Abstract
BACKGROUND/OBJECTIVES
Yuja peel possesses anti-cancer, anti-inflammatory, and anti-diabetic properties. However, its potential anti-sarcopenic effects remain unclear. This study examined the effects of yuja peel hot water extract (YW) on dexamethasone (DEX)-induced muscle atrophy in C2C12 myotubes and sarcopenic mouse model.
MATERIALS/METHODS
We measured grip strength, cross-sectional area of the muscle fiber, biochemical markers, and expression of muscle-specific messenger RNA and proteins in atrophied muscle cell/tissue after treatment with YW.
RESULTS
In DEX-treated C2C12 cells, YW (100 and 200 µg/mL) increased the diameter of myotubes and reduced the gene and protein expression of muscle-specific F-box protein (atrogin-1) and muscle RING-finger protein-1 (MuRF-1) compared to the DEX (100 µM). In the mouse model with DEX (10 mg/kg)-induced muscle atrophy, treatment with YW (200 mg/kg/day) significantly increased grip strength and the cross-sectional area of the gastrocnemius muscle fibers, whereas it decreased serum lactate dehydrogenase and creatine phosphokinase levels compared to the DEX group. Treatment with YW downregulated the proteins related to muscle degradation, such as atrogin-1, MuRF-1, ubiquitin, and growth differentiation factor 8 (myostatin), by regulating the phosphatidylinositol 3-kinase (PI3K)-protein kinase B (Akt)-forkhead box O3 alpha (FoxO3α) pathway. Furthermore, treatment with YW upregulated the proteins associated with muscle protein synthesis, such as myogenic differentiation 1 (MyoD1), myogenin (MyoG), and myosin heavy chain (MHC), by regulating the PI3K-Akt-mammalian target of rapamycin (mTOR) pathway. A puromycin labeling assay in C2C12 myotube cells showed that YW treatment significantly increased protein synthesis compared to the cells treated with DEX alone. YW significantly upregulated the protein expression of phosphorylated PI3K and Akt in wortmannin (a PI3K inhibitor)-treated C2C12 cells.
CONCLUSION
YW suppressed DEX-induced muscle atrophy by regulating the PI3K-Akt-mTOR/FoxO3α signaling pathway. These results indicate that YW may serve as a potential agent for the treatment or prevention of muscle atrophy.
Keywords: Sarcopenia, mTOR, FoxO3α, dexamethasone, yuja peel extract
INTRODUCTION
Sarcopenia, also known as muscle atrophy, is characterized by the loss of muscle mass and strength, resulting in functional impairments [1]. Various factors contribute to its development, with aging being a primary cause [2]. When individuals age, physiological and morphological changes in the skeletal muscle lead to a progressive decline in both the size and number of skeletal muscle fibers [3]. Skeletal muscle mass and strength begin to decline in individuals as early as 40 yrs, with up to 40% of muscle mass being lost by the age of 80 [4,5]. Furthermore, the prevalence of sarcopenia is estimated to be 5–13% in individuals aged 60–79 yrs, and increases to 50% in those aged 80 yrs and older [5,6]. Muscle weakness can lead to weight loss, physical disability, and an increased risk of falls and fractures [7]. Additionally, frequent falls and diminished walking ability can severely impact the quality of life [7].
Citrus junos commonly known as yuja is a yellow-colored citrus fruit primarily cultivated in both Korea and Japan. It is generally smaller than other citrus fruits like oranges or grapefruit, with a rough and bumpy surface [8]. Yuja is used as an aromatic ingredient in various processed foods, including teas, and dressings. Notably, due to its distinctive flavor and potential effectiveness against colds, yuja is common component in herbal medicines and beverages [9]. The vitamin C content of yuja is 2 times higher than that in lemon, and yuja is also abundant in flavonoids, such as naringin and hesperidin [10,11]. These compounds have been reported to be more concentrated in the peel than in the flesh [10,11]. Yuja peel extract has been reported to possess anti-cancer [12], anti-diabetic [13], anti-obesity [14], and anti-inflammatory [15] properties. However, its anti-sarcopenic effects have not yet been elucidated.
In this study, we compared the protective effects of yuja peel hot water extract (YW) and ethanol extract (YE) in vitro in dexamethasone (DEX)-induced muscle atrophy in C2C12 cells, confirmed the in vivo efficacy of YW in a sarcopenic mouse model, and investigated the underlying mechanisms.
