Manganese suppresses tumor growth through hyper-activating IRE1α

Summary

IRE1α and its downstream XBP1 signal is the most conserved unfolded protein response pathway that cells utilize to combat endoplasmic reticulum stress, also known to be utilized by tumor cells to adapt to harsh environment, leading to tumor progression. Several inhibitors against IRE1α have been developed, some of which show promising effect in clinical trial for cancer therapy, but none of them have been used in practice. Considering that hyper-activation of IRE1α induces cell death, we hypothesize that activation of IRE1α could be an alternative way for tumor suppression. Here, we identified divalent manganese ion as a potent activator to IRE1α, which interacts with the cytosolic part of IRE1α directly, augmenting the downstream pro-apoptotic pathway but not the pro-survival outcome. Mn²⁺ limits tumor growth in xenograft model in an IRE1α-dependent way. Our finding suggests pharmacological activation of IRE1α as an underestimated but promising way in cancer therapy.

Graphical abstract

Highlights

• •Mn²⁺ binds to cytosolic segment of IRE1α and promotes its oligomerization
• •Mn²⁺ hyper-activates IRE1α and induces downstream terminal UPR under ER stress
• •Mn²⁺ does not elevate XBP1s expression
• •Mn²⁺ as an IRE1α activator impairs tumor growth in xenograft model

Biological sciences; molecular biology; cancer systems biology; cancer

Introduction

Endoplasmic reticulum (ER) stress is a condition characterized by the accumulation of misfolded and unfolded proteins in the ER lumen that exceeds the protein processing capacity. Under ER stress, cells initiate the unfolded protein response (UPR) to restore ER homeostasis.¹ Genetic mutation, metabolic abnormality, chemotherapy, among others, constitutively challenges the protein folding in tumor cells to cause ER stress.² Activation of the tumoral UPR is notorious for its contribution to tumor progression by building up cell adaptation, bypassing antitumor immunity, and facilitating angiogenesis and metastasis.³

As the most conserved UPR pathway, IRE1α has been extensively studied for its role in tumor progression.⁴ IRE1α is an ER-transmembrane kinase and RNase which, upon ER stress, undergoes dimerization/oligomerization and trans-autophosphorylation, activating the RNase domain to initiate the mRNA splicing of XBP1.⁵ Removal of a 26-nucleotide intron results in the translation of XBP1s (s, spliced), a transcription factor that plays key roles in cell adaptation (adaptive UPR).^6,7,8 In many cancers, IRE1α-XBP1 signal positively correlates with tumor malignancy and presages poor survival of the patients. Thus, IRE1α-XBP1 has been regarded as a potential target for cancer therapy. Many IRE1α inhibitors have been developed.⁴ However, none of them have been used clinically.

Although IRE1α-XBP1 serves to maintain ER homeostasis, unmitigated IRE1α activation can also elicit cell death, especially during severe and chronic ER stress. This has been studied extensively, ranging from IRE1α′s role in mRNA and microRNA degradation (termed regulated IRE1α-dependent decay, abbr. RIDD) to activation of JNK phosphorylation.^9,10,11 Importantly, the pro-death effect of IRE1α (terminal UPR), no matter RIDD or JNK phosphorylation, requires fully activated, auto-phosphorylated IRE1.^9,11,12 In contrast, XBP1 mRNA is a highly specific substrate of IRE1α whose cleavage can be achieved with partially active, kinase-dead IRE1α mutant.^11,13 Furthermore, somatic IRE1α gene mutations have been found in human cancers, which showed partially impaired auto-phosphorylation but with XBP1 splicing activity unaffected when overexpressed in cells. Unlike fully active wild-type IRE1α, these mutants did not induce cell apoptosis.^11,14 Here, we refer to the state of IRE1α competent in degrading RIDD substrates and causing JNK phosphorylation as hyper-active state in order to distinguish it from the state of IRE1α that is capable of XBP1 splicing but unable to initiate the pro-death signals. Considering that tumor tissues experience ER stress and have basal level of IRE1α activation, we proposed that forced hyper-activation of IRE1α could be an alternative way in cancer therapy. However, very few have been done in developing IRE1α activators. A recent study reported a high-throughput screening that identified IXA4 as a small compound to activate IRE1-XBP1 pathway, yet the molecular target of the compound is still unclear.¹⁵ CRUK-3 and quercetin can also activate IRE1α RNase activity, but both act as kinase inhibitors.^16,17

Here, we reported that divalent Mn ion (Mn²⁺) causes cell death in the context of ER stress in an IRE1α-dependent manner by upregulating the activity of IRE1α and the downstream pro-apoptotic signals. Mn²⁺ promotes IRE1α phosphorylation and oligomerization, and activates the downstream pro-apoptotic signals yet with the protective XBP1 pathway unaffected. Mn²⁺ administration repressed tumor progression in mice experiment in an IRE1α-dependent manner, suggesting that Mn²⁺-driven hyperactivation of IRE1α could be a potential strategy for cancer therapy.

Results

Mn²⁺ impairs cell viability and increases ER stress-induced cell death in an IRE1α-dependent manner

Divalent ions play essential roles in cellular function and are tightly linked with the pathology of many diseases. In search of divalent ions that may hyper-activate IRE1α to a level that hinder tumor cell growth, we found that Mn²⁺ impaired cell viability and aggravated cell death in MDA-MB-231, a human triple-negative breast cancer (TNBC) cell line. We chose MDA-MB-231 because it has intrinsically highly activated IRE1α, which we think may be more prone to be hyper-activated.¹⁸ Mn²⁺ had no effect on cell viability nor caused cell death by itself, but showed cytotoxicity in a dose-dependent manner in the presence of thapsigargin (Tg), an ER stress inducer (Figures 1A and 1B). Notably, the cytotoxic effect is ion-type specific, since other essential divalent ions, including Ca²⁺, Mg²⁺, Zn²⁺, and Cu²⁺, did not decrease cell viability in the context of ER stress (Figures S1A and S1B).

Figure 1.

Mn²⁺ impairs cell viability and increases ER stress-induced cell death in an IRE1α-dependent manner

(A) Cell viability detected by the MTT assay. MDA-MB-231 cells were treated with or without Tg (0.2 μM) in the absence or presence of different concentrations of MnCl₂ for 24 h (n = 6).

(B) Cell death percentage in MDA-MB-231 cells measured by Annexin V staining. Cells were treated as in (A). The percentage of Annexin V-positive cells was shown (n = 3).

(C) Cell death percentage in MDA-MB-231 WT and IRE1α KO cells measured by Annexin V staining. Cells were treated with Tg (0.2 μM), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 24 h (n = 3).

(D) Cell death percentage in MDA-MB-231 WT and IRE1α KO cells measured by Annexin V staining. Cells were cultured under physiological conditions or subjected to oxygen-glucose deprivation (OGD) for 8 h with or without MnCl₂ (100 μM) (n = 3).

(E) Cell death percentage in MDA-MB-231 WT and IRE1α KO cells measured by Annexin V staining. Cells were treated with Tm (1 μg/mL), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 48 h (n = 3).

(F) Cell death percentage in MDA-MB-231 cells measured by Annexin V staining. Cells were treated with PTX (100 μM), MnCl₂ (100 μM) and KIRA8 (1 μM) alone or in combination for 24 h (n = 3).

(G) Cell death percentage in BT-474 and MDA-MB-453 cells measured by Annexin V staining. BT-474 and MDA-MB-453 cells were treated with Tg (0.2 μM), MnCl₂ (100 μM) and KIRA8 (1 μM) alone or in combination for 12 h and 24 h, respectively (n = 3). Data are presented as mean ± SEM. Statistical analysis was performed by unpaired Student’s t test. ns, not significant; ∗∗p < 0.01; ∗∗∗p < 0.001. See also Figure S1.

