ABSTRACT
Background
Feline vector‐borne diseases are caused by various pathogens transmitted by arthropods. Many of these infections have zoonotic importance, and cats can serve as sentinels for monitoring the health of both humans and pets. However, there is a limited research on the vector‐borne and zoonotic diseases carried by feline populations.
Objectives
This study aimed to detect the prevalence of selected vector‐borne and zoonotic infections among stray cats in Istanbul, Türkiye, by molecular and phylogenetic techniques.
Methods
DNA extracted from blood samples of 316 stray cats was analysed using conventional PCR assays to identify various pathogens, targeting genes 16S rRNA for Anaplasma/Ehrlichia/Bartonella spp., 18S rRNA for Hepatozoon spp., LT1 for Leishmania spp. and 529 bp—Repetitive element for Toxoplasma gondii. Phylogenetic reconstructions were conducted based on the results.
Results
Anaplasma/Ehrlichia/Bartonella spp., Hepatozoon spp. and T. gondii prevalence were 1.8%, 3.4% and 0.3%, respectively. In addition, sequencing revealed the following prevalences: Ehrlichia canis (0.3%), Hepatozoon felis (1.5%), Hepatozoon canis (0.3%), Bartonella henselae (0.3%), Bartonella clarridgeiae (0.3%) and T. gondii (0.3%). No Leishmania spp. or Anaplasma spp. DNA was detected in any of the samples. The E. canis 16S rRNA gene sequence obtained in the study showed 100% homology with E. canis from Venezuela (human), and the H. felis 18S rRNA gene sequence demonstrated 99.45%–100% similarity with H. felis from Türkiye (Haemaphysalis parva).
Conclusion
This study is the first to report molecular and phylogenetic findings of E. canis and H. canis in cats from Türkiye. Notably, E. canis, Bartonella spp. and T. gondii all have zoonotic potential, highlighting the need for surveillance within the framework of a One Health approach.
Keywords: cats, ehrlichia, hepatozoon, pathogens, PCR, Türkiye, vector‐borne, zoonotic
Istanbul, the largest metropolis in Türkiye, is home to a notable population of stray cats. While cats enrich the city's culture, they can also transmit various diseases, posing diagnostic challenges for clinicians. This study aimed to detect infections in stray cats using PCR and sequencing to identify Ehrlichia, Anaplasma, Bartonella, Hepatozoon, Leishmania and Toxoplasma gondii.

1. Introduction
Türkiye is known for its large population of cats, especially in Istanbul, the country's largest city. This vibrant metropolis serves as a crucial gateway to Europe. In recent years, there has been a notable increase in both companion animal ownership and stray cats, serving as reservoirs or hosts for various vector‐borne diseases. Although limited studies have focused on this topic in Istanbul, recent findings in the country indicate the emergence of diseases among the feline populations, such as Anaplasma spp. (Muz et al. 2021), Hepatozoon spp. (Koçkaya et al. 2023) and Leishmania spp. (Aksulu et al. 2021).
Anaplasmosis and ehrlichiosis are zoonotic diseases that occur worldwide and are transmitted to humans and animals through ticks from the Ixodidae family (Pennisi et al. 2017). Geographical disease distribution is linked to the competent vectors: R. sanguineus sensu lato and sensu stricto being the primary vectors for E. canis (Ipek et al. 2018) and A. platys (Snellgrove et al. 2020), respectively. In the USA, Ixodes pacificus and Ixodes scapularis transmit A. phagocytophilum, while Ixodes ricinus serves this role in Europe (Pennisi et al. 2017). A. phagocytophilum and A. platys have recently been identified in cats in Türkiye (Muz et al. 2021)—but, although E. canis is commonly found in dogs, it has not yet been reported in cats in Türkiye.
Hepatozoon spp. belong to the Apicomplexa phylum and are transmitted to vertebrates by ingesting hematophagous arthropods, primarily ticks, harbouring mature oocysts containing sporozoites. In addition, transmission can occur through predation and transplacental routes (Baneth et al. 2013). Globally, Hepatozoon felis has been identified as the predominant species infecting cats (Lloret et al. 2015), including those in Türkiye (Muz et al. 2021; Koçkaya et al. 2023; Önder et al. 2025). Recently, Hepatozoon silvestris has been detected in cats from Türkiye (Önder et al. 2025), Switzerland (Kegler et al. 2018) and Italy (Giannelli et al. 2017). Hepatozoon canis has been reported in cats from Europe (Giannelli et al. 2017; Diaz‐Reganon et al. 2017; Criado‐Fornelio et al. 2009) and Asia (Baneth et al. 2013; Jittapalapong et al. 2006), and it has also been found in dogs (Aktas et al. 2013), red foxes (Orkun and Nalbantoğlu 2018) and their ticks (Aktas et al. 2013; Orkun and Nalbantoğlu 2018) within Türkiye. However, no cases of H. canis have been reported in cats in Türkiye.
Cats are known as the primary reservoir of Bartonella henselae, Bartonella clarridgeiae and Bartonella koehlarea species. The most prevalent species affecting both cats and humans is B. henselae, which causes cat scratch disease and other potentially fatal disorders in immunocompromised individuals. B. henselae is typically transmitted among cats via a flea vector (Ctenocephalides felis felis) or in their faeces, but is commonly spread to other animals, including humans, through cat scratches. In addition, blood transfusions can pose a transmission risk (Alvarez‐Fernandez et al. 2018). In Türkiye, high rates of B. henselae have been molecularly diagnosed in cats (4.0%–40.0%) (Muz et al. 2021; Köseoğlu et al. 2022; Diren Sigirci and Ilgaz 2013), and B. henselae seropositivity was found to be statistically significantly higher (26.5%) in stray cat/dog owners (Aydin et al. 2019).