MATERIALS AND METHODS
Preparation of YW and YE
Yuja peels sourced from Goheung, Korea, were collected, dried, and pulverized. A total of 100 g yuja peel powder was mixed with either distilled water or 70% ethanol and was subjected to extraction at 80°C. The resulting extracts were filtered using Whatman No. 2 filter paper (Whatman, Maidstone, UK) for 3 h, concentrated under reduced pressure, and subsequently freeze-dried. The extraction yields of the YW and YE were 13.24% and 31.33%, respectively. The hesperidin content of YW and YE was determined to be 881.97 mg/100 g and 997.92 mg/100 g, respectively, while the naringin content was 330.59 mg/100 g and 359.23 mg/100 g, respectively [16]. These compounds were identified as the major constituents of yuja.
Differentiation of C2C12 cells and cell viability analysis
C2C12 myoblasts (CRL-1772), derived from murine skeletal muscle, were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s Modified Eagle Medium (Welgene, Gyeongsan, Korea) supplemented with 10% fetal bovine serum (Welgene) and 1% penicillin-streptomycin (P/S; Cytiva, Marlborough, MA, USA) under the controlled condition of 5% CO2 at 37°C. For differentiation, once the myoblasts reached full confluence, the medium was replaced with a differentiation medium containing 2% horse serum (Gibco, Gaithersburg, MD, USA) and 1% P/S. The medium was refreshed every other day, and the cells were cultured for 6–8 days to ensure differentiation into myotubes.
Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [17]. The C2C12 myoblasts were seeded onto a 96-well plate at a density of 1 × 104 cells per well and incubated at 37°C for 24 h. Following incubation, the cells were treated with YW or YE at concentrations of 50, 100, and 200 µg/mL. Similarly, differentiated myotube cells were exposed to the same concentration of YW or YE, followed by the addition of 100 µM DEX (Sigma-Aldrich, St. Louis, MO, USA) after 1 h, then incubated for an additional 24 h at 37°C. The control group received DEX alone, while the vehicle group received no treatment.
For the MTT assay, 50 µL of MTT (2.5 mg/mL) solution was added to each well, and the cells were incubated at 37°C for 4 h. After the incubation, the supernatant was carefully removed, and the formazan crystals were dissolved in 200 µL of dimethyl sulfoxide (Sigma-Aldrich). Absorbance was measured at 595 nm using a microplate reader (Molecular Devices, San Jose, CA, USA).
Measurement of myotube diameter
To assess the impact of YW and YE on DEX-induced atrophy of C2C12 myotubes, the C2C12 cells were seeded onto a 96-well plate at a density of 2 × 105 cells per well. Once differentiated, the cells were treated with varying concentrations of YW or YE at 50, 100, and 200 µg/mL for 1 h. Following this, 100 µM DEX was introduced into the culture medium, and the cells were incubated for an additional 24 h. After incubation, the myotubes were examined using an optical microscope (CKX53; OLYMPUS, Tokyo, Japan). The diameters of the myotubes were measured with the ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Puromycin labeling for assessing protein synthesis
The C2C12 myotubes were exposed to 200 µg/mL YW for 1 h, followed by 24 h of exposure to 100 µM DEX. Thirty min before harvesting, the cells were treated with 1 µM puromycin (Sigma-Aldrich) to label synthesized proteins. After protein extraction, the samples were analyzed using Western blot analysis.
Phosphatidylinositol 3-kinase (PI3K) inhibitor treatment of C2C12 cells
To investigate the role of YW on the PI3K-protein kinase B (Akt) signaling pathway, the C2C12 myotubes were treated with 200 µg/mL YW for 1 h. Following this, the cells were exposed to 50 nM wortmannin (PI3K inhibitor; Sigma-Aldrich) with or without 100 µM DEX for 24 h.
DEX-induced muscle atrophy mouse model and YW treatment
Male C57BL/6N mice, aged 8 weeks, were obtained from Orient Bio Co., Ltd. (Seongnam, Korea) and housed in an environment with a 12-h light/dark cycle, temperature maintained at 21 ± 2°C, and humidity levels at 50 ± 5%. Following a 4-day acclimatization period, the mice were randomly assigned to 3 experimental groups, with 8 mice per group: the normal control group (NC), the DEX-treated group (DEX), and the group receiving both DEX and 200 mg/kg/day of YW (YW200). In the YW200 group, YW was administered orally once per day for a period of 2 weeks, with daily intraperitoneal injections of 10 mg/kg DEX to induce muscle atrophy. Mice in the NC and DEX groups were given an equal volume of distilled water orally, instead of YW, while saline was injected intraperitoneally in the NC group instead of DEX. All the mice had free access to an AIN-93M diet (Harlan Teklad/Envigo, Madison, WI, USA) and water throughout the experiment. After 2 weeks, the animals were euthanized under CO2 anesthesia following a 12-h fasting period. The animal research protocol was approved by the Animal Ethics Committee of Sunchon National University (SCNU IACUC-2024-02).