The cytotoxic effect of Mn²⁺ was only observed in the presence of ER stress, suggesting that a basal activation of the UPR is a prerequisite. We hypothesized that Mn²⁺ enhanced the activity of the UPR signals to exceed a threshold, exerting the pro-apoptotic function. Constitutive overexpression of IRE1α has been reported to induce cell apoptosis.¹¹ Interestingly, pharmacological inhibition of IRE1α pathway with KIRA8,^19,20 or genetic deletion of IRE1α, reduced the cell apoptotic level, suggesting that IRE1α activation could be a reason for cell death (Figure 1C).

We then induced ER stress by culturing cells under oxygen-glucose deprivation (OGD), protein glycosylation inhibitor tunicamycin (Tm), or chemotherapy drug paclitaxel (PTX). Mn²⁺ acted synergistically with each condition to promote cell apoptosis in an IRE1α-dependent way (Figures 1D–1F). Consistent results were observed in another two breast cancer cell lines, BT-474 and MDA-MB-453 (Figure 1G).

The effects of Mn²⁺ on the other two branches of the UPR, PERK, and ATF6, were also examined. Mn²⁺ slightly activated ATF6 cleavage, but did not induce PERK phosphorylation or the downstream ATF4 expression, and had no effect on the amount of ER-resident chaperone BIP. However, under Tg-induced ER stress, Mn²⁺ further enhanced PERK phosphorylation as well as the protein level of ATF4 and cleaved ATF6 (Figures S1C and S1D). These results suggested that Mn²⁺ per se did not cause ER stress but may aggravate ER stress under Tg. We could not exclude the possibility that PERK activation was involved in Mn²⁺-induced apoptosis, since the mRNA level of CHOP, downstream of PERK, was elevated by Mn²⁺ in the presence of Tg or Tm in both MDA-MB-231 and MDA-MB-453 cells, and that pharmacological inhibition of PERK reduced Mn²⁺-induced apoptosis (Figures S1E–S1H). Nevertheless, Mn²⁺-induced apoptosis was more readily suppressed by KIRA8 than with PERK inhibitor GSK2606414 or ATF6 inhibitor Ceapin-A7 (Figure S1H). Therefore, we primarily focused on the role of IRE1α in Mn²⁺-induced enhancement of apoptosis.

Mn²⁺ promotes the terminal UPR downstream of IRE1α but spares the adaptive UPR unaffected

To elucidate whether Mn²⁺ activates IRE1α, we then examined IRE1α pathway activity in ER-stressed cells in the presence or absence of Mn²⁺. Upon activation, IRE1α undergoes dimerization and oligomerization, and becomes auto-phosphorylated. We found that Mn²⁺ led to a shift of endogenous IRE1α to the high-molecular-weight fractions (Figure 2A). To visualize the oligomerization of IRE1α, we expressed a GFP-tagged IRE1α in the cell, and examined the puncta formation upon Tg treatment. Tg-induced puncta formation as expected. Importantly, this was further boosted by Mn²⁺ (Figure 2B). In line with this, Mn²⁺ advanced the Tg-induced IRE1α phosphorylation and the downstream XBP1 splicing (Figures 2C–2F). This was also the case for cells under OGD condition, where Mn²⁺ promotes both IRE1α phosphorylation and XBP1 splicing (Figures S2A–S2D). Notably, Mn²⁺ itself did not promote IRE1α oligomerization, and had no effect on IRE1α phosphorylation or XBP1 splicing (Figures 2B–2F and S2A–S2D). On the other hand, Mn²⁺ was able to increase the phosphorylation level of over-expressed IRE1α that was intrinsically phosphorylated, even in the absence of ER stress (Figures 2G and 2H). Thus, Mn²⁺ serves as an amplifier to increase the activity of IRE1α once IRE1α is partially activated.

Figure 2.

Mn²⁺ promotes the terminal UPR downstream of IRE1α but spares the adaptive UPR unaffected

(A) The oligomerization of IRE1α detected by immunoblotting assay. MDA-MB-231 cells were treated with Tg (0.2 μM) and MnCl₂ (100 μM) alone or in combination for 24 h. Cell lysates were separated by sucrose density gradient centrifugation (20%–40%).

(B) Representative immunofluorescence image (Left) and the quantitative result (Right) of hIRE1α-sfGFP puncta in MDA -MB-231 IRE1α KO cells that stably express hIRE1α-sfGFP cells in a Dox-inducible way. Magnified views of the red-boxed regions are shown on the right of each original image. Cells were pretreated with Dox (5 μg/mL) for 20 h, followed by MnCl₂ (100 μM) treatment for 4 h. Hoechst was used to identify the nucleus. Scale bar: 10 μm.

(C) Phosphorylation of IRE1α and activation of its downstream signaling pathway in MDA-MB-231 WT and IRE1α KO cells measured by immunoblotting assay. Cells were treated with Tg (0.2 μM), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 24 h. Diamond denotes non-specific band.

(D) Quantitative gray value analysis of p-IRE1α/t-IRE1α (by Phos-tag), p-JNK/JNK, XBP1s/GAPDH, and cleaved caspase-3/caspase-3 in (C) (n = 3). Relative ratio was shown, with ratio in lane 3 (Tg treatment for IRE1α WT) set as 1.

(E) Agarose gel of XBP1 cDNA amplicons from MDA-MB-231 WT and IRE1α KO cells. Cells were treated as in (C). U, unspliced XBP1; S, spliced XBP1.

(F) Quantitative gray value analysis of S/(S + U) in (E) (n = 4).

(G) Immunoblotting assay of IRE1α phosphorylation and its downstream signaling pathways in MDA-MB-231 IRE1α KO cells that stably express exogenous IRE1α in a Dox-inducible way. Cells were pretreated with Dox (200 ng/mL) for 24 h, and then incubated with MnCl₂ (200 μM) for 48 h. Relative ratio was shown, with ratio in lane 3 (OE IRE1α WT) set as 1.

(H) Quantitative gray value analysis of p-IRE1α/t-IRE1α (by Phos-tag), p-JNK/JNK, and XBP1s/GAPDH in (G) (n = 4).

(I) The mRNA expression level of BLOS1 in MDA-MB-231 cells detected by RT-qPCR. Cells were pretreated with ActD (2 μg/mL) for 1 h, then treated with Tg (0.2 μM), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 24 h (n = 3).

(J) The mRNA expression level of BLOS1 in MDA-MB-231 cells detected by RT-qPCR. Cells were pretreated with ActD (2 μg/mL) for 1 h, then treated with Tm (1 μg/ml), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 48 h (n = 3).

(K) The mRNA expression level of BLOS1 in BT-474 and MDA-MB-453 cells detected by RT-qPCR. BT-474 and MDA-MB-453 cells. BT-474 and MDA-MB-453 cells were pretreated with ActD (2 μg/mL) for 1 h, then treated with Tg (0.2 μM), MnCl₂ (100 μM), and KIRA8 (1 μM) alone or in combination for 12 h and 24 h, respectively (n = 3).

(L) The interaction of IRE1α and TRAF2 in MDA-MB-231 cells detected by co-immunoprecipitation. Cells were treated with Tg (0.2 μM) and MnCl₂ (100 μM) alone or in combination for 24 h.

