Prevalence and antimicrobial resistance patterns of Clostridium perfringens from healthy broiler chickens: A potential public health threat

Abstract

The aim of this study was to investigate the prevalence and toxin type of Clostridium perfringens isolated from broiler chicken faeces and determine its antibiotic resistance (AR) profile. A total of 480 broiler chicken faeces were collected from four different chicken abattoirs in North West Province, South Africa. Faecal samples were pooled (5 per pool from the same farm), resulting in 96 pooled samples. The disc diffusion method was used for documenting phenotypic AR, whilst PCR was used for the identification of C. perfringens and detection of toxin and antibiotic resistance genes. All 52 isolates identified as Clostridium spp. using the tpi gene PCR assay were also positive for the 16S rRNA gene which is specific for C. perfringens. All 52C. perfringens isolates harboured the cpa gene responsible for encoding alpha toxin. Additionally, 7 (13.5 %) of these isolates were found to carry the netB gene. None of the isolates harboured cpe, cpb2, and cpb genes. All isolates in this study exhibited AR to ampicillin, followed by tetracycline, clindamycin, and chloramphenicol with resistance rates of 100 %, 71.15 %, 46.15 %, and 34.62 %, respectively. C. perfringens isolates contained tetracycline encoding genes, namely tet(A) and tet(W), chloramphenicol encoding genes which are: floR, catI, and catII and beta-lactamase encoding genes including bla_TEM, bla_SHV, bla_CTX-M and bla_OXA. None of the isolates carried bla_CARB. This is the first study to characterize C. perfringens and determine its antimicrobial susceptibility phenotypically and genetically in food-producing chicken in South Africa, proving that animals may be sources of resistant strains of C. perfringens.

1. Background

Clostridium spp. are anaerobic, Gram-positive, spore-forming rod-shaped bacterium that can produce endospores commonly found in soil, sewage, soil, food, faeces and water [[1], [2], [3], [4]]. The genus Clostridium comprises 181 identified species, divided into 16 clusters based on the 16S rRNA gene phylogeny, highlighting their considerable genetic diversity [5,6]. Clostridium species are found in various human and animal sites, including the intestinal tract, female genital tract, and oral mucosa [[7], [8], [9]]. However, among the clostridial species, Clostridium perfringens is known to cause pleuropulmonary infections [7]. Furthermore, C. perfringens is a pathogen of considerable clinical concern, given its role in causing serious human diseases [6,10,11].

C. perfringens naturally inhabits the gastrointestinal tracts of poultry, cattle, sheep, and goats [12,13]. Due to concerns about food-borne intoxication, C. perfringens is an organism of high zoonotic potential and of serious public health concern [14]. C. perfringens is a prolific toxin-producer, harboring toxin genes on its chromosome and plasmids [5]. It produces at least 20 toxic enzymes and spore-forming anaerobic bacteria [15]. Based on the production of four primary toxins, namely alpha (cpa), beta (cpb), epsilon (etx), and iota (iap), C. perfringens strains are divided into five toxin categories which are designated type A to E [2,3,13]. Epsilon toxin, a Category B Select Agent, is produced by C. perfringens types B and D. Although there is a potential threat, there is currently no evidence of human infection or epsilon-intoxication [11]. Human food poisoning strains carrying enterotoxigenic C. perfringens type A carry cpe on the chromosome, which is clustered into the transposon-like structure Tn1565 flanked by insertion sequences IS1470 and IS1469 [13]. Alpha toxin significantly contributes to the virulence of C. perfringens, causing gas gangrene, haemolysis, and septicaemia in humans, as demonstrated by in vitro and in vivo animal studies [16].

Antibiotic resistance is a rising public health crisis and one of the greatest health problems of the twenty-first century [17,18]. Various antimicrobial agents have been used to treat infections caused by C. perfringens, including tetracycline, chloramphenicol, lincomycin, bacitracin, ampicillin, metronidazole, and even imipenem [19]. Several resistance genes have been discovered in C. perfringens isolates thus far [17,19]. Although these antibiotics boost growth and feed efficiency, they alter gut flora and put pressure on the development of antibiotic resistance [17,20].