Toxoplasma gondii is a prevalent parasite globally, posing health risks such as abortions, neonatal complications and even fatality in humans, particularly in immunocompromised patients. Cats play a significant role in the transmission of T. gondii by contaminating food and water supplies with resilient oocysts in the faeces. In Türkiye, particularly Istanbul, infection rates are concerning, with seropositivity rates of 24% (Akyar 2011) among women of childbearing age and 31% (Dogan et al. 2015) in pregnant women for IgG antibodies. High seropositivity rates have also been found in cattle (24%) and sheep (25%) at local slaughterhouses. Furthermore, T. gondii DNA has been detected in ovine muscle samples (20%) and fermented sausage products (19%) (Ergin et al. 2009). To our knowledge, no molecular or serological screening has been conducted on cats in Istanbul for T. gondii, and PCR studies are limited (Karakavuk et al. 2021; Duru et al. 2017). Cat infection rates, especially among stray or free‐living populations, serve as reliable indicators of the level of T. gondii in the environment because infected cats can shed millions of infectious oocysts for a short period. Serological methods are commonly used for diagnosing Toxoplasma, but in recent years, direct detection methods, such as polymerase chain reaction (PCR), are increasingly used in both human and veterinary medicine (Dubey et al. 2020).
Leishmania infantum is a zoonotic disease transmitted by phlebotomine sand flies, primarily affecting dogs as the main reservoir. Although there is no evidence of the potential role of other arthropods (fleas and ticks) as vectors, L. infantum DNA has been detected in Ixodes spp., Rhipicephalus spp. (Pennisi et al. 2015) and C. felis (Persichetti et al. 2016). The prevalence of L. infantum is lower in cats than in dogs, but feline leishmaniosis is increasingly reported in Mediterranean countries like Italy, Spain and Türkiye, as well as in Iran and Brazil (Pennisi and Persichetti 2018). Leishmania tropica and Leishmania major are less commonly found in dogs but have been identified in stray cats in the Ege region of Türkiye (Paşa 2015; Can et al. 2016).
The diversity of these diseases and the emergence of new pathogens pose significant diagnostic challenges for clinicians. The objective of this study was to detect infections in cats from the Istanbul area using PCR and phylogenetic techniques to identify Ehrlichia, Anaplasma, Bartonella, Hepatozoon, Leishmania and T. gondii. In addition, various host factors, including age, gender and ectoparasite status, were analysed.
2. Materials and Methods
2.1. Study Area and Sample Collection
The study sample consisted of 316 stray cats (200 ♀ and 116 ♂) from various municipal shelters (including Besiktas [n = 16], Beylikduzu [n = 40], Beykoz [n = 25], Buyukada [n = 25], Buyukcekmece [n = 40)] Esenyurt [n = 40], Eyup [n = 20], Kucukcekmece [n = 30], Maltepe [n = 20], Silivri [n = 40], and Sile [n = 20] districts), in the Istanbul province of Türkiye between 2018 and 2020 (Figure 1).
FIGURE 1.

Map of stray cat sampling area.
Peripheral blood samples were obtained from each cat by cephalic venipuncture, and the blood collected (1 mL) was placed into EDTA tubes. Subsequently, 200 µL of blood was transferred to sterile microcentrifuge tubes and stored at −20°C for molecular analyses. All experimental procedures were approved by the Istanbul University Ethics Committee (approval number: 2018/36).
2.2. Molecular and Phylogenetic Analysis
DNA extraction from 200 µL of blood was performed using the Extractme DNA Blood Kit (Blirt, Poland) according to the manufacturer's instructions. DNA was eluted in 100 µL of elution buffer and stored at −20°C until used. DNA concentrations were measured using a NanoDrop 2000 spectrophotometer.
The conventional PCR was carried out according to the protocols previously described for genes 16S rRNA of Anaplasma/Ehrlichia/Bartonella spp., 18S rRNA of Hepatozoon spp., LT1 of Leishmania spp. and 529 ‐ bp repetitive element (RE) for T. gondii. All primers and PCR protocols used to detect parasites are summarized in Table 1. DNA from known infected cats were used as a positive control, and nuclease‐free water was used as a negative control for all reactions. PCR reactions were carried out in a total volume of 25 µL, and for each sample, 12.5 µL master mix, 6.5 µL bi‐distilled water, 0.5 µL forward primer and 0.5 µL reverse primer and 5 µL target DNA were placed in sterile PCR tubes. The study used agarose gels prepared at 1.2% and 1.5%, considering the DNA sizes. After removing it from the microwave, 5 µL of DNA dye was added to the agarose gel (Red Safe). DNAs were loaded into the gel and run at 90–120 volts for 30–45 min. After the process was completed, the agarose gel was taken out and examined for the presence of specific bands on the UV transilluminator. Positive sample bands were photographed with a digital imaging system (iBright 1500, Invitrogen Thermofisher Imaging Systems, America).
TABLE 1.
Primer sets, target genes, product sizes and references used in the study.
| Pathogens | Primers (5′‐3′) | Gene | Product size (bp) | Reference |
|---|---|---|---|---|
|
Anaplasma/ Ehrlichia/ Bartonella spp |
F:GGAATTCAGAGTTGGATCMTGGYTCAG R:CGGGATCCCGAGTTTGCCGGGACTTCTTCT |
16S rRNA | 456‐476 bp | (Schouls et al. 1999) |
| Hepatozoon spp. |
F:ATACATGAGCAAAATCTCAAC R:CTTATTATTCCATGCTGCAG |
18S rRNA | 666 bp | (Inokuma et al. 2002) |
| Leishmania spp. |
F:CTTTTCTGGTCCCGCGGGTAGG R:CCACCTGGCCTATTTTACACCA |
LT1 | 145 bp | (le Fichoux et al. 1999) |
| Toxoplasma gondii |
F:CGCTGCAGGGAGGAAGACGAAAGTTG R:CGCTGCAGACACAGTGCATCTGGATT |
529 bp—RE | 529 bp | (Homan et al. 2000) |
The PCR amplicons were sequenced by a private laboratory (BMLabosis, Ankara), and sequences were assembled using BioEdit software and compared for similarity with sequences deposited in GenBank using the basic local alignment search tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/). Homologous DNA sequences were aligned, and phylogenetic trees were constructed with MEGA 7.0 software (Kumar et al. 2016).