Assessment of grip strength and serum markers of muscle tissue damage
Grip strength was measured using a grip strength meter (Jeungdo Bio & Plant, Seoul, Korea) over 2 consecutive days prior to the end of the experiment. Each mouse was positioned on the apparatus, ensuring that all 4 paws made contact. The tail was then gently pulled backward until the paws were released from the device. To ensure consistency, the same researcher performed all measurements. The grip strength test was repeated three times per day for each mouse.
Blood was collected from the inferior vena cava, centrifuged at 4°C and 890 ×g for 15 min (Hanil Scientific, Gimpo, Korea), and serum was obtained. Serum lactate dehydrogenase (LDH) and creatine phosphokinase (CPK) levels were quantified using a dry chemistry blood analyzer (Fuji Dry-Chem 3500i; Fujifilm, Tokyo, Japan).
Histological analysis of muscle tissue
The gastrocnemius muscle was fixed in 10% formalin and then subjected to sequential processes, including washing, dehydration, infiltration, and paraffin embedding. Thin sections, measuring 3 µm in thickness, were prepared and stained with hematoxylin and eosin (H&E). The cross-sectional area (CSA) of the individual muscle fibers was quantified using the Motic DSAssistant (Motic VM V1 Viewer 2.0; Motic, Kowloon, Hong Kong) software.
Real-time quantitative polymerase chain reaction (PCR)
The total RNA was isolated from the C2C12 myotube and the gastrocnemius muscle of the sarcopenic mouse model using TRIzol reagent (Invitrogen, Grand Island, NY, USA). Chloroform was then added, and then the mixture was incubated at room temperature for 10 min. Following incubation, centrifugation was performed at 16,810 ×g for 15 min at 4°C, and the upper aqueous phase was carefully collected. Equal volumes of isopropyl alcohol were added to precipitate RNA, with the solution incubated at room temperature for 10 min before undergoing a second centrifugation under identical conditions. The resulting RNA pellet was washed three times with 75% ethanol, air-dried, and resuspended in diethylpyrocarbonate-treated water (Bioneer, Daejeon, Korea).
For complementary DNA (cDNA) synthesis, 1 µg of extracted RNA was reverse transcribed using the SuperiorScript III cDNA Synthesis kit from Enzynomics Co., Ltd. (Daejeon, Korea) following the manufacturer’s protocol. The reaction conditions included incubating at 65°C for 5 min, 50°C for 50 min, and 85°C for 5 min. The quantification of messenger RNA (mRNA) expression was conducted using SYBR green PCR kits (Enzynomics Co., Ltd.) and a CFX Duet real-time PCR system (Bio-Rad Laboratories Inc., Hercules, CA, USA). The PCR amplification was carried out under the following conditions: initial denaturation at 95°C for 15 min, followed by 40 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control for normalization. The relative mRNA expression levels were calculated using the 2−ΔΔCt method [18]. The primer sequences used are provided in Table 1.
Table 1. Primer sequences used for real-time polymerase chain reaction.