Despite the simplicity of preventing C. perfringens foodborne illnesses through proper washing and disinfection, significant outbreaks with occasional fatal consequences continue to occur [21]. Chicken remains the most affordable meat alternative, playing a vital role in ensuring household food and nutrition security, as well as the stability of the South African food system [22]. C. perfringens is one of leading cause of foodborne illness outbreaks in South Africa [22]. Therefore, this study aimed to investigate the prevalence, toxin type and antibiotic resistance profiles of C. perfringens from faecal samples of broiler chickens.

2. Materials and methods

2.1. Sampling

A total of 480 faecal samples were aseptically collected from caeca/rectum of healthy broiler chicken's post-evisceration. They then transferred to sterile containers and stored them in cooler boxes for transportation to the laboratory. Pooled samples were created from 480 faecal samples, resulting in a total of 96 samples with five samples per pool [23,24].

2.2. Isolation and identification of C. perfringens

A modified version of the Fung double tube method was used to analyze each sample. A capped test Pyrex tube was filled with 7 mL of double-strength C. perfringens agar base (Oxoid, UK) and autoclaved. Liquefied media was cooled to approximately 50 °C, 1 mL of sample and 32 μL of TSC supplement (Oxoid, UK) were mixed with the agar in serial dilutions. The mixture was then transferred to a Pyrex test tube containing an autoclaved inserter test tube, sealed to create anaerobic conditions.

The test tube was incubated at 37 °C for 3–7 h to inhibit excessive bacterial growth. Black colonies formed in the center of the media. Isolation of Clostridium colonies was done by pouring the contents of the tube into a sterile petri dish, and the colonies were collected with a sterile wooden toothpick. These colonies were then sub-cultured in Luria-Bertani (LB) plates in an AnaeroJar (AG0025; Oxoid), with an AnaeroGen sachet (AN0025; Thermo Scientific) and an anaerobic indicator (BR0055B; Oxoid).

2.3. DNA extraction and identification of Clostridium species by PCR

Genomic DNA was extracted from pure bacterial cultures using PureLink® DNA Mini Kit (Invitrogen, USA) following the manufacturer's instructions. A NanoDrop spectrophotometer (ThermoFischer Scientific, USA) was used to measure DNA concentrations. To detect the tpi gene, a PCR assay was used to amplify an 800 bp gene fragment with tpi-F and tpi-R primers (Table 1) with conditions described by Montso and Ateba [6]. The positive control was C. perfringens ATCC 13124 (ThermoFischer Scientific™), while the negative control was nuclease-free water.

Table 1.

Antibiotic resistance gene primers and PCR conditions used in this study.

Name of bacteria	Target gene	Primer	Primer sequence (5′ → 3′)	Amplicon size (bp)	Annealing temp (°C)	References
	Clostridium species identification
Clostridium species	tpi	tpi-F tpi-R	GCWGGWAAYTGGAARATGMAYAA TTWCCWGTWCCDATWGCCCADAT	800	60	[6]
C. perfringens	16S RNA	ClPer-1 ClPer-2	TAACCTGCCTCATAGAGT TTTCACATCCCACTTAATC	481	53	[14]
	Toxins
Alpha (α)	cpa	CPAlpha-F CPAlpha-R	GCTAATGTTACTGCCGTTGA CCTCTGATACATCGTGTAAG	195	53	[14]
Beta (β)	cpb	CPBeta-F3 CPBeta-R3	GCGAATATGCTGAATCATCTAG GCAGGAACATTAGTATATCTTC	548	53	[14]
Beta-2 (β2)	cpb2	CPBeta2-F2 CPBeta2-R2	AAATATGATCCTAACCAACAA CCAAATACTCTAATYGATGC	548	53	[25]
Enterotoxin	cpe	CPEntero-F CPEntero-R	TTCAGTTGGATTTACTTCTG TGTCCAGTAGCTGTAATTT	485	53	[14]
netB toxin	netB	NETB-F NETB-R	TGATACCGCTTCACATAAAGGTTGG ATAAGTTTCAGGCCATTTCATTTTTCCG	196	61	[26]