2.3. Statistical Data Analysis
The sample size was estimated using exact binomial 95% confidence intervals (CIs). The chi‐square test was used to analyse the results of PCR tests in relation to age, gender and ectoparasite presence of the examined cats. Values of p < 0.05 were considered significant.
3. Results
The study sample comprised 200 female and 116 male cats. Regarding age, 190 cats were one year old or younger, while 210 were older than one year. Ectoparasites (fleas) were detected on 218/316 (69%) cats. Fleas were collected from 40 of these cats, and all were identified as C. felis felis. All cats appeared healthy during sampling. No statistical difference was determined between age, gender, ectoparasite presence and haemopathogen PCR detection (Table 2).
TABLE 2.
Host risk factors associated with PCR positivity for vector borne diseases in stray cats of Istanbul.
| Risk factor | Variables | Number of cats (n) | PCR positive: n (%) | Test statistic | Degrees of freedom | p‐value |
|---|---|---|---|---|---|---|
| Age |
>1 Year ≤1 Year |
210 106 |
13 (6.1) 5 (4.7) |
0.28 | 1 | 0.59 |
| Gender |
Male Female |
116 200 |
10 (8.6) 8 (4.0) |
2.91 | 1 | 0.08 |
| Ectoparasites |
Yes No |
218 98 |
16 (7.3) 2 (2.0) |
3.53 | 1 | 0.06 |
p < 0.05 indicate a significant association with PCR‐positivity.
Of the 316 blood samples, 18 (5.6%; 95% CI: 22.2‐35.1%) were positive for haemopathogens. The overall prevalence of Anaplasma/Ehrlichia/Bartonella spp. (n = 6, 1.8%), Hepatozoon spp. (n = 11, 3.4%), and T. gondii (n = 1, 0.3%) were identified with conventional PCR assays (Figure 2). Sequencing analysis revealed the following pathogens from the PCR‐positive amplicons: H. felis (n = 5), H. canis (n = 1), Ehrlichia canis (n = 1), B. henselae (n = 1), B. clarridgeiae (n = 1) and T. gondii (n = 1). Sequencing and BLAST analysis results are summarized in Table 3. None of the samples were positive for Anaplasma or Leishmania.
FIGURE 2.

Agrose gel electrophoresis view of positive amplicons. (A) line 1; DNA ladder, line 2; positive control for Hepatozoon spp., line 3–13 positive samples, line 14; negative control. (B) line 1; DNA ladder, line 2; positive control for T. gondii, line 3; positive sample, line 4; negative control. (C) line 1; DNA ladder, line 2; positive control for Anaplasma/Ehrlichia/Bartonella spp., line 2; negative control, line 4–9 positive samples. The sequenced samples are indicated by their ID numbers (C5, C6, C16 etc).
TABLE 3.
Various host factors and homology of sequences with those of GenBank, all showing 100% query coverage.
| Cat ID (Area) | Species | Gender | Age (years) | Ecto‐parasite | Accession number, similarity%, host, country | Accession number |
|---|---|---|---|---|---|---|
| C5 (Beylikduzu) | H. canis | F | >1 | C. felis |
MK957187, 99.65% Dog, Iraq |
PQ608612 |
| C6 (Esenyurt) | H. felis | M | >1 | C. felis |
OQ076292, 100% Cat, Turkey |
PQ608613 |
| C16 (Silivri) | H. felis | F | ≤1 | — |
OQ076292, 100% Cat, Turkey |
PQ657278 |
| C17 (Silivri) | H. felis | M | >1 | C. felis |
OQ076292, 100% Cat, Turkey |
PQ657290 |
| C18 (Buyukada) | H. felis | M | >1 | C. felis |
OQ076292, 99.45% Cat, Turkey |
PQ657291 |
| C28 (Esenyurt) | E. canis | F | >1 | C. felis |
KJ513196, 100% Dog, Turkey |
PQ608562 |
| C59 (Beykoz) | H. felis | M | >1 | C. felis |
OQ076292, 100% Cat, Turkey |
PQ657293 |
| C92 (Maltepe) | B. henselae | M | ≤1 | C. felis |
OQ165187, 100% Cat, Turkey |
PQ608598 |
| C204 (Besiktas) | B.clarridgeiae | M | >1 | C. felis |
AB292603, 98.40% USA |
PQ657295 |
| C239 (Eyup) | T. gondii | F | >1 | — |
PQ202301, 100% Dog, Turkey |
PQ661245 |
Phylogenetic trees for E. canis and Hepatozoon spp. were constructed based on their respective genes (16S rRNA and 18S rRNA). These sequences were compared with those deposited in the NCBI GenBank database. E. canis 16S rRNA gene sequence obtained in the study (PQ608562) demonstrated a strongly‐supported clade with the 16S rRNA gene sequences from Venezuela (human), Italy (ticks), Turkey (dogs and ticks), Greece (dogs), Japan (Iriomote cats) and India (dogs) with a 100% homology (Figure 3). H. felis 18S rRNA gene sequences obtained in the study (PQ608613, PQ657278, PQ657290, PQ657291, PQ657293) established a strongly‐supported clade with the 18S rRNA gene sequences from Turkey (cats, ticks and Eurasian lynx) with a 99.45%–100% nucleotide sequence identity (Figure 4). H. canis 18S rRNA gene obtained in the study (PQ608612) showed a strongly‐supported clade with the H. canis 18S rRNA gene sequences from Turkey (dogs, red foxes), Iraq (dogs), China (cats), Romania (golden jackal), Serbia (mouse) and Jordan (dogs) with a 99.47%–99.65% nucleotide sequence identity (Figure 4).
FIGURE 3.

A maximum likelihood phylogram of Ehrlichia species was inferred from the 16S rRNA gene. The tree was constructed using MEGA version 7 software, applying the Kimura‐2 parameter model with evolutionary rates among sites (K2). To assess the confidence of the nodes and branches in the tree, bootstrap analysis with 1.000 replications was conducted. The sequences included in this study are demonstrated in boldface. The 16S rRNA gene sequence of Mycoplasma bovis (KM576849) was used as an outgroup.