| Gene | Full name | Forward/Reverse (5’–3’) |
|---|---|---|
| Atrogin-1 | Muscle-specific F-box protein | F: TCATGCAGAGGCTGAGTGAC |
| R: TCAAACGCTTGCGAATCTGC | ||
| MuRF-1 | Muscle RING-finger protein-1 | F: GTGTGAGGTGCCTACTTGCT |
| R: TCAGCACATCCACAAGGGTC | ||
| Myostatin | Growth differentiation factor 8 | F: TGCTGTAACCTTCCCAGGAC |
| R: TCAAGCCCAAAGTCTCTCCG | ||
| MyoD1 | Myogenic differentiation 1 | F: TACAGTGGCGACTCAGATGC |
| R: CACTGTAGTAGGCGGTGTCG | ||
| MyoG | Myogenin | F: CCCTACAGACGCCCACAATC |
| R: AGTTGGGCATGGTTTCGTCT | ||
| MHC | Myosin heavy chain | F: CTCTTCCCGCTTTGGTAAGTT |
| R: CAGGAGCATTTCGATTAGATC | ||
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | F: AAGGTCATCCCAGAGCTGAA |
| R: CTGCTTCACCACCTTCTTGC |
Western blot analysis
Cells and tissues samples were lysed in a buffer containing 50 mM hydroxyethyl piperazine ethane sulfonic acid, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 2 mM ethylenebis (oxyethylenenitrilo) tetraacetic acid, 50 mM sodium fluoride, 1% triton, 1 mM phenylmethylsulfonyl fluoride, 25 µL/mL leupeptin, 2 µL/mL aprotinin. The lysates were incubated for 40 min before centrifugation (Hanil Scientific) at 16,810 ×g for 20 min at 4°C and the supernatant was collected. Protein concentration was quantified using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). A total of 20–40 µg of protein was loaded onto a 10% sodium dodecyl sulfate-polyacrylamide gel and subsequently transferred onto nitrocellulose membranes (Cytiva). The membranes were blocked for 1 h at room temperature using Tris-buffered saline containing 5% skim milk (Difco, Detroit, MI, USA) or bovine serum albumin (BioShop Canada Inc., Burlington, Canada) with 0.05% Tween 20 (TBST). For protein detection, the membranes were incubated overnight at 4°C with primary antibodies against atrogin-1 (SC-166806, 1:1,000), muscle RING-finger protein-1 (MuRF-1, SC-398608, 1:1,000), growth differentiation factor 8 (myostatin, SC-134345, 1:1,000), myogenic differentiation 1 (MyoD1, SC-32758, 1:1,000), myogenin (MyoG, SC-12732, 1:1,000), myosin heavy chain (MHC, SC-376157, 1:1,000), and GAPDH (SC-32233, 1:10,000) sourced from Santa Cruz Biotechnology (Dallas, TX, USA), ubiquitin (#3936, 1:1,000), phosphorylated phosphatidylinositol 3-kinase (p-PI3K, #4228, 1:1,000), PI3K (#4249, 1:1,000), phosphorylated protein kinase B (p-Akt, #4058, 1:1,000), Akt (#9272, 1:1,000), phosphorylated forkhead box O3 alpha (p-FoxO3α, #9466, 1:1,000), FoxO3α (#2497, 1:1,000), phosphorylated mammalian target of rapamycin (p-mTOR, #2971, 1:1,000) and mTOR (#2972, 1:1,000) sourced from Cell Signaling Technology (Danvers, MA, USA). anti-puromycin (MABE343, 1:1,000) sourced from Sigma-Aldrich. After primary antibody incubation, the membrane was washed 3 times with TBST and then incubated with a horseradish peroxidase secondary antibody for 1 h at room temperature. Following 3 additional washes with TBST, protein bands were visualized using WestGlow MAX ECL Chemiluminescent Substrate (BioMax, Seoul, Korea) and detected with the DAVINCH Chemi Fluoro Imager (Davinch-K, Seoul, Korea).
Statistical analysis
Data analysis was conducted using the Statistical Package for the Social Sciences (SPSS) software, version 27.0 (IBM Corp., Armonk, NY, USA). Results are presented as the means ± SE. A one-way analysis of variance was performed to evaluate the differences among groups, followed by Tukey’s honestly significant difference test for post-hoc comparisons. Statistical significance was set at P < 0.05.
RESULTS
Comparison of the anti-muscle atrophy effect of YW and YE in DEX-treated C2C12 cells
YW and YE showed no cytotoxicity in both C2C12 myoblasts and myotubes at concentrations of 50, 100, and 200 µg/mL. Likewise, 100 µM DEX exhibited no toxicity on myotubes (Fig. 1A). YW dose-dependently increased the thickness and length of myotubes compared to the DEX-alone treated control group, while YE showed improvement only at 200 µg/mL (Fig. 1B). Thus, YW increased the diameter of the myotube of DEX-induced muscle atrophy cells more effectively than YE at all concentrations (Fig. 1B).
Fig. 1. Effects of YW and YE on cell viability (A) and myotube diameters (B) in muscle atrophy cells. The values of three independent experiments are presented as mean ± SE. Results are shown in percentages compared to the untreated vehicle group. The diameters of 90 myotubes from eight different locations in each cell were measured using the ImageJ software. Images were captured at 200× magnification.
YW, yuja peel hot water extract; YE, yuja peel ethanol extract; DEX, dexamethasone.
a-dValues not sharing common letters are significantly different among groups at P < 0.05.