(M) Cell death percentage in MDA-MB-231 cells measured by Annexin V staining. Cells were pretreated with or without CC401 (5 μM) for 1 h, then incubated with Tg (0.2 μM) and MnCl₂ (100 μM) alone or in combination for 24 h (n = 3).

(N) Cell death percentage in MDA-MB-231 cells measured by Annexin V staining. Cells were pretreated with z-VAD-FMK (z-VAD, 20 μM), ferrostatin-1 (Fer, 1 μM), necrostatin-1 (Nec, 80 μM), bafilomycin A1 (Baf, 10 nM), disulfiram (Dis, 10 μM) for 24 h or cycloheximide (CHX, 2 μM) for 6 h, and further treated with Tg (0.2 μM) and MnCl₂ (100 μM) alone or in combination for 24 h (n = 3). Data are presented as mean ± SEM. Statistical analysis was performed by unpaired Student’s t test. ns, not significant; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001. See also Figures S2 and S3.

In cells that experience ER stress, IRE1α plays dual roles in cell fate decision. On one hand, IRE1α serves as an RNase to initiate XBP1 mRNA splicing, resulting in the translation of a transcription factor XBP1s that restores the ER homeostasis. On the other hand, persistent activation of IRE1α decreases the RNA substrate selectivity and results in rampant degradation of certain mRNAs and micro-RNAs, leading to cell dysfunction and programmed cell death.^9,10,21 IRE1α could also interact with TRAF2, activating the downstream pro-apoptotic JNK signaling.¹² We found that Mn²⁺ failed to elevate the protein amount of XBP1s despite an increased XBP1 splicing ratio in both Tg- and OGD-treated cells (Figures 2C–2F and S2A–S2D). Similarly, in IRE1α-overexpressing cells that had XBP1s expression induced, Mn²⁺ was unable to further increase XBP1s protein level (Figures 2G and 2H). Polysome profiling revealed a shift of XBP1s mRNA from the polysome fraction to the 40S and 60S ribosomal subunits fraction with Mn²⁺ treatment under Tg-induced ER stress, indicating that Mn²⁺ impaired the translation efficiency of XBP1s mRNA (Figure S3). Considering the bona fide effect of XBP1s, this result implied that Mn²⁺-induced IRE1α activation may not benefit cells in combatting ER stress.

Rather, Mn²⁺ aggravated the Tg-, Tm-, or OGD-induced mRNA level decrease for BLOS1, a known RNA substrate of IRE1α, indicating an increased level of RIDD.²² The decrease in BLOS1 could be suppressed by IRE1α inhibition (Figures 2I and 2J; S2E). Consistent with our findings in MDA-MB-231 cells, the Mn²⁺-induced, IRE1α-dependent reduction of BLOS1 mRNA under ER stress was also observed in BT-474 and MDA-MB-453 cell lines (Figure 2K). Furthermore, Mn²⁺ significantly promoted IRE1α-TRAF2 interaction and advanced the JNK phosphorylation and the downstream caspase-3 cleavage in Tg-treated cells but not naive cells (Figures 2C and 2D, and 2L). Both JNK phosphorylation and caspase-3 cleavage were suppressed upon IRE1α inhibition or deletion, supporting the idea that Mn²⁺ activated JNK signaling through IRE1α (Figures 2C and 2D). In addition, the inhibition of JNK with CC401 significantly reduced the apoptotic level in Mn²⁺- and Tg-treated MDA-MB-231 cells, consistent with its pro-apoptotic role (Figure 2M). We further examined the contribution of different type of cell death to the cytotoxicity of Mn²⁺ by inhibiting various types of cell death. Z-VAD, pan caspase inhibitor, significantly reduced cell death that was triggered by Tg and aggravated by Mn²⁺ (Figure 2N). In cells experiencing OGD, Mn²⁺ also promoted JNK phosphorylation and caspase-3 cleavage in an IRE1α-dependent manner (Figures S2A and S2B). Similarly, Mn²⁺ increased cell death under OGD treatment, which can be alleviated by JNK inhibition or caspase inhibition (Figures S2F and S2G). Finally, while IRE1α overexpressing per se was unable to induce JNK phosphorylation, this pro-death signal became pronounced upon Mn²⁺ treatment (Figures 2G and 2H). Thus, Mn²⁺ promotes JNK- and caspase-dependent cell death whenever IRE1α is partially activated by further activating IRE1α and its downstream terminal UPR but not adaptive UPR.

Mn²⁺ binds to the cytosolic domain of IRE1α, promoting its auto-phosphorylation and RNase activity

We wondered whether Mn²⁺ directly activated IRE1α. To this end, we expressed both the luminal domain (IRE1α(LD), residues 24–441) and cytosolic fractions of IRE1α (IRE1α(CD), residues 469–977), and measured the protein melting curve in the presence or absence of Mn²⁺ by thermal shift assay (TSA) (Figures 3A and 3B). Mn²⁺ increased the melting temperature of IRE1α(CD), but not IRE1α(LD), in a concentration-dependent manner, indicating a direct interaction between Mn²⁺ and the cytosolic domain of IRE1α (Figures 3C–3F). Furthermore, Mn²⁺ increased the phosphorylation level of IRE1α(CD), which was even not observed with same concentration of Mg²⁺, suggesting that Mn²⁺ may be a more potent cofactor than Mg²⁺ for IRE1α kinase activity (Figures 3G and 3H). Not only this, Mn²⁺ augmented IRE1α(CD) dimerization, increased the IRE1α(CD) RNase activity toward a synthesized XBP1 RNA fragment that harbors the cleavage site for IRE1α, and promoted the in vitro degradation of mouse Ins2 mRNA by IRE1α(CD) (Figures 3I–3L). These in vitro experiments demonstrated that Mn²⁺ directly binds to and activates IRE1α.

Figure 3.

Mn²⁺ binds to the cytosolic domain of IRE1α, promoting its auto-phosphorylation and RNase activity

(A) Schematic diagram of hIRE1α.

(B) SDS-PAGE of the purified ER luminal domain (24–441) of hIRE1α (hIRE1α[LD]) and the cytoplasmic domain (469–977) of hIRE1α (hIRE1α[CD]).

(C) The unfolding curve of recombinant hIRE1α(CD) (residues 469–977) protein (2 μM) incubated with different concentrations of MnCl₂ measured by thermal shift assay. The melting temperature (Tm) corresponds to the horizontal axis value at the point of maximum slope (n = 4).

(D) Comparison of the melting temperature of hIRE1α (CD) incubated with MnCl₂ (n = 4).

(E) The unfolding curve of recombinant hIRE1α(LD) protein (2 μM) incubated with different concentrations of MnCl₂ measured by thermal shift assay. The melting temperature (Tm) corresponds to the horizontal axis value at the point of maximum slope (n = 6).

(F) Comparison of the melting temperature of hIRE1α(LD) incubated with MnCl₂ (n = 6).

(G) The phosphorylation of hIRE1α(CD) was detected by Phos-tag immunoblotting assay. hIRE1α(CD) protein was incubated with different concentrations of Mn²⁺ or Mg²⁺ at room temperature for 2 h.

(H) Quantitative analysis of p-IRE1α/t-IRE1α (by Phos-tag) in (G) (n = 4).

(I) The oligomerization of hIRE1α(CD) was detected by immunoblotting assay. hIRE1α (CD) (10 μM) was incubated with or without MnCl₂ (1 or 2 mM) for 90 min at room temperature, then crosslinked by adding 250 μM disuccinimidyl suberate for 30 min.

(J) Quantitative analysis of (dimer+oligomer)/monomer in (I) (n = 3).