FIGURE 4.

A maximum likelihood phylogram of Hepatozoon species was inferred from the 18S rRNA gene. The tree was constructed using MEGA version 7 software, applying the Tamura‐3 parameter model with evolutionary rates among sites (T92). To assess the confidence of the nodes and branches in the tree, bootstrap analysis with 1.000 replications was conducted. The sequences included in this study are demonstrated in boldface. The 18S rRNA gene sequence of Theileria equi (LC781921) was used as an outgroup.
4. Discussion
The first step in disease prevention is access to current data regarding disease risk. While vector‐borne diseases have been studied more extensively in dogs, both globally and within Türkiye, it is essential to recognize that cats can also act as carriers or reservoirs for many diseases (Muz et al. 2021; Önder et al. 2025; Ceylan et al. 2024). Istanbul boasts a diverse geography with a Mediterranean climate along the Marmara coast and a humid subtropical climate near the Bosporus and north. Although this research is conducted at the provincial level, we endeavoured to enhance the epidemiological reliability of our study by gathering samples from various regions of Istanbul that reflect these different climates. This diversity is important, as it may influence vector distribution. Nevertheless, studies encompassing the entire country with a larger sample size are generally more reliable when assessing the prevalence of pathogens.
The study detected several cat pathogens, including Anaplasma/Ehrlichia/Bartonella spp. (1.8%), Hepatozoon spp. (3.4%) and T. gondii (0.3%). Sequencing and phylogenetic analyses confirmed the presence of the dog monocytic ehrlichiosis agent E. canis and dog hepatozoonosis agent H. canis DNA in cats for the first time in Türkiye. In addition, the study identified the cat scratch disease species B. henselae and B. clarridgeiae, as well as T. gondii, through sequencing. Notably, T. gondii DNA was found in cats in Istanbul for the first time. None of the cats tested positive for Anaplasma spp. or Leishmania spp., and no statistical findings were found regarding the cats' age, gender, ectoparasite status or PCR positivity.
Ehrlichiosis is considered a rare disease in cats compared to dogs. It is not fully understood whether this rarity is due to cats' internal resistance to the pathogen (Shaw et al. 2001) or their more effective tick removal during self‐grooming (Breitschwerdt et al. 2002). Molecular detections of E. canis in cats have been documented in several countries, including 2.4% in Italy (Ebani et al. 2020), 3.6% in Pakistan (Abbas et al. 2023), 2.9% in Qatar (Alho et al. 2017) and 0.3% in the United States (Hegarty et al. 2015). E. canis is a common parasite in dogs in our country. However, only one case has been reported in which the parasite was found in a cat's blood smear and diagnosed using an immunofluorescence assay (Albay et al. 2016). Most research on this subject has been conducted in Brazil (Braga et al. 2014, 2017; de Braga Mdo et al. 2012), with the highest prevalence reported at 9.4% (Braga et al. 2014). There is little information on the pathogenesis of rickettsial agents in cats (Pennisi et al. 2017). Surprisingly, in some studies, while PCR‐positive cats were asymptomatic (Braga et al. 2017; Kelly et al. 2017), as in dogs, severe symptoms have been described (Breitschwerdt et al. 2002). PCR is a sensitive technique for diagnosing the disease, but false negative results can occur, particularly following antibiotic treatment (Criado‐Fornelio et al. 2009). R. sanguineus primarily feeds on dogs, but it can also parasitize cats (Braga et al. 2017). The natural transmission cycles of this bacterium to cats are not yet fully understood. However, R. sanguineus may serve as a vector for E. canis in cats in Turkey. In the presented study, the 16S rRNA gene sequence of E. canis showed a strongly supported clade with the 16S rRNA gene sequences from Rhipicephalus sanguineus ticks from Turkey (KY847523) and Italy (GQ857078), demonstrating a 100% nucleotide sequence identity. Moreover, the sequence of E. canis found in cats may be zoonotically important, as it is closely related to the sequence previously identified in humans in Venezuela (AF373612) with a 100% sequence identity. Anaplasma spp. was not detected in the cats participating in this study. In contrast, a recent study identified A. phagocytophilum and A. platys through PCR in cats presenting to an animal hospital in Tekirdag (Muz et al. 2021). The absence of Anaplasma agents in the current study may be related to differences in vector distribution, the health status of the animals, or variations in the molecular techniques utilized.
Hepatozoon infections have been increasingly detected molecularly in cat populations in Europe (4.0%–30.0%) (Carbonara et al. 2023) and in Türkiye (2.3%–10.8%) (Muz et al. 2021; Koçkaya et al. 2023; Önder et al. 2025). In Türkiye, H. silvestris (Önder et al. 2025) and H. felis (Muz et al. 2021; Koçkaya et al. 2023) species have been diagnosed in cats, and Hepatozoon DNA was found in several tick species, including R. sanguineus (Aktas et al. 2013), R. turanicus, Hyalomma marginatum, I. ricinus and Haemaphysalis parva (Orkun et al. 2020). While the vector for feline hepatozoonosis is still unknown, it is considered that H. parva could potentially serve as a vector for Hepatozoon species in Türkiye (Orkun et al. 2020). In this study, homology was found between the four H. felis 18S rRNA gene sequences (PQ608613, PQ657278, PQ657290, PQ657293) from stray cats and those of H. parva (MN905024, MN905025) with 100% sequence identity and 100% query coverage. Likewise, this was the same homology as in the Eurasian Lynx from Türkiye (MZ895464). H. parva can be a competent vector for H. felis; however, this hypothesis requires further investigation.