2.4. Identification of C. perfringens

C. perfringens was identified using the ClPer-1 and ClPer-2 oligonucleotide primers (Table 1) to detect C. perfringens with slight modification from previously published protocol by Rana et al. [14]. The 16S rRNA gene sequence was used to confirm the identity of the C. perfringens isolates which were positive by the above CIPer primers PCR assay. To amplify the 16S rRNA gene segment, bacterial universal primers (27F: AGA GTT TGA TCM TGG CTC AG and 1492R: GGT TAC CTT GTT ACG ACT T) were used the following methods described by Mlangeni et al. [27]. PCR conditions were as follows: 96 °C initial denaturation for 4 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 1 min, and an extension step of 10 min at 72 °C. The amplified 16S rRNA gene fragments were sequenced with the BigDye Terminator cycle sequencing kit (v 3.1) on the SeqStudio genetic analyzer at North-West University, UESM Sequencing facility in Potchefstroom. The representative sequences were analyzed using BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to verify the isolate's identity.

2.5. Detection of C. perfringens toxin genes

All positive isolates were chosen for the screening of four toxin genes [netB (necrotic enteritis-β-like toxin), cpe (Enterotoxin), cpb2 (β2), cpa (α), and cpb (β)] upon identification of the C. perfringens species (Table 1). Multiplex PCR was used to amplify the toxinotyping gene specifically, as described in a prior study. For the PCR assays detecting virulence genes, a total of 25 μL reaction mixture consisting of 12.5 μL of the PCR Master Mix [AmpliTaq Gold® DNA Polymerase, 0.05 units/L, Gold buffer, 930 mM Tris/HCl pH 8.05, 100 mM KCl, 0.4 mM of each dNTP, and 5 mM MgCl₂].

(AmpliTaq Gold® DNA Polymerase), 10 μM of each primer, 2 μL of template DNA, and 8.5 μL nuclease-free water. Amplification was performed in the thermal cycler, the ProFlex PCR System (Applied Biosystems, USA), with the PCR program consisting of 15 min 95 °C followed by 40 cycles of 30 s denaturation at 94 °C, 90 s annealing [53 °C - 61 °C] and 90 s extension at 72 °C and a final extension step of 10 min at 72 °C (Table 1).

2.6. Agarose gel electrophoresis

PCR products were analyzed on 1.5 % (w/v) ethidium bromide-stained agarose gels and visualized under UV light using the ENDURO GDS Gel Documentation System (Labnet International Inc., US). Product sizes were determined using 100 bp and 1 kb DNA ladders (PROMEGA, Wisconsin, USA).

2.7. Phenotypic antibiotic resistance screening

All 52C. perfringens were screened for AMR. Five antibiotics, namely, Ampicillin (AMP), Clindamycin (CLI), Chloramphenicol (CHL), Metronidazole (MTZ) and Tetracycline (TET) obtained from ThermoFischer Scientific™ were tested on anaerobic bacteria using minimum inhibitory concentration (MIC) gradient diffusion (M.I.C.E. strips) [28] and agar dilution [29], which is considered the gold standard method for testing anaerobic bacteria. In the agar dilution, molten Reinforced Clostridia agar was supplemented with antibiotics of varying concentrations, ranging from 0.015 μg/mL to 256 μg/mL. Afterwards, the mixture was poured into sterile petri dishes and allowed to set. A different concentration of antibiotics was spot inoculated onto each plate and incubated anaerobically at 37 °C for 24 to 48 h. The MIC breakpoints were interpreted according to the CLSI Interpretive Standards for Anaerobes [30,31]. As previously reported, multidrug resistance (MDR) was determined as a phenomenon that occurs with resistance to three or more classes of antimicrobial agents [32]. C. perfringens ATCC 13124 (ThermoFischer Scientific™) served as the quality control strain.