(K) The RNase activity of hIRE1α(CD) was detected by the in vitro cleavage assay. hIRE1α(CD) (1 μM) protein was incubated with MnCl₂ (1 mM) for 20 min at room temperature, followed by incubation with 3 μM RNA substrate for 5 min. The reaction was quenched by adding urea to a final concentration of 4 M. The fluorescence of mini-XBP1 was detected using a microplate reader (n = 3).

(L) The degradation of mouse Ins2 mRNA (mIns2) was detected by the TBE urea polyacrylamide gel. hIRE1α(CD) (5 μM) was incubated with in vitro-transcribed RNA of mIns2 (110 nt) (0.5 μM), and MnCl₂ (2 mM) at 30°C for 2 h.

(M) The unfolding curve of recombinant hIRE1α(CD) (residues 469–977) protein (2 μM) incubated with KIRA8 (5 μM) and different concentrations of MnCl₂ measured by thermal shift assay. The melting temperature (Tm) corresponds to the horizontal axis value at the point of maximum slope (n = 4).

(N) Comparison of the melting temperature of hIRE1α(CD) incubated with KIRA8 and MnCl₂ (n = 4).

(O) The unfolding curve of recombinant hIRE1α(CD) (residues 469–977) protein (2 μM) incubated with MKC8866 (20 μM) and different concentrations of MnCl₂ measured by thermal shift assay. The melting temperature (Tm) corresponds to the horizontal axis value at the point of maximum slope (n = 4).

(P) Comparison of the melting temperature of hIRE1α(CD) incubated with MKC8866 and MnCl₂ (n = 4).

(Q) The unfolding curve of recombinant hIRE1α(CD) (residues 469–977) protein (2 μM) incubated with MgCl₂ (10 mM) and different concentrations of MnCl₂ measured by thermal shift assay. The melting temperature (Tm) corresponds to the horizontal axis value at the point of maximum slope (n = 4).

(R) Comparison of the melting temperature of hIRE1α(CD) incubated with MgCl₂ and MnCl₂ (n = 4). Data are presented as mean ± SEM. Statistical analysis was performed by unpaired Student’s t test. ns, not significant; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001. See also Figure S4.

To further understand how Mn²⁺ binds with IRE1α(CD), we employed KIRA8 (also called compound 18) and MKC8866, which specifically bind to the ATP pocket of the kinase domain and the RNase domains of IRE1α, respectively.^23,24 KIRA8, but not MKC8866, increased the melting temperature of IRE1α(CD) to a level less than Mn²⁺. Remarkably, Mn²⁺ failed to increase the melting temperature of IRE1α(CD) in the presence of KIRA8, suggesting that KIRA8 occupies the ATP docking site where Mn²⁺ binds to. On the contrary, the RNase domain-binding compound MKC8866 did not interfere with Mn²⁺ in elevating the melting temperature of IRE1α(CD) (Figures 3M–3P, compared to Figures 3C and 3D). In addition, the melting temperature of IRE1α(CD) was readily elevated by Mg²⁺, the kinase cofactor that binds to the ATP pocket, and was unaffected by low dose of Mn²⁺, but became further elevated when increasing the concentration of Mn²⁺ and finally reached roughly the same level as with Mn²⁺ alone. This is a strong indication that Mn²⁺ competes with Mg²⁺ to bind to IRE1α(CD) at the same site (Figures 3Q and 3R, compared to Figures 3C and 3D).

Given that Mn²⁺ may compete with Mg²⁺ in IRE1α binding, we examined whether Mn²⁺-induced activation of IRE1 could be attributed to its influence on Mg²⁺. To this end, intracellular Mn²⁺ and Mg²⁺ concentrations were quantified by inductively coupled plasma mass spectrometry (ICP-MS). Mn²⁺ addition increased the intracellular Mn²⁺ level, especially under ER stress condition. Meanwhile, intracellular Mg²⁺ level declined with Mn²⁺ exposure, suggesting a perturbation on Mg²⁺ homeostasis (Figures S4A and S4B). However, treatment of Mn²⁺ alone, though able to reduce the intracellular Mg²⁺ level, could not activate IRE1α or induce apoptosis in cell culture. Thus, the decline of Mg²⁺ concentration was not sufficient to cause IRE1α activation or cell apoptosis. In addition, in the presence of Tg, Mn²⁺ was able to promote IRE1α phosphorylation and apoptosis but had no effect on intracellular Mg²⁺ level, suggesting that Mn²⁺-induced IRE1α activation and cell apoptosis was not due to perturbation of Mg²⁺ homeostasis in the cell. Finally, addition of Mg²⁺ did not compromise Mn²⁺- and Tg-induced apoptosis (Figure S4C). Taken together, perturbation of Mg²⁺ homeostasis is unlikely a reason for IRE1α activation or cell apoptosis under ER stress and Mn²⁺ treatment.

Mn²⁺ impairs tumor growth in orthotopic model

Next, we examined the effect of Mn²⁺ on tumor growth in mice orthotopically transplanted with MDA-MB-231 (either WT or IRE1α-KO) cells into the mammary fat pad. Injection of Mn²⁺ impaired WT tumor growth, but could not limit IRE1α-KO tumor growth (Figures 4A–4D). Mn²⁺ had no effect on mice weight (Figure 4E). We found that Mn²⁺ administration increased the phosphorylation level of IRE1α and JNK (Figures 4F and 4G). Interestingly, XBP1s protein level was not increased, but rather decreased upon Mn²⁺ treatment, indicating again that Mn²⁺ did not promote the pro-survival signal downstream of IRE1α (Figures 4F and 4G). As for IRE1α-KO tumors, we did not see upregulation of JNK phosphorylation or tumor growth retardation after Mn²⁺ treatment (Figures 4B–4D, and 4H). Finally, cell apoptosis in tumor tissue was examined by TUNEL staining. As expected, Mn²⁺ treatment increased cell apoptosis in WT, but not IRE1α-KO tumors, demonstrating that Mn²⁺ promotes tumor cell death and retards tumor growth through activating IRE1α (Figures 4I and 4J).

Figure 4.

Mn²⁺ impairs tumor growth in orthotopic model

(A) The schematic of the MnCl₂ treatment schedule. The mammary fat pad of BALB/c nude mice were orthotopically inoculated with MDA-MB-231 WT or IRE1α KO cells (1.5×10⁶ cells per mouse), and intratumorally injected with saline or MnCl₂ (5 mg/kg) every two days from day 8. Tumors were collected on day 18 after mice execution.

(B–E) Photograph of tumor (B) and tumor weight (C) measured after mice execution. Tumor volume (D) and the body weight (E) of mice inoculated with MDA-MB-231 WT or IRE1α KO cells during drug injection were recorded (n = 7).

(F) Immunoblotting assay of IRE1α phosphorylation and its downstream signaling pathways in tumor tissues isolated from MDA-MB-231 WT cell-injected mice.

(G) Quantitative analysis of p-IRE1α/t-IRE1α (by Phos-tag), p-JNK/JNK, and XBP1s/H3 in (F) (n = 7).

(H) Immunoblotting assay of IRE1α phosphorylation and its downstream signaling pathways in tumor tissues isolated from MDA-MB-231 IRE1α KO cell-injected mice.

(I) Cell apoptosis in tumor tissues detected by TUNEL staining. Scale bar: 100 μm.

(J) Quantitative analysis of TUNEL positive area in (I) (n = 7). Data are presented as mean ± SEM. Statistical analysis was performed by unpaired Student’s t test. ns, not significant; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001.