In the cell with the DEX-induced muscle atrophy, the expression of the atrogin-1 gene and its protein increased by 3.8- and 2.2-fold, respectively, compared to the cells in the vehicle group (Fig. 2A). Similarly, the expression of the MuRF-1 gene and its protein were elevated by 2.1- and 1.7-fold respectively, in DEX group compared to the cells in the vehicle group (Fig. 2B). In contrast, the YW treatment significantly reduced atrogin-1 and MuRF-1 gene expression at 200 µg/mL and significantly decreased their protein levels at both 100 and 200 µg/mL compared to the DEX-alone treated control group (Fig. 2). Treatment with YE reduced the expression of both genes and proteins, but the changes were not statistically significant (Fig. 2). Thus, YW demonstrated greater efficacy than YE in suppressing DEX-induced muscle atrophy by significantly downregulating the gene and protein expression of atrogin-1 and MuRF-1.
Fig. 2. Effects of YW and YE on expression of atrogin-1 (A) and MuRF-1 (B) in muscle atrophy cells. The values of 3 independent experiments are presented as mean ± SE. The gene and protein expressions were calculated as the fold-change relative to the vehicle group.
YW, yuja peel hot water extract; YE, yuja peel ethanol extract; atrogin-1, muscle-specific F-box protein; MuRF-1, muscle RING-finger protein-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; AU, arbitrary units; DEX, dexamethasone.
a-cValues not sharing common letters are significantly different among groups at P < 0.05.
YW enhanced muscle strength and fiber area in sarcopenic mice
Grip strength, a critical indicator of muscle function, was markedly reduced in the DEX group compared to the NC group. However, the grip strength was 16.27% higher in the YW200 group compared to the DEX group (Table 2).
Table 2. Effects of YW on grip strength, body weight, food intake, relative muscle weights, and serum muscle damage biomarkers in a mouse model with dexamethasone-induced muscle atrophy.
| Variables | NC group | DEX group | YW200 group | |
|---|---|---|---|---|
| Grip strength (gf/g BW) | 9.62 ± 0.15b | 8.46 ± 0.23a | 9.83 ± 0.17b | |
| Body weight (g) | 22.61 ± 0.30 | 21.31 ± 0.48 | 21.50 ± 0.35 | |
| Food intake (g/day) | 3.21 ± 0.03a | 3.39 ± 0.05b | 3.22 ± 0.44a | |
| Muscle weight (mg/g BW) | ||||
| Soleus | 0.83 ± 0.05 | 0.77 ± 0.04 | 0.78 ± 0.02 | |
| Gastrocnemius | 12.59 ± 0.29b | 10.26 ± 0.32a | 10.41 ± 0.16a | |
| Quadriceps | 14.02 ± 0.60b | 10.86 ± 0.48a | 11.00 ± 0.26a | |
| Serum muscle damge marker | ||||
| LDH (U/L) | 291.71 ± 42.42a | 492.00 ± 68.31b | 268.25 ± 15.63a | |
| CPK (U/L) | 87.14 ± 15.39a | 178.44 ± 19.62b | 111.88 ± 9.30a | |
The results are presented as mean ± SE.
YW, yuja peel hot water extract; NC, normal control group; DEX, dexamethasone-treated group; YW200, dexamethasone and YW (200 mg/kg/day)-treated group; BW, body weight; LDH, lactate dehydrogenase; CPK, creatine phosphokinase.
a,bValues not sharing common letters are significantly different among groups at P < 0.05.
The spaces between the muscle fibers were notably wider in the DEX group compared to the NC group. In contrast, the interstitial spacing was significantly lower in the YW200 group compared to the DEX group indicating the protective effects of YW against muscle atrophy (Fig. 3A).
Fig. 3. Effects of YW on histology and CSA. (A) Histology, (B) muscle fiber size analysis, and (C) CSA of the gastrocnemius muscle. The results are presented as mean ± SE. A representative cross-section of gastrocnemius muscle stained with H&E (magnification 200×, scale bar = 60 µm). The distribution of 50 myofibers size in gastrocnemius muscle was measured using the MoticVM V1 program.
YW, yuja peel hot water extract; CSA, cross-sectional area; H&E, hematoxylin and eosin; NC, normal control group; DEX, dexamethasone-treated group; YW200, dexamethasone and YW (200 mg/kg/day)-treated group.
a-cValues not sharing common letters are significantly different among groups at P < 0.05.