2.8. Detection of antibiotic resistance genes by PCR

The genomic DNA extracted from C. perfringens isolates was screened for the presence of antibiotic resistance genes encoding for chloramphenicol (catI, catII, catIII, catIV, and floR), tetracycline [tet(A), tet(O), tet(X), tet(P), tet(W) and tet(K)], β-lactamase (bla_SHV, bla_OXA, bla_CARB, bla_TEM and bla_CTX-M) (Table 2). To set up PCR assays for the AMR genes, a total of 25 μL reaction mixture consisting of 12.5 μL of the PCR Master Mix (AmpliTaq Gold® DNA Polymerase, 0.05 units/L, Gold buffer, 930 mM Tris/HCl pH 8.05, 100 mM KCl, 0.4 mM of each dNTP, and 5 mM MgCl2), 10 μM of each primer, 2 μL of template DNA, and 8.5 μL nuclease-free water. The amplification program consisted of the following steps: denaturation at 94 °C for 6 min, followed by 30 cycles of 94 °C for 30 s, annealing temperature listed in Table 2 for 30 s, and 72 °C for 60 s, with a final extension at 72 °C for 6 min [33].

Table 2.

Antibiotic resistance gene primers used in this study.

Target gene	Primers	Primer sequence (5′ → 3′)	Amplicon size (bp)	Annealing temp (°C)
Tetracycline
tet(A)	TETA-F TETA-R	GCGCTNTATGCGTTGATGCA ACAGCCCGTCAGGAAATT	387	62
tet(O)	TETO-F TETO-R	ACGGARAGTTTATTGTATACC TGGCGTATCTATAATGTTGAC	171	60
tet(W)	TETW-F TETW-R	GAGAGCCTGCTATATGCCAGC GGGCGTATCCACAATGTTAAC	168	50
tet(K)	tet(X)-F tet(X)-R	TCGATAGGAACAGCAGTA CAGCAGATCCTACTCCTT	169	61
Chloramphenicol
catI	catI-F catI-R	GGTGATATGGGATAGTGTT CCATCACATACTGCATGATG	349	60
catII	catII-F catII-R	GATTGACCTGAATACCTGGAA CCATCACATACTGCATGATG	567	60
catIII	catIII-F CatIII-R	CCATACTCATCCGATATTGA CCATCACATACTGCATGATG	275	60
catIV	CatIV-F catIV R	CCGGTAAAGCGAAATTGTAT CCATCACATACTGCATGATG	451	60
floR	FloR-F FloR-R	CGCCGTCATTCCTCACCTTC GATCACGGGCCACGCTGTGTC	215	50
β-lactamase
blaSHV	SHV-F SHV-R	CACTCAAGGATGTATTGT G TTAGCGTTGCCAGTGCTCG	885	55
blaOXA	OXA-F OXA -R	ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC	813	55
blaCARB	CARB-F CARB-R	CAAGTACTTTYAAAACAATAGC GCTGTAATACTCCKAGCAC	534	46
blaTEM	TEM-F TEM-R	TTCTTGAAGACGAAAGGGC ACGCTCAGTGGAACGAAAAC	1150	55
blaCTX-M	CTX-M-F CTX-M-R	GTTACAATGTGTGAGAAGCAG CCGTTTCCGCTATTACAAAC	550	55

2.9. Data analysis

The 16S rRNA sequences from four representative C. perfringens isolates were aligned with nucleotide sequences available in the National Centre for Biotechnology Information database (NCBI) GenBank using BLASTn (http://www.ncbi.nlm.nih.gov/BLAST/). Heatmap plots illustrating the virulence and antibiotic resistance profiles were generated using ChipPlot, an online tool accessible at https://www.chiplot.online/. Data management and all statistical analyses were done using Microsoft Excel version 2506 (One Microsoft Way, USA). Statistical analysis of normally distributed data was performed using one-way analysis of variance (ANOVA), followed by Tukey's post hoc test to determine significant differences.