Discussion

Numerous studies have shown that the UPR, especially IRE1α-XBP1 branch, is activated in tumor tissue and is associated with tumor growth and progression.^{18,24,25,26,27} Attempts to limit tumor growth by shutting down this pro-survival pathway is quite reasonable and have attracted many researchers, leading to the development of highly selective and potent IRE1α inhibitors.^4,28,29,30 While attractive and promising, such strategy may have potential shortcomings. First, inhibition of IRE1α-XBP1 cripples adaptive UPR and may aggravate ER stress. This could be detrimental to normal secretory cells that intrinsically experience ER stress and require IRE1α-XBP1 to maintain the ER homeostasis under physiological conditions. Second, at the dosage that is insufficient to inhibit XBP1 splicing, IRE1α inhibitor may still be able to turn off the pro-death outcome of IRE1α, which usually requires IRE1α hyper-activation and is thus more sensitive to inhibitors. In that case, inhibition of IRE1α may have potential risk in promoting tumor cell growth as it blocks the terminal UPR but keeps adaptive UPR partially functional.

An IRE1α activator may serve as a new strategy to avoid these shortcomings, especially considering that tumor tissue has higher IRE1α activities than normal tissues. Ideally, such activator should not activate IRE1α by itself, but only be effective when cells are already undergoing ER stress and have IRE1α partially activated. Here, we identified Mn²⁺ as a potent IRE1α activator, which luckily meets this goal. Our observation that Mn²⁺ per se does not cause ER stress is different from a previous report in which Mn²⁺ induces ER stress and activates all the three UPR pathways, including IRE1α, possibly due to cell type specificity.³¹ Not only this, Mn²⁺ failed to elevate XBP1s at the protein level, although it promotes XBP1 splicing. We found that Mn²⁺ limited the translation of XBP1s. The reason for this still needs further study, and one possibility is that the pro-death outcomes dominates when IRE1α is hyper-activated, leaving no chance for cells to synthesize enough XBP1s protein to survive. Activating the pro-death pathway while leaving the pro-survival outcome of IRE1α unaffected, or even reduced, makes Mn²⁺ a promising reagent for cancer treatment. We envisage Mn²⁺-mediated IRE1α activation as an alternative strategy in cancer therapy besides IRE1α inhibition, especially for tumors with intrinsically high level of IRE1α activity.

A previous study showed that IRE1, but not HAC1 (the homolog of XBP1), is required to bypass Mn²⁺ toxicity in the yeast Candida albicans, suggesting that other pro-survival signals besides HAC1 splicing were activated downstream of IRE1. This seems different from our observation that Mn²⁺-induced IRE1α activation was cytotoxic. Such discrepancy could be due to species difference. IRE1 in the fission yeast Schizosaccharomyces pombe truncates BIP mRNA and renders it more stable,³² a unique mechanism of adaptive UPR that may also exist in Candida albicans but not mammals. On the other hand, it remains unknown whether Candida albicans lacks the IRE1-TRAF2-JNK pathway, which accounts for the terminal UPR in mammals. It would be interesting to analyze whether Mn²⁺-activated IRE1 could be cytoprotective under various conditions or in different species.

It remains an interesting question that how Mn²⁺ activates IRE1α. We found that Mn²⁺ interacts with the lumenal domain of IRE1α directly. Like many other kinases, IRE1α requires Mg²⁺ for ATP binding. Mn²⁺ and Mg²⁺ can replace each other in binding with many enzymes, including kinase.³³ It is possible that Mn²⁺ binds to IRE1α kinase domain similar as Mg²⁺, facilitating ATP binding and phosphate transfer. The TSA result supported this hypothesis. Notably, Mn²⁺ is more potent than Mg²⁺ in inducing IRE1α auto-phosphorylation (Figures 3G and 3H). This may explain why Mn²⁺, but not Mg²⁺, is cytotoxic when cells are experiencing ER stress. Although rare, some kinases do prefer Mn²⁺ over Mg²⁺ as a cofactor, for example casein kinase 2.³⁴ Our study suggests IRE1α to be one of those Mn²⁺-prone kinases. The structural mechanism and physiological relevance of such preference to Mn²⁺ require further study.

Safety of Mn²⁺ usage in cancer therapy should be carefully considered. We did not see cytotoxicity of Mn²⁺ in cell culture. In addition, administration of Mn²⁺ did not cause weight loss in mice. In fact, Mn²⁺-based reagents and chemicals have been widely used in clinic. For example, MnCl₂ is commonly used for manganese-enhanced magnetic resonance imaging.³⁵ Mn²⁺-based nanoparticles have been used in chemodynamic therapy, which accelerate the fenton reaction to generate hydroxyl radical in tumor microenvironment.^36,37,38 Furthermore, Mn²⁺-based nanoparticles could serve as an adjuvant to regulate tumor immune microenvironment and enhance immunotherapy, thanks to the ability of Mn²⁺ in activating cGAS-STING pathway.³⁹ However, one still need to be cautious with long-term Mn²⁺ treatment, as Mn²⁺ can accumulate in the central nervous system and leads to neurotoxicity.⁴⁰ Meanwhile, we cannot exclude the possibility that Mn²⁺ induces tumor cell death through binding to proteins other than IRE1α. While our study does not find a specific activator for IRE1α, it does suggest that an ever-been-ignored facet of IRE1α function, in pro-cell death, could be employed and pharmacologically amplified for the purpose of cancer therapy. We look forward to more potent and specific IRE1α activators been developed and practically utilized in the future.

Limitations of the study

In this study, we focused primarily on Mn²⁺ binding to and hyper-activating IRE1α to enhance tumor cell death, and we cannot exclude the possibility that the interaction of Mn²⁺ with other proteins may also contribute to this process. While our study provides a proof of concept of using IRE1α activator in cancer therapy, the development of specific IRE1α activators remains to be addressed. In addition, we observed that Mn²⁺ suppresses the translation of XBP1s protein under ER stress conditions, but the underlying mechanism remains unclear. Finally, although we confirmed that Mn²⁺ promotes cell death under ER stress using three breast cancer cell lines, its effects on other types of tumors have not been investigated.

Resource availability

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Likun Wang (wanglikun@ibp.ac.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

• •All data reported in this paper will be shared by the lead contact upon request.
• •This paper does not report original code.
• •Any additional information required to reanalyze the data reported will be shared by the lead contact upon request.

Acknowledgments

We are grateful to Prof. Chih-chen Wang and Dr. Lei Wang laboratory (Institute of Biophysics, CAS) who provide MDA-MB-231 cell line. BT-474 and MDA-MB-453 cell lines are generous gifts from Dr. Moshi Song laboratory (Institute of Zoology, CAS). We thank Dr. Yang Yu (Guangzhou Women and Children’s Medical Center; Institute of Biophysics, CAS) for a generous gift of pcW-cas9 plasmid. Thanks to the members of the Wang laboratory for helpful discussions. Acknowledgments are given to Junying Jia (Core Facility, Institute of Biophysics, CAS) for helping with FACS, Ya Wang (Core Facility, Institute of Biophysics, CAS) and Dr. Tao Li (School of Basic Medical Sciences, Peking University) for helping with thermal shift assay, and Chunliu Liu and Yun Feng (Center for Biological Imaging, Institute of Biophysics, CAS) for taking and analyzing confocal images. This work was supported by the National Key R&D Program of China (2021YFA1300800), the National Natural Science Foundation of China (92354303, 32170785), CAS Youth Interdisciplinary Team funding (JCTD-2021-07), and the Strategic Priority Research Program of CAS (XDB37020305).