H. canis predominantly infects domestic and wild canids, but has also been reported at low rates in cats in Europe, including 0.5% in Italy (Giannelli et al. 2017), 0.15% in Spain (Diaz‐Reganon et al. 2017) and 1.7% in France (Criado‐Fornelio et al. 2009), as in the presented study (0.3%, 1/316). H. canis 18S rRNA gene sequence (PQ608612) is closely related to those reported in wildlife canids and dogs from Türkiye, Iraq, Jordan and Romania, except cats from China (OM714910). Interestingly, the H. canis sequence from stray cats was closely related to a yellow‐necked field mouse (Apodemus flavicollis) from Serbia (OQ262961) with a 99.47% nucleotide identity. The yellow‐necked mouse is also found in Türkiye, especially around farmlands and buildings in rural areas. The role of this rodent is unknown; however, we consider it a potential paratenic host for H. canis. The phylogenetic analysis of 18S rRNA Hepatozoon sequences derived from stray cats in this study displays that H. felis and H. canis can infect felines in Istanbul, with H. felis obtaining a significantly higher prevalence.
Despite the low prevalence of Leishmania infection in cats, they are thought to contribute to the epidemiology and transmission of the parasite in Europe (Mancianti 2004). Molecular evidence of feline leishmaniosis has been documented at 12.6% in the Black Sea (Pekmezci et al. 2024), and 0.54% (Can et al. 2016) and 8.84% (Paşa 2015) in Ege regions of Türkiye, utilizing real‐time or nested PCR methods that target the ITS1 or Hsp70 gene regions. The failure to detect Leishmania in this study may be due to vector distribution and/or molecular technique variations.
B. henselae and B. clarridgeiae are frequently isolated from domestic cats, with a high reported prevalence (10%–67%) in countries with favourable temperatures and humidity favouring the flea vector, such as Italy, Spain, Portugal and Greece (Alvarez‐Fernandez et al. 2018). In Türkiye, the molecular prevalence of B. henselae ranges from 4% to 40%, while the prevalence of B. clarridgeiae varies from 0% to 9%, as reported in various studies that targeted the 16S‐23S rRNA ITS and gltA genes (Muz et al. 2021; Köseoğlu et al. 2022; Diren Sigirci and Ilgaz 2013; Aydin et al. 2019). In the present study, three of the Anaplasma/Ehrlichia/Bartonella positive samples could be sequenced. B. henselae 16s rRNA gene sequence obtained from stray cats was closely related to cats from Türkiye (OQ165187) and Brazil (ON564896) with a 100% sequence identity. Moreover, it showed 100% homology with a DNA sequence from a febrile patient (M73229) infected with human immunodeficiency virus. An assessment of the prevalence of bacteraemia based on lifestyle conditions indicates that stray cats are more likely to be bacteraemic than pet cats (Köseoğlu et al. 2022). However, our study revealed a lower prevalence in Istanbul, which may be attributed to the 16S rRNA gene providing insufficient distinction for phylogenetic analysis at the species level (Köseoğlu et al. 2022).
In recent years, genotypes II and III of T. gondii have been identified in domestic cats in Türkiye, which are also prevalent in Europe (Can et al. 2014). Several studies have detected these parasites in the blood of cats, showing a prevalence of 8.1% in Ankara using nested PCR (Duru et al. 2017) and 8.8% in Izmir using real‐time PCR (Karakavuk et al. 2021). Notably, this study marks the first molecular detection of T. gondii in cats from Istanbul, and the findings have been registered in GenBank (PQ661245). T. gondii 529 bp RE gene sequence obtained in the study showed 99%–100% sequence identity with sequences of cats from Sweden (U03070), Iran (LC416237) and China (KX008018). It was also closely related to other hosts, including dogs from Turkey (PQ202301), red foxes from Poland (EU165368), common wombats from Australia (KM875436) and crab‐eating foxes from Brazil (OR805035), with 100% sequence homology. Although we obtained a lower prevalence of toxoplasmosis in stray cats via PCR, detecting acutely infected cats is crucial for preventing human infections and soil contamination. The low prevalence may be due to its presence in the blood only during the acute phase, after which it migrates to the tissues. Combining serological and molecular methods can provide more effective results since stray cats may initially encounter this parasite in the early months of their lives and remain seropositive afterwards. Wider investigation is warranted since detection rates in animals and meat offered for consumption in Türkiye are alarming (Ergin et al. 2009).
5. Conclusion
For the first time, E. canis and H. canis were molecularly identified as cats in Türkiye. Low‐moderate levels of multiple vector‐borne pathogens were detected in the Istanbul stray cat population, and comprehensive studies are needed to ascertain the associated risks for humans.
Author Contributions
Tuba Yazıcıoğlu: writing – review and editing, writing – original draft, visualization, project administration, methodology, Investigation, formal analysis, conceptualization. Handan Çetinkaya: writing – review and editing, supervision, conceptualization, resources.
Ethics Statement
All experimental procedures were approved by the Istanbul University Ethics Committee (approval number: 2018/36).
Conflicts of Interest
The authors declare no conflicts of interest.
Peer Review
The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer‐review/10.1002/vms3.70552.
Acknowledgements
We thank Handan Cetinkaya (Istanbul), Ahmet Deniz (Kars) and Mehmet Aydın (Karaman) for providing positive control samples. Also we would like to thank the technicians and veterinarians working in the municipal shelters who helped collect the blood samples.
Yazicioglu, T. , and Cetinkaya H.. 2025. “Prevalence and Sequence Analysis of Vector‐Borne Zoonotic Diseases in Stray Cats in Istanbul.” Veterinary Medicine and Science 11, no. 5: 11, e70552. 10.1002/vms3.70552
Funding: This research was supported by the İstanbul Üniversitesi ‐ Cerrahpaşa Bilimsel Araştırma Projeleri Koordinatörlüğü (grant number 31133).
Contributor Information
Tuba Yazicioglu, Email: tubtas@gmail.com.
Handan Cetinkaya, Email: handan@istanbul.edu.tr.
Data Availability Statement
All data supporting this study's findings are available in the article's material.