3. Results

3.1. Prevalence and toxin-encoding genes of C. perfringens from broiler chickens

A total of 96 pooled broiler samples were analyzed for the presence of C. perfringens by the conventional cultural characteristic's method. From each positive plate, two colonies were picked and sub-cultured. A total of 52 isolates were confirmed to be Clostridium spp. by tpi gene PCR assay (Fig. 1). The 16S rRNA gene sequence analysis of the C. perfringens revealed a high percentage of nucleotide similarity (99.9–100 %) to the reference GenBank sequences of the C. perfringens isolates. The representative isolates were deposited in GenBank with the following accession numbers: OR494052, OR494053, OR494054 and OR494055. Furthermore, all 52C. perfringens encode the species-specific (cpa) gene for C. perfringens (Fig. 1). The netB gene was detected in 7 (13.5 %) of the 52C. perfringens isolates examined. None of the cpb, cpe, and cpb2 genes were detected in all screened isolates.

Fig. 1.

Heatmap showing confirmatory and virulent genes detected in 52C. perfringens isolates from broiler chickens. The black colour indicates the genes that were detected in each isolate. https://www.chiplot.online/#.

Table 3 shows the number of 52C. perfringens-positive samples per slaughterhouse. Among all positive samples, Abattoir B has the highest number (16/52; 30.8 %) of positive isolates, followed by abattoir D with 14 (26.9 %), then Abattoir A with 13 (25 %) isolates and finally abattoir C with only 9 (17.3 %) isolates.

Table 3.

The number of samples collected per abattoir and C. perfringens positive samples.

Abattoirs ID	Samples collected	Pooled samples	C. perfringens encoding genes			Toxin encoding genes
			tpi (%)	16S RNA (%)	Alpha (α) [cpa] (%)	Beta (β) [cpb] (%)	Beta-2 (β2) [cpb2] (%)	Enterotoxin [cpe] (%)	netB toxin [netB] (%)
A	120	24	25	25	13.5	0	0	0	3.8
B	120	24	30.7	30.7	21.1	0	0	0	5.7
C	120	24	17.3	17.3	5.7	0	0	0	0
D	120	24	26.9	26.9	9.6	0	0	0	23.8
p-value	–	–	0.74	0.74	0.01	–	–	–	–

3.2. Antimicrobial resistance of C. perfringens strains

All C. perfringens isolates (n = 52) were susceptible to metronidazole, as shown in Fig. 2. All the isolates obtained in this study 100 % (n = 52) were resistant to ampicillin, followed by tetracycline, clindamycin, and chloramphenicol, with 71.15 % (n = 37), 46.15 % (n = 24), and 34.62 % (n = 18), respectively. Of the 52 isolates, 24 (44.4 %) exhibited multidrug resistance, showing resistance to ≥3 antibiotic classes.

Fig. 2.

Distribution of antibiotic resistance among C. perfringens. The abbreviation refers to: AMP = Ampicillin, CLI=Clindamycin, CHL = Chloramphenicol, MTZ = Metronidazole, and TET = Tetracycline.

3.3. Identification of tetracycline, chloramphenicol and β-lactamase encoded genes

The tetracycline encoding genes were identified in 13 (25 %) isolates, which harboured tet(A) and tet(W) 5 (9.6 %) genes. None of the isolates carried tet(K) and tet(O) genes. Whereas chloramphenicol encoding genes such as for floR, catI and catII from 9 (17.3 %), 6 (11.5 %) and 2 (3.8 %) were detected from screened C. perfringens in this study, respectively. Whilst catIII and catIV were not detected from all the isolates. Out of 52 ampicillin phenotypic resistant isolates, only 21 (40.4 %), 15 (28.8 %), 12 (23.1 %) and 9 (17.3 %) harboured bla_TEM, bla_CTX-M, bla_SHV,and bla_OXA respectively, which are genes encoding beta-lactamase. Five (CP1W, CP12W, CP20W, CP29W and CP38W) isolates possess up to three classes of antibiotics (tetracycline, chloramphenicol and β-lactamase). No tet(O), tet(K), catIII, catIV, bla_CARB and catIV genes detected in all the tested isolates (Fig. 3).

Fig. 3.

Distribution of antibiotic-resistant genes among C. perfringens isolated from healthy broiler chickens.