Author contributions

L.W. designed the study. R.S. and M.W. performed the majority of the experiments. S.C. and X.H. helped with protein purification. S.C., X.Z., S.Z., C.F., and Z.Z. helped with animal experiments. X.Z. and S.Z. helped with sucrose density gradient centrifugation. R.S., M.W., and L.W. analyzed the data. R.S. and L.W. wrote the manuscript.

Declaration of interests

The authors declare no competing interests.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
IRE1α	Cell Signaling Technology	Cat#3294S; RRID: AB_823545
p-IRE1α (Ser 724)	Abcam	Cat#ab124945; RRID: AB_11001365
XBP1s	Cell Signaling Technology	Cat#12782s; RRID: AB_2687943
JNK	Cell Signaling Technology	Cat#9252S; RRID:AB_2250373
p-JNK	Cell Signaling Technology	Cat#4668S; RRID:AB_823588
Caspase-3	Cell Signaling Technology	Cat#14220T; RRID:AB_2798429
Cleaved-Caspase-3	Cell Signaling Technology	Cat#9664S; RRID:AB_2070042
GAPDH	Proteintech	Cat#60004-1; RRID: AB_2107436
TRAF2	Santa Cruz	Cat#sc-136999; RRID:AB_2209298
Histone H3	Gene-Protein Link	Cat#P01L24; RRID:AB_11219006
Chemicals, peptides, and recombinant proteins
MnCl2	Sigma	Cat#M5005
Thapsigargin (Tg)	Sigma	Cat#T9033
Tunicamycin (Tm)	Abcam	Cat#ab120296
Paclitaxel (PTX)	TargetMol	Cat#T0968
KIRA8	WuXi AppTec	N/A
GSK2606414 (GSK)	Merck	Cat#516535
Ceapin-A7	Sigma	Cat#SML2330
CaCl2	Sinopharm Chemical Reagent	Cat#10005861
MgCl2	Sinopharm Chemical Reagent	Cat#10012818
ZnCl2	Sigma	Cat#Z0152
CuCl2	Sinopharm Chemical Reagent	Cat#10007818
HNO3	Sinopharm Chemical Reagent	Cat#10014518
MTT	Sigma	Cat#V900888
Phos-tag™ Acrylamide AAL-107	WAKO	Cat#304-93521
Actinomycin D (ActD)	MCE	Cat#HY-17559
CC401	MCE	Cat#HY-13022
Doxycyclin (Dox)	Cayman	Cat#14422
1-NM-PP1	TargetMol	Cat#T2153
Z-VAD-FMK	GLPBIO	Cat#GC12861
Ferrostatin-1	Aladdin	Cat#F129882
Necrostatin–1	GLPBIO	Cat#GC11008
Cycloheximide	GLPBIO	Cat#GC17198
Brefeldin A	Biolegend	Cat#420601
Disulfiram	GLPBIO	Cat#GC10801
Disuccinimidyl suberate (DSS)	Thermo Fisher	Cat#21655
ATP	Sigma	Cat#A7699
Dithiothreitol (DTT)	Amresco	Cat#0281
Critical commercial assays
FITC Annexin V Apoptosis Detection Kit I	BD Bioscences	Cat#556547
Super Real Pre Mix Plus Kit (SYBR Green)	TIANGEN	Cat#FP205
FastQuant RT Kit (with gDNase)	TIANGEN	Cat#KR116
BCA Protein Assay Kit	Beyotime	Cat#P0012
T7 RiboMAX™ Express Large Scale RNA Production System	Promega	Cat#P1320
Nuclear and Cytoplasmic Protein Extraction Kit	Beyotime	Cat#P0028
Colorimetric TUNEL Apoptosis Assay Kit	Beyotime	Cat#C1098
Experimental models: Cell lines
Cell Line: MDA-MB-231 cells	A gift from of Chih-chen Wang	RRID: CVCL_0062
Cell Line: IRE1α KO MDA-MB-231 cells	This paper	N/A
Cell Line: BT-474 cells	A gift from of Moshi Song	RRID: CVCL_0179
Cell Line: MDA-MB-453 cells	A gift from of Moshi Song	RRID: CVCL_0418
Cell Line: 293T cells	ATCC	ATCC: CRL-3216; RRID: CVCL_0063
Experimental models: Organisms/strains
Mouse: BALB/c nude mice	GemPharmatech	N/A
Oligonucleotides
Human XBP1s for XBP1 splicing assay	This paper	N/A
Forward: TTACGAGAGAAAACTCATGGCC
Reverse: GGGTCCAAGTTGTCCAGAATGC
Human β-actin for RT-PCR	This paper	N/A
Forward: TCATTCCAAATATGAGATGCGTTGT
Reverse: GCTATCACCTCCCCTGTGTG
Human BLOS1 for RT-PCR	This paper	N/A
Forward: AGGAGGCGAGAGGCTATCAC
Reverse: GGACCTGTAGGGTCTTCACCT
Recombinant DNA
PX458(pSpCas9(BB)-2A-GFP)	Addgene	plasmid#48138
pcW-cas9	A gift from of Yang Yu	N/A
pcW-hIRE1α-HA	This paper	N/A
pcW-hIRE1α-superfolder GFP	This paper	N/A
PUC19-mIns2	This paper	N/A
Software and algorithms
Prism9	GraphPad	N/A
Flow Jo 10.1	FlowJo	N/A
ZEN 2012	ZEISS	N/A
ImageJ	https://imagej.nih.gov/ij/	N/A

Experimental model and study participant details

Animals

BALB/c nude mice were purchased from GemPharmatech. The mice were socially housed (2–5 mice/cage) and given ad libitum access to food and water during a 12-h light-dark cycle. All animal experiments were approved by the Animal Committee of the Institute of Biophysics, Chinese Academy of Sciences.

For all tumor progression assays, tumor cells suspended in 50 μL of 1 × PBS were mixed with 50 μL of matrigel (BD Biosciences, Cat#356231) and then injected into the mammary fat pad of 6–8 weeks-old female mice (1.5 × 10⁶ per mouse) following the protocol as described previously.⁴¹ From day 8, intratumoral injections of either saline or MnCl₂ (5 mg/kg) were administered every two days (n = 7 mice for each condition). On day 18, mice were euthanized before tumor samples collection. Tumor volume, weight and mice weight were measured and recorded. Tumor sizes were calculated by using the equation V_tumor (mm³) = a²b/2 (a indicates the smallest diameter, b is the perpendicular diameter).

Cell culture

Human breast cancer cells (MDA-MB-231, BT-474, and MDA-MB-453) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Cat#C11965500BT) supplemented with 10% fetal bovine serum (Gibco, Cat#10091-148) and 1% penicillin-streptomycin (Solarbio, Cat#p1400). Cells were cultured in an ESCO CO₂ incubator at 37°C with 5% CO₂. Cell lines are free of mycoplasma contamination.

For oxygen-glucose deprivation (OGD) assay, cells were washed with PBS, and subsequently, glucose-free DMEM (Gibco, Cat#11966025) was added for cell culture. The cells were then cultured in a hypoxic environment with 1% O₂, 5% CO₂, and 94% N₂.

For CRISPR/Cas9 knockout cell lines generation, sgRNA targeting human IRE1α(5′-TTGTTTGTGTCAACGCTGGA-3′) was constructed into the vector PX458. Cells were transiently transfected with the appropriate plasmid followed by FACS-based monoclonal selection based on GFP fluorescence. Single knockout clones were verified by immunoblotting and sequencing of the PCR fragments.