References
- Abbas, S. N. , Ijaz M., Abbas R. Z., Saleem M. H., and Mahmood A. K.. 2023. “Molecular Evidence of Ehrlichia Canis, Associated Risk Factors and Hematobiochemical Analysis in Client Owned and Shelter Cats of Pakistan.” Comparative Immunology, Microbiology and Infectious Diseases 94: 101959. 10.1016/j.cimid.2023.101959. [DOI] [PubMed] [Google Scholar]
- Aksulu, A. , Bilgiç H. B., Karagenç T., and Bakırcı S.. 2021. “Seroprevalence and Molecular Detection of Leishmania spp. in Cats of West Aegean Region, Turkey.” Veterinary Parasitology: Regional Studies and Reports 24: 100573. 10.1016/j.vprsr.2021.100573. [DOI] [PubMed] [Google Scholar]
- Aktas, M. , Ozubek S., and Ipek D. N. S.. 2013. “Molecular Investigations of Hepatozoon Species in Dogs and Developmental Stages of Rhipicephalus sanguineus .” Parasitology Research 112, no. 6: 2381–2385. 10.1007/s00436-013-3403-6. [DOI] [PubMed] [Google Scholar]
- Akyar, I. 2011. “Seroprevalence and Coinfections of Toxoplasma gondii in Childbearing Age Women in Turkey.” Iranian Journal of Public Health 40, no. 1: 63–67. https://pmc.ncbi.nlm.nih.gov/articles/PMC3481714/. [PMC free article] [PubMed] [Google Scholar]
- Albay, M. K. , Sevgi̇Sunar N. S., Şahi̇Nduran S., and Özmen Ö.. 2016. “The First Report of Ehrlichiosis in a Cat in Turkey.” Ankara Üniversitesi Veteriner Fakültesi Dergisi 63: 329–331. [Google Scholar]
- Alho, A. M. , Lima C., Latrofa M. S., et al. 2017. “Molecular Detection of Vector‐Borne Pathogens in Dogs and Cats From Qatar.” Parasites & Vectors 10, no. 1: 298. 10.1186/s13071-017-2237-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alvarez‐Fernandez, A. , Breitschwerdt E. B., and Solano‐Gallego L.. 2018. “Bartonella Infections in Cats and Dogs Including Zoonotic Aspects.” Parasites & Vectors 11, no. 1: 624. 10.1186/s13071-018-3152-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Aydin, N. , Aydin N., Korkmazgil B., et al. 2019. “Seropositivity of Bartonella Henselae in Risky Human Population, Cats and Dogs.” Meandros Medical and Dental Journal 20: 51–56. 10.4274/meandros.galenos.2018.85057. [DOI] [Google Scholar]
- Baneth, G. , Sheiner A., Eyal O., et al. 2013. “Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) Based on Phylogenetic Analysis, Tissue and Blood Form Morphology, and Possible Transplacental Transmission.” Parasites & Vectors 6, no. 1: 102. 10.1186/1756-3305-6-102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Braga, Í. A. , dos Santos L. G. F., de Ramos D. G. S., Melo A. L. T., da Mestre G. L. C., and de Aguiar D. M.. 2014. “Detection of Ehrlichia Canis in Domestic Cats in the Central‐Western Region of Brazil.” Brazilian Journal of Microbiology 45: 641–645. 10.1590/S1517-83822014000200036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Braga, Í. A. , Taques I., Costa J dos S., et al. 2017. “ Ehrlichia canis DNA in Domestic Cats Parasitized by Rhipicephalus sanguineus Sensu Lato (s.l.) Ticks in Brazil—Case Report.” Brazilian Journal of Veterinary Research and Animal Science 54, no. 4: 412–415. 10.11606/issn.1678-4456.bjvras.2017.128222. [DOI] [Google Scholar]
- Breitschwerdt, E. B. , Abrams‐Ogg A. C. G., Lappin M. R., et al. 2002. “Molecular Evidence Supporting Ehrlichia canis‐Like Infection in Cats.” Journal of Veterinary Internal Medicine 16, no. 6: 642–649. 10.1111/j.1939-1676.2002.tb02402.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Can, H. , Döşkaya M., Ajzenberg D., et al. 2014. “Genetic Characterization of Toxoplasma gondii Isolates and Toxoplasmosis Seroprevalence in Stray Cats of İzmir, Turkey.” PLoS ONE 9, no. 8: e104930. 10.1371/journal.pone.0104930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Can, H. , Döşkaya M., Özdemir H. G., et al. 2016. “Seroprevalence of Leishmania Infection and Molecular Detection of Leishmania tropica and Leishmania infantum in Stray Cats of İzmir, Turkey.” Experimental Parasitology 167: 109–114. 10.1016/j.exppara.2016.05.011. [DOI] [PubMed] [Google Scholar]
- Carbonara, M. , Iatta R., Sgroi G., et al. 2023. “Hepatozoon Species Infecting Domestic Cats From Countries of the Mediterranean Basin.” Ticks and Tick‐Borne Diseases 14, no. 5: 102192. 10.1016/j.ttbdis.2023.102192. [DOI] [PubMed] [Google Scholar]
- Ceylan, O. , Ma Z., Ceylan C., et al. 2024. “Feline Vector‐Borne Haemopathogens in Türkiye: The First Molecular Detection of Mycoplasma wenyonii and Ongoing Babesia ovis DNA Presence in Unspecific Hosts.” BMC Veterinary Research 20, no. 1: 365. 10.1186/s12917-024-04209-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Criado‐Fornelio, A. , Buling A., Pingret J. L., et al. 2009. “Hemoprotozoa of Domestic Animals in France: Prevalence and Molecular Characterization.” Veterinary Parasitology 159, no. 1: 73–76. 10.1016/j.vetpar.2008.10.012. [DOI] [PubMed] [Google Scholar]
- de Braga Mdo, S. C. O. , André M. R., Freschi C. R., Teixeira M. C. A., and Machado R. Z.. 2012. “Molecular and Serological Detection of Ehrlichia spp. in Cats on São Luís Island, Maranhão, Brazil.” Revista Brasileira de Parasitologia Veterinária 21: 37–41. 10.1590/S1984-29612012000100008. [DOI] [PubMed] [Google Scholar]