4. Discussion

Livestock and humans are susceptible to C. perfringens infections, which cause intestinal infections and histotoxic diseases [34]. C. perfringens is a ubiquitous commensal bacterium that resides in the gastrointestinal tracts of humans and animals [35]. Faecal flora contamination of carcasses is unavoidable during slaughter. Therefore, food of animal origin may serve as a medium for transporting resistant bacteria, including C. perfringens, between animals and man [36]. Globally, C. perfringens is one of the most common bacteria that cause foodborne illness [37]. There is a paucity of studies in South Africa on the isolation of C. perfringens in water sources [28], captive animals [38], human [39] and beef samples [6]. However, there is a scarcity of investigations regarding the prevalence of C. perfringens in chickens in South Africa.

This study revealed that 27 % (26/96) of the pooled chicken faecal samples harboured C. perfringens, which is higher than the 23.4 % of chicken faecal samples reported in Beijing and Shanxi, China [40], and in central China (23.1 %) [41], in Korea, 19 % from chicken, beef and pork samples [42], 16 % isolates from chicken meat in Vietnam [1] and 17.4 % isolates from wild bird stool samples in Beijing, China [4]. However, the C. perfringens prevalence in this study was lower (38.42 %) than that reported in a study conducted by Xu et al. [43], in China and 56.7 % of the isolates from aquatic sources in China [44]. This indicates regional variations in prevalence and potential differences in sampling methods, biosecurity measures, or environmental factors that influence C. perfringens contamination. Further investigation into these contributing factors could aid in controlling and mitigating its spread in poultry and related environments.

C. perfringens toxinotypes correlate with distinct disease syndromes, with alpha-toxin (encoded by cpa) found in nearly all toxinotypes [45]. In 2018, the introduction of cpe and netB genes as novel typing markers led to the identification of two new toxinotypes (F and G) distinct from toxinotype A, increasing the total number of recognized toxinotypes in C. perfringens to seven (A-G) [46]. C. perfringens type A, which produces the single major toxin CPA, serves as the foundational toxinotype for this species. Acquisition of plasmids encoding specific toxins, including C. perfringens enterotoxin, C. perfringens epsilon toxin, C. perfringens iota-toxin, and necrotic enteritis toxin B-like toxin, confers distinct toxinotypes on C. perfringens strains [47]. The cpa breaks down phosphatidylcholine and sphingomyelin on the cell membrane, inhibits neutrophil migration and maturation, and activates arachidonic acid metabolism, causing vasoconstriction and platelet aggregation [48]. Therefore, this toxin impairs innate immunity and creates an undesirable micro-environment [49]. In the present study, all C. perfringens harboured cpa of healthy broiler chicken’ samples. The production of NetB toxin has recently been recognized as a key virulence factor in C. perfringens strains that induce necrotic enteritis (NE). The prevalence of NetB is greater in diseased birds, yet it is also found in healthy broilers [50]. In this study, the netB gene was detected in 7 (13.5 %) of the 52C. perfringens isolates examined. Zhou et al. [51] determined that although netB is essential for NE virulence, it cannot independently induce NE and requires additional genes for complete virulence. However, none of the isolates in this study possessed Enterotoxin (cpe), and Beta-toxin (cpb2 and cpb) genes.

In the present study, all C. perfringens isolates (100 %) were resistant to ampicillin, followed by tetracycline, clindamycin, and chloramphenicol, with 71.15 %, 46.15 %, and 34.62 %, respectively. In an Iranian study, C. perfringens isolates from raw beef meats showed high antibiotic resistance to ampicillin, tetracycline, amoxicillin, ciprofloxacin and chloramphenicol antibiotics with 72.2 %, 66.6 %, 61.1 %, 37.8 % and 33.3 %, respectively [47]. A study in India on C. perfringens isolates from livestock and poultry found resistance rates of 44 % to gentamicin, 40 % to both erythromycin and bacitracin, and 26.6 % to tetracycline [52]. A Romanian study by Beres et al. [19] found high antibiotic resistance rates among C. perfringens isolates from food-producing animals, with 71.4 % resistant to tetracycline, 64.2 % to penicillin, 42.8 % to erythromycin, and 35.7 % to enrofloxacin. A consensus among numerous studies indicates that C. perfringens isolates frequently exhibit resistance to tetracycline [1]. Due to excessive usage and incorrect veterinary guidance, C. perfringens isolates have developed resistance to tetracycline [19,47]. In Vietnam, 91.30 % of pork and chicken meat isolates were resistant to tetracycline [1]. Among antibiotics, tetracyclines are the second most used group after β-Lactam [53]. Tetracycline resistance is achieved through the presence of one or more of the 36 known tet genes [28]. This study revealed that 44.38 % of the C. perfringens isolates exhibited multidrug resistance, showing resistance to ≥3 antibiotic classes. In contrast, a study recently conducted in Iran by Hassani et al. [47] showed lower multidrug resistance (38 %) prevalence of C. perfringens isolates compared to our results.