The IRE1α reporter cell line and OE IRE1α cell lines were generated by lentiviral infection of MDA-MB-231 IRE1α KO cells with IRE1α reporter (pcW-hIRE1α-superfolder GFP) or IRE1α (pcW-hIRE1α-HA). Stably IRE1α reporter and IRE1α OE cell lines were selected with 10 μg/mL puromycin. Both hIRE1α-superfolder GFP and hIRE1α-HA are expressed in a Dox-inducible way.

Method details

MTT

Cells were plated into a 96-well plate (10³-10⁴ per well). After adhesion, drug treatment was administered. The cells were then incubated at 37°C with 5% CO₂ for 24 h. Following this, 20 μL of MTT (5 mg/mL) solution was added to each well, and incubation was continued at 37°C for 1–4 h. To terminate the incubation, the medium was aspirated and replaced with 150 μL of DMSO (Sigma, Cat#D2650) per well. The plates were agitated at room temperature to dissolve the crystals. Absorbance was measured at 570 nm using a microplate reader, and the results were recorded.

Flow cytometry assay of cell death

Cell death was measured by FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, Cat#556547) according to the manufacturer’s instruction. Briefly, Aspirate the cell culture medium and transfer it to a 15 mL centrifuge tube. Wash the adherent cells once with PBS and transfer the wash to a centrifuge tube. Add an appropriate amount of trypsin to digest the cells. Incubate at 37°C until gentle tapping can dislodge the adherent cells, at which point digestion should be stopped. Transfer the cells into the centrifuge tube and centrifuge at 1000 rpm for 3 min. Wash the cell pellet once with PBS, then centrifuge again at 1000 rpm for 3 min. Resuspend the cells in 1× Binding Buffer at a concentration of 1 × 10^ˆ6 cells/mL. Transfer 100 μL of the cell suspension (containing 1×10⁵ cells) into a 5 mL flow cytometry tube. Add 5 μL of FITC Annexin V and 5 μL of PI. Gently vortex the cells and incubate at room temperature (25°C) in the dark for 15 min. Add 400 μL of 1× Binding Buffer to each tube. Analyze the cells by flow cytometry within 1 h.

Immunohistochemistry (IHC) and immunofluorescence (IF)

For live-cell imaging, IRE1α reporter cells were seeded on glass bottom cell culture dishes. Dox (5μg/mL) was used to induce the expression of GFP-labeled IRE1α. Hoechst dye (Beyotime, Cat#C1028) is used for staining cell nuclei.

For tumor tissue TUNEL staining, a Colorimetric TUNEL Apoptosis Assay Kit (Beyotime, Cat#C1098) was used for detect apoptotic cells according to the manufacturer’s protocols. Briefly, paraffin sections were deparaffinized sequentially with xylene, absolute ethanol, 90% ethanol, 70% ethanol, and distilled water. Add 20 μg/mL DNase-free protease K dropwise onto slides and incubate for 30 min at room temperature. Wash samples twice with PBS then add 50μL of TUNEL detection solution per sample and incubate 60 min at 37°C in the dark. After mounting samples with Antifade Mounting Medium, observe cells by fluorescence microscopy.

Immunoblotting assays

For whole cell lysates, remove the culture medium and wash the cells 3 times with PBS. Collect the cells and add RIPA lysis buffer (Beyotime, Cat#P0013B) supplemented with protease inhibitor cocktail (Merck, Cat#539137-10VLCN) and phosphatase inhibitor cocktail (Merck, Cat#524625-1SETCN) on ice for 30 min, then centrifuge at 12,000 rpm for 10 min at 4°C. The supernatant contains the total cellular protein.

Nuclear proteins were obtained from cells using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, Cat#P0028) following the manufacturer’s instructions. In brief, scrape cells into a 15 mL conical tube and wash them twice with ice-cold PBS. Centrifuge the cells for 3 min at 2000 rpm and discard the supernatant. Resuspend cell pellet in cytoplasmic with ice-cold PBS. Centrifuge the cells for 3 min at 2000 rpm and discard the supernatant. Resuspend cell pellet in cytoplasmic protein extraction buffer A containing protease inhibitor cocktail, vortex vigorously for 5 s and then incubate on ice for 10–15 min. Centrifuge the lysates at 13,000 rpm for 5 min at 4°C after the addition of cytoplasmic protein extraction buffer B. Carefully remove the cytoplasmic extract from the nuclear pellet. Break nuclear pellet by sonication in ice-cold nuclear extraction buffer containing protease inhibitor cocktail, then incubate on ice for 30 min and centrifuge at 13,000 for 10 min at 4°C. Supernatants were subjected to protein concentration quantification by BCA method and equivalent amounts of proteins were denatured in 5× SDS loading buffer.

Protein concentrations were calculated by the BCA protein assay kit (Beyotime, Cat#P0012). Protein samples in equal amounts were loaded onto SDS-PAGE gel. After electrophoresis, proteins were transferred to a PVDF membrane (Merck, Cat# IPVH00010), blocked with 5% skim milk, and incubated with primary antibodies overnight at 4°C. Then membranes were washed in PBST buffer (136.89 mM NaCl, 2.68 mM KCl, 1.76 mM KH₂PO₄, 10mM Na₂HPO₄, 0.1% Tween 20, pH 7.2–7.4) and incubated with the secondary antibodies at room temperature for 2 h. Finally, the immunoreactive bands were detected with the chemiluminescence reagent (Lablead, Cat#E1050).

Phos-tag SDS-PAGE was performed according to the manufacturer’s protocols. Briefly, 50μM Phos-tag acrylamide (Wako, Cat#304–93521) and 250 μM MnCl₂ were added into the 5% separating gel when preparing SDS-PAGE. After electrophoresis, the gel was washed with transfer buffer containing 10 mM EDTA (Sinopharm Chemical Reagent, CAT#10009717) for 30 min, and proteins were transferred to the PVDF membrane for western blot assay.

Sucrose density gradient centrifugation

MDA-MB-231 cells were treated with Tg (0.2 μM) and/or MnCl₂ (100 μM) for 24 h, then harvested and lysed in lysis buffer. A fresh 20%–40% sucrose gradient was prepared using a gradient maker in 14 × 89 mm polypropylene tubes (Beckman Coulter). The protein lysates were gently layered onto the gradient. Centrifugation was performed at 35,000 rpm for 20 h at 4°C using an SW 41 Ti rotor (Beckman Coulter). Approximately 12 mL of solution from each tube was fractionated into 15 fractions from top to bottom. The proteins in the solution were subjected to SDS-PAGE through extraction, and the changes in the IRE1α complex were detected using an IRE1α-specific antibody.

XBP1 mRNA splicing assay and qRT-PCR assays

Total RNA was isolated from whole cells using TRIzol (TIANGEN, Cat#DP424), and equivalent RNA samples were then reverse-transcribed into cDNA using FastQuant RT Kit (with gDNase) (TIANGEN, Cat#KR116). For XBP1 mRNA splicing assay, cDNAs were PCR-amplified with the indicated primers, then resolved on 2.5% (w/v) agarose gels. qRT-PCR employing SuperReal PreMix Plus Kit (SYBR Green) (TIANGEN, Cat#FP205) was performed in the QuantStudio 3 Flex machine (Applied Biosystems) and the QuantStudio 7 Flexmachine (Applied Biosystems), following the manufacturer’s instructions.