- Diaz‐Reganon, D. , Villaescusa A., Ayllón T., et al. 2017. “Molecular Detection of Hepatozoon spp. And Cytauxzoon sp. in Domestic and Stray Cats From Madrid, Spain.” Parasites & Vectors 10, no. 1: 112. 10.1186/s13071-017-2056-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Diren Sigirci, B. D. , and Ilgaz A.. 2013. “Detection of the Presence of Bartonella henselae in Cats in Istanbul.” İstanbul Üniversitesi Veteriner Fakültesi Dergisi 39, no. 2: 209–217. 10.16988/iuvfd.45052. [DOI] [Google Scholar]
- Dogan, K. , Guraslan H., Ozel G., Aydan Z., and Yasar L.. 2015. “Seroprevalence Rates of Toxoplasma gondii, Rubella, Cytomegalovirus, Syphilis, and Hepatitis B, Seroprevalences Rate in the Pregnant Population in İstanbul.” TurkiyeParazitolDerg 38, no. 4: 228–233. 10.5152/tpd.2014.3435. [DOI] [PubMed] [Google Scholar]
- Dubey, J. P. , Cerqueira‐Cézar C. K., Murata F. H. A., Kwok O. C. H., Yang Y. R., and Su C.. 2020. “All About Toxoplasmosis in Cats: The Last Decade.” Veterinary Parasitology 283: 109145. 10.1016/j.vetpar.2020.109145. [DOI] [PubMed] [Google Scholar]
- Duru, S. Y. , Kul O., Babür C., Deniz A., Pekcan Z., and Yağcı İ. P.. 2017. “Kedilerde Toksoplazmoz Tanısında Seroloji, Sitoloji Ve Polimeraz Zincir Reaksiyonunun Tanısal Değerlerinin Araştırılması.” Ankara Üniversitesi Veteriner Fakültesi Dergisi 64: 199–203. [Google Scholar]
- Ebani, V. V. , Guardone L., Marra F., Altomonte I., Nardoni S., and Mancianti F.. 2020. “Arthropod‐Borne Pathogens in Stray Cats From Northern Italy: A Serological and Molecular Survey.” Animals 10, no. 12: 2334. 10.3390/ani10122334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ergin, S. , Ciftcioglu G., Midilli K., Issa G., and Gargili A.. 2009. “Detection of Toxoplasma gondii From Meat and Meat Products by the Nested‐PCR Method and Its Relationship With Seroprevalence in Slaughtered Animals.” Bulletin of the Veterinary Institute in Pulawy 53, no. 4: 657–661. 10.5072/ZENODO.47744. [DOI] [Google Scholar]
- Giannelli, A. , Latrofa M. S., Nachum‐Biala Y., et al. 2017. “Three Different Hepatozoon Species in Domestic Cats From Southern Italy.” Ticks and Tick‐Borne Diseases 8, no. 5: 721–724. 10.1016/j.ttbdis.2017.05.005. [DOI] [PubMed] [Google Scholar]
- Hegarty, B. C. , Qurollo B. A., Thomas B., et al. 2015. “Serological and Molecular Analysis of Feline Vector‐Borne Anaplasmosis and Ehrlichiosis Using Species‐Specific Peptides and PCR.” Parasites & Vectors 8, no. 1: 320. 10.1186/s13071-015-0929-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Homan, W. L. , Vercammen M., De Braekeleer J., and Verschueren H.. 2000. “Identification of a 200‐ to 300‐Fold Repetitive 529 Bp DNA Fragment in Toxoplasma gondii, and Its Use for Diagnostic and Quantitative PCR1Note: Nucleotide Sequence Data Reported in this Paper Have Been Submitted to GenBankTM Database With the Accession Number AF146527 (Toxoplasma gondii genomic repetitive 529 bp fragment).1.” International Journal for Parasitology 30, no. 1: 69–75. 10.1016/S0020-7519(99)00170-8. [DOI] [PubMed] [Google Scholar]
- Inokuma, H. , Okuda M., Ohno K., Shimoda K., and Onishi T. 2002. “Analysis of the 18S rRNA Gene Sequence of a Hepatozoon Detected in Two Japanese Dogs.” Veterinary Parasitology 106, no. 3: 265–271. 10.1016/S0304-4017(02)00065-1. [DOI] [PubMed] [Google Scholar]
- Ipek, N. D. S. , Özübek S., and Aktas M.. 2018. “Molecular Evidence for Transstadial Transmission of Ehrlichia canis by Rhipicephalus sanguineus sensu lato under Field Conditions.” Journal of Medical Entomology 55, no. 2: 440–444. 10.1093/jme/tjx217. [DOI] [PubMed] [Google Scholar]
- Jittapalapong, S. , Rungphisutthipongse O., Maruyama S., Schaefer J. J., and Stich R. W.. 2006. “Detection of Hepatozoon canis in Stray Dogs and Cats in Bangkok, Thailand.” Annals of the New York Academy of Sciences 1081: 479–488. 10.1196/annals.1373.071. [DOI] [PubMed] [Google Scholar]
- Karakavuk, M. , Can H., Selim N., et al. 2021. “Investigation of the Role of Stray Cats for Transmission of Toxoplasmosis to Humans and Animals Living in İzmir, Turkey.” Journal of Infection in Developing Countries 15, no. 1: 155–162. 10.3855/jidc.13932. [DOI] [PubMed] [Google Scholar]
- Kegler, K. , Nufer U., Alic A., Posthaus H., Olias P., and Basso W.. 2018. “Fatal Infection With Emerging Apicomplexan Parasite Hepatozoon silvestris in a Domestic Cat.” Parasites & Vectors 11, no. 1: 428. 10.1186/s13071-018-2992-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kelly, P. J. , Köster L., Li J., et al. 2017. “Survey of Vector‐Borne Agents in Feral Cats and First Report of Babesia gibsoni in Cats on St Kitts, West Indies.” BMC Veterinary Research 13, no. 1: 331. 10.1186/s12917-017-1230-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koçkaya, E. S. , Güvendi M., Köseoğlu A. E., et al. 2023. “Molecular Prevalence and Genetic Diversity of Hepatozoon spp. in Stray Cats of İzmir, Türkiye.” Comparative Immunology, Microbiology and Infectious Diseases 101: 102060. 10.1016/j.cimid.2023.102060. [DOI] [PubMed] [Google Scholar]