Globally, antimicrobial resistance is a significant concern [17]. Even though these antibiotics boost growth and feed efficiency, they alter gut flora and pressure antibiotic resistance development [17,20]. Through conjugative plasmids, ARG may spread between different bacterial infections [47]. In this study, we found the presence of tetracycline-encoding genes like tet(A) (25 %) and tet(W) (9.6 %) genes. At least two [tet(W) and tet(A)] tetracycline resistance genes were present in each of the 13 tetracycline-resistant isolates. Remarkably, the combinations of tetracycline(disk) and tetracycline encoding genes tet(A) and tet (W) were found in one sample.

Out of 18C. perfringens isolates resistant to chloramphenicol, seven had one chloramphenicol encoding genes catI, catII and floR in this study. One C. perfringens isolate had phenotypic resistance to chloramphenicol and harboured three chloramphenicol encoding genes (catI, catII and floR). All CAT enzymes can acetylate chloramphenicol to form 3-acetoxy-chloramphenicol [29]. The β-Lactam antibiotics are medicine and agriculture's most commonly used antibiotics [28]. This study identified the presence of genes encoding beta-lactamases, including bla_OXA, bla_CTX-M, bla_SHV, and bla_TEM. The detection of these genes in C. perfringens poses a significant public health concern, as they can be released into the environment, disseminated among other microorganisms, and potentially contribute to the emergence of antibiotic-resistant superbugs. Due to the quantity and variety of human antibiotics used in veterinary clinics, the findings raised serious concerns for public health and veterinary medicine.

5. Conclusion

This study provides insights into the prevalence, toxinotypes, and antibiotic resistance patterns of C. perfringens isolates obtained from broiler chickens in South Africa. The study confirms that all isolates were identified as C. perfringens, harboring the cpa and netB genes which has previously been reported to play a crucial role in necrotic enteritis in poultry. Therefore, ongoing year-round monitoring of Clostridium disease in broiler chickens is essential. The isolates showed high resistance to tetracycline, clindamycin, and chloramphenicol. Different classes of ARGs were detected in this study. In broiler farming, the occurrence of multiple ARGs could contribute to development of pathogenic multidrug-resistant C. perfringens strains. Given the role of foodborne transmission in spreading C. perfringens, stricter biosecurity measures, surveillance programs, and antimicrobial stewardship are urgently needed to mitigate its impact.

CRediT authorship contribution statement

Tsepo Ramatla: Writing – original draft, Methodology, Formal analysis, Data curation, Conceptualization. Silence Ncube: Investigation, Formal analysis. Prudent Mokgokong: Writing – review & editing, Methodology. Jane Nkhebenyane: Writing – review & editing. Lesego Molale-Tom: Writing – review & editing. Rendani Ndou: Writing – review & editing. Ntelekwane Khasapane: Writing – review & editing. Carlos Bezuidenhout: Writing – review & editing, Supervision. Oriel Thekisoe: Writing – review & editing, Supervision, Funding acquisition, Conceptualization. Kgaugelo Lekota: Writing – review & editing, Supervision, Conceptualization.

Ethics approval and consent to participate

The ethical approval was received from the Ethical Committee of the Animal Production Committee of the North-West University, South Africa (NWU-00511-18-A5).

Funding

This research was funded by NRF Incentive grant for rated researchers (GUN: 118949) made available to Oriel Thekisoe.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

All the data supporting our findings were incorporated within the manuscript.