Co-immunoprecipitation (Co-IP)

Cells expressing the target protein were collected and lysed by adding IP lysis buffer (Beyotime, Cat#P0013) on ice for 30 min. Subsequently, the lysate was centrifuged at 12,000 rpm for 10 min at 4°C. The supernatant was incubated with the primary antibody at 4°C overnight. Following this, Protein A/G Agarose Beads (YEASEN, Cat#36403ES08) were added and incubated for 3 h at 4°C, after which the beads were washed five times. After adding SDS-PAGE loading buffer, the protein-coated beads were boiled and subjected to SDS-PAGE, followed by detection using western blotting.

Lentiviral infection

HEK293T cells were used for lentivirus packaging. The transfection was performed according to the jetPRIME Transfection Reagent (Polyplus, Cat# PT-114-15) manufacturer’s instructions. Specifically, the viral packaging plasmid psPAX2 (6 μg), pCMV-VSV-G (4 μg), and the target plasmid (10 μg) were mixed in 500 μL of jetPRIME Transfection Buffer, followed by the addition of 40 μL of jetPRIME Transfection Reagent. The mixture was incubated at room temperature for 10 min and then added dropwise to the cell culture medium. The virus-containing culture medium was collected 48 h post-transfection. The medium of the infected cells was removed, and the virus-containing supernatant was mixed with fresh culture medium at a 1:1 ratio for further cell culture. The infection duration was 48 h, and the fresh virus-containing medium could be replaced during infection. Stable OE IRE1-WT cell lines were selected with 10 μg/mL puromycin in cell culture medium.

Protein expression and purification

hIRE1α(CD) (residues 469–977) truncated protein was expressed in SF9 insect cells using the Bac-to-Bac baculovirus expression system (Invitrogen) with an N-terminal 6×His tag. After 3 days of growth at 27°C, the cells were lysed by sonication in a buffer containing 50 mM HEPES (pH 7.5), 200 mM NaCl, 10 mM imidazole and protease inhibitors. The lysate was centrifuged at 18,000 g for 1 h at 4°C to remove cell debris and insoluble material. The supernatant was loaded into a pre-equilibrated Ni-affinity column and eluted with lysis buffer containing 250 mM imidazole followed by purification on Superdex 200 column (GE Healthcare). The purified protein was flash-frozen in liquid nitrogen, and stored at -80°C.

The hIRE1α(LD) (residues 24–441) was expressed in BL21 competent cells using pET-32a plasmid, induced with 0.5 M IPTG at 16°C for 20 h. After induction, the bacterial culture was centrifuged at 4,000 rpm for 30 min at 4°C. The supernatant was discarded, and the cell pellet was resuspended in a buffer containing 25 mM HEPES (pH 7.5) and 500 mM NaCl, supplemented with protease inhibitors. The cells were lysed by sonication, and the lysate was centrifuged at 17,000 g for 1.5 h at 4°C. The protein was purified using a Ni-affinity column and eluted with buffers containing 10 mM, 20 mM, and 250 mM imidazole. Finally, the protein was concentrated using a 10 kDa cutoff concentrator and further purified by size-exclusion chromatography.

Thermal shift assay

hIRE1α (CD or LD) and different concentrations of MnCl₂ were mixed with 10×SYPRO Orange Fluorescent Dye (Sigma, Cat#S5692-500UL) in kinase buffer (20 mM HEPES, 50 mM KCl, 1 mM DTT, 1 mM ATP, pH 7.5). 20 μL mixtures were added into each well of a 96-well qPCR plate (Bio-Rad, Cat#HSP9601) sealed with AB MicroAmp optical adhesive film (Applied Biosystems, Cat#4311971). Protein melting curve was measured by CFX RT-PCR detection systems (Bio-Rad), where the mixtures were incubated at 25°C for 2 min, and then heated in a stepwise fashion from 20°C to 90°C at a rate of 1°C/min.

In vitro cleavage assay of IRE1α(CD)

Purified hIRE1α(CD), Mn²⁺, and reaction buffer (20 mM HEPES (pH 7.5), 50 mM KCl, 1 mM DTT, and 2 mM ATP) were incubated at room temperature for 20 min. Then, 3 μM of mini-XBP1 RNA (5′-FAM-CUGAGUCCGCAGCACUCAG-3′-BHQ) was added, and the total reaction volume was adjusted to 30 μL. The reaction was carried out at room temperature for 5 min. The reaction was terminated by adding an equal volume of urea, which resulted in a final urea concentration of 4 M. Fluorescence readings were measured using a Microplate Reader (TECAN), with excitation and emission wavelengths of 494 nm and 525 nm, respectively.

In vitro cross-linking assay of IRE1α (CD)

10 μM purified hIRE1α(CD), 1 mM ATP, Mn²⁺ (1 or 2 mM), and buffer (20 mM HEPES (pH 7.5), 0.05% Triton X-100 (v/v), 50 mM NaCl) were incubated at room temperature for 90 min. Then, 250 μM of the cross-linker DSS was added and incubated for 30 min at room temperature. The reaction was quenched by adding Tris-HCl (pH 7.5) to a final concentration of 50 mM. The samples were boiled, separated by SDS-PAGE, and immunoblotted with an IRE1α-specific antibody to detect IRE1α(CD).

In vitro transcription of mIns2 RNA

The DNA sequence corresponding to mIns2 RNA (5′- GCCCUCGUCCACUGGAAGUCUGGAACCGUGACCUCCACCGGGUCGUCUUCGCACCGUAACAUCUAGUCACGACGUGGUCGUAGACGAGGGAGAUGGUCGACCUCUUGAU-3′) is inserted into the pUC19 plasmid, and an EcoRI restriction enzyme recognition site is introduced at the end of the target DNA sequence. The circular pUC19 plasmid containing the target gene is digested with EcoR1 at 37°C overnight. Then the linearized plasmid template is purified using phenol-chloroform extraction. mIns2 RNA is transcribed at 37°C using the T7 RNA transcription kit. Use DNase I (Roche, Cat#10104159001) to remove the template DNA from the transcription reaction. Finally, the residual DNase I, rNTPs, and other impurities are removed to obtain a purified mIns2 RNA fragment by ethanol precipitation.

Polysome profiling

Cells were treated with cycloheximide (GPL, Cat#GC17198, 100 μg/mL) at 37°C for 7 min without harringtonine pretreatment, washed twice by ice-cold PBS and then collected in freshly prepared ice-cold lysis buffer (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 100 μg/mL CHX, 1% Triton X-100, and 25 U/mL Turbo DNase I). The cell lysis buffer was triturated several times with a 26 G needle and incubated on ice for 10 min. The lysate was centrifuged at 20,000 g for 10 min at 4°C. The supernatant was collected, followed by 15–40% sucrose density gradient centrifugation at 38,000 rpm for 2.5 h at 4°C. Input samples and polysome fraction samples were performed reverse transcription (First-strand cDNA synthesis kit, TIANGEN, Cat# KR116-03) and qPCR according to manufacturer’s protocols.

ICP-MS analysis

Cells were cultured in the serum-free DMEM medium. Cells were washed by cold PBS for five times, harvested and weighed, incubated in a hypotonic buffer (10 mM KCl, 10 mM Tris-HCl, pH 7.5) for 15 min, and then homogenized using a glass homogenizer on ice for 5 min. Cell samples were digested with 2 mL HNO₃ at 200°C until the solution became clear. The digested samples were then diluted to a final volume of 5 mL with 1% HNO₃. The measurement of Mn and Mg content was performed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, Thermo X SERIES).

Quantification and statistical analysis

Statistical analyses were performed using Prism 9.0 (GraphPad). Statistical comparisons between two groups were carried out using unpaired Student’s t test and the values were shown as mean ± SEM. Throughout all figures: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Significance was concluded at p < 0.05.

Published: July 16, 2025