- Köseoğlu, A. E. , Can H., Güvendi M., et al. 2022. “Molecular Prevalence and Genetic Diversity of Bartonella spp. in Stray Cats of İzmir, Turkey.” Parasites & Vectors 15, no. 1: 305. 10.1186/s13071-022-05431-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar, S. , Stecher G., and Tamura K.. 2016. “MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.” Molecular Biology and Evolution 33, no. 7: 1870–1874. 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- le Fichoux, Y. , Quaranta J. F., Aufeuvre J. P., et al. 1999. “Occurrence of Leishmania infantum Parasitemia in Asymptomatic Blood Donors Living in an Area of Endemicity in Southern France.” Journal of Clinical Microbiology 37, no. 6: 1953–1957. 10.1128/JCM.37.6.1953-1957.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lloret, A. , Addie D. D., Boucraut‐Baralon C., et al. 2015. “Hepatozoonosis in Cats: ABCD Guidelines on Prevention and Management.” Journal of Feline Medicine and Surgery 17, no. 7: 642–644. 10.1177/1098612x15589879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mancianti, F. 2004. “[Feline leishmaniasis: what's the epidemiological role of the cat?].” Parassitologia 46, no. 1–2: 203–206. [PubMed] [Google Scholar]
- Muz, M. N. , Erat S., and Mumcuoglu K. Y.. 2021. “Protozoan and Microbial Pathogens of House Cats in the Province of Tekirdag in Western Turkey.” Pathogens 10, no. 9: 1114. 10.3390/pathogens10091114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Önder, Z. , Pekmezci D., Yıldırım A., et al. 2025. “Microscopy and Molecular Survey of Hepatozoon spp. in Domestic Cats and Their Ticks: First Report of H. silvestris From Türkiye.” Parasitology International 104: 102979. 10.1016/j.parint.2024.102979. [DOI] [PubMed] [Google Scholar]
- Orkun, Ö. , Çakmak A., Nalbantoğlu S., and Karaer Z.. 2020. “Turkey Tick News: A Molecular Investigation Into the Presence of Tick‐Borne Pathogens in Host‐Seeking Ticks in Anatolia; Initial Evidence of Putative Vectors and Pathogens, and Footsteps of a Secretly Rising Vector Tick, Haemaphysalis Parva.” Ticks and Tick‐Borne Diseases 11, no. 3: 101373. 10.1016/j.ttbdis.2020.101373. [DOI] [PubMed] [Google Scholar]
- Orkun, Ö. , and Nalbantoğlu S.. 2018. “ Hepatozoon canis in Turkish Red Foxes and Their Ticks.” Veterinary Parasitology: Regional Studies and Reports 13: 35–37. 10.1016/j.vprsr.2018.03.007. [DOI] [PubMed] [Google Scholar]
- Paşa, S. 2015. “Detection of Leishmania Major and Leishmania Tropica in Domestic Cats in the Ege Region of Turkey.” Veterinary Parasitology 212, no. 3–4: 389–392. 10.1016/j.vetpar.2015.07.042. [DOI] [PubMed] [Google Scholar]
- Pekmezci, D. , Yildirim A., Kot Z. N., et al. 2024. “First Molecular Evidence of Leishmania infantum in Domestic Cats and Associated Risk Factors From the Black Sea Region of Türkiye.” Acta Parasitologica 69, no. 3: 1547–1554. 10.1007/s11686-024-00885-0. [DOI] [PubMed] [Google Scholar]
- Pennisi, M. G. , Hofmann‐Lehmann R., Radford A. D., and Tasker S.. 2017. “Anaplasma, Ehrlichia and Rickettsia Species Infections in Cats: European Guidelines From the ABCD on Prevention and Management.” Journal of Feline Medicine and Surgery 19, no. 5: 542–548. 10.1177/1098612x17706462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pennisi, M. G. , and Persichetti M. F.. 2018. “Feline Leishmaniosis: Is the Cat a Small Dog?” Veterinary Parasitology 251: 131–137. 10.1016/j.vetpar.2018.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pennisi, M. G. , Persichetti M. F., Serrano L., et al. 2015. “Ticks and Associated Pathogens Collected From Cats in Sicily and Calabria (Italy).” Parasites & Vectors 8, no. 1: 512. 10.1186/s13071-015-1128-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Persichetti, M. F. , Solano‐Gallego L., Serrano L., et al. 2016. “Detection of Vector‐Borne Pathogens in Cats and Their Ectoparasites in Southern Italy.” Parasites & Vectors 9, no. 1: 247. 10.1186/s13071-016-1534-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schouls, L. M. , Pol I. V. D., Rijpkema S. G. T., and Schot C. S.. 1999. “Detection and Identification of Ehrlichia, Borrelia burgdorferi Sensu Lato, and Bartonella Species in Dutch Ixodes ricinus Ticks.” Journal of Clinical Microbiology 37, no. 7: 2215–2222. 10.1128/JCM.37.7.2215-2222.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shaw, S. E. , Birtles R. J., and Day M. J.. 2001. “Arthropod‐Transmitted Infectious Diseases of Cats.” Journal of Feline Medicine and Surgery 3, no. 4: 193–209. 10.1053/jfms.2001.0149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snellgrove, A. N. , Krapiunaya I., Ford S. L., et al. 2020. “Vector Competence of Rhipicephalus sanguineus Sensu Stricto for Anaplasma platys .” Ticks and Tick‐Borne Diseases 11, no. 6: 101517. 10.1016/j.ttbdis.2020.101517. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data supporting this study's findings are available in the article's material.