The CSA of the gastrocnemius was significantly lower in the DEX group compared to the NC group. Supplementation with YW resulted in a significant increase of 31.32% compared to the DEX group (Fig. 3C). An analysis of the distribution of CSA of the muscle fiber in the gastrocnemius revealed that 92% of the fibers were smaller than 2,000 µm2, and 8% were larger than 3,000 µm2 in the DEX group. In contrast, in the YW200 group, 70.67% of the fibers were smaller than 2,000 µm2, and 29.3% were larger than 3,000 µm2 (Fig. 3B). Thus, YW effectively alleviated the reduction in the CSA of the gastrocnemius muscle fibers, demonstrating its protective effect against sarcopenia.
The relative weights of the gastrocnemius and quadriceps muscles were significantly reduced in the DEX group when compared with the NC group. However, YW did not produce a noticeable effect on muscle weight (Table 2). Body weight did not differ among groups, while food intake was significantly higher in the DEX than in the NC or YW200 groups (Table 2). The serum LDH level was notably higher in the DEX group compared to the NC group, but this was significantly lower in the YW200 group (Table 2). Additionally, the serum CPK levels in the YW200 group were considerably lower than those in the DEX group (Table 2). These findings suggest that YW supplementation effectively reduced the biomarkers of muscle damage, even though it did not significantly affect muscle weight.
YW suppressed protein degradation and promoted protein synthesis in the muscle tissue of sarcopenic mice
In the DEX group, there was a marked increase in the expression of the genes and proteins associated with muscle degradation, including atrogin-1, MuRF-1, myostatin, and ubiquitin, compared to the NC group. However, YW treatment resulted in a reduction in the expression of these genes and proteins, bringing their levels closer to those observed in the NC group (Fig. 4). This suggests that YW effectively reduced protein degradation in mice with DEX-induced muscle atrophy.
Fig. 4. Effects of YW on muscle protein degradation related gene and protein expression. (A) Atrogin-1, (B) MuRF-1, (C) myostatin, and (D) ubiquitin. The results are presented as mean ± SE. The gene and protein expression were calculated as the fold-change relative to the NC group.
YW, yuja peel hot water extract; atrogin-1, muscle-specific F-box protein; MuRF-1, muscle RING-finger protein-1; myostatin, growth differentiation factor 8; NC, normal control group; DEX, dexamethasone-treated group; YW200, dexamethasone and YW (200 mg/kg/day)-treated group; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; AU, arbitrary units.
a,bValues not sharing common letters are significantly different among the groups at P < 0.05.
Moreover, the expression of MyoD1, MyoG, and MHC genes and proteins was significantly decreased in the DEX group. However, the YW treatment enhanced the expression of these myogenic markers, reaching levels comparable to those observed in the NC group (Fig. 5). The puromycin labeling assay in C2C12 myotubes further confirmed that YW treatment significantly enhanced the synthesis of these muscle-related proteins compared to the DEX group. These results indicate that YW promotes protein synthesis in of DEX-induced muscle atrophy (Fig. 5).
Fig. 5. Effects of YW on muscle protein synthesis related gene and protein expression. (A) MyoD1, (B) MyoG, (C) MHC gene and protein expression of gastrocnemius muscle in mice with dexamethasone-induced muscle atrophy, and (D) puromycin protein expression in dexamethasone-treated C2C12 cells. The results are presented as mean ± SE. The gene and protein expression were calculated as the fold-change relative to the NC group.
YW, yuja peel hot water extract; MyoD1, myogenic differentiation 1; MyoG, myogenin; MHC, myosin heavy chain; NC, normal control group; DEX, dexamethasone-treated group; YW200, dexamethasone and YW (200 mg/kg/day)-treated group; mRNA, messenger RNA; AU, arbitrary units; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
a,bValues not sharing common letters are significantly different among the groups at P < 0.05.
YW downregulated FoxO3α and upregulated mTOR via modulation of the PI3K-Akt signaling pathway in sarcopenic mice
To explore the underlying mechanism by which YW alleviates muscle atrophy, we examined the PI3K/Akt signaling pathway in the gastrocnemius muscle of the sarcopenic mouse model. Treatment with DEX significantly reduced the phosphorylation of PI3K and Akt. However, the phosphorylation levels of both PI3K and Akt after treatment with YW were comparable to the NC group (Fig. 6). Furthermore, in the in vitro study, YW significantly increased the levels of phosphorylated PI3K and Akt in wortmannin-treated C2C12 myotubes, both in the presence and absence of DEX (Fig. 6). These findings suggest that YW exerts protective effects against DEX-induced muscle atrophy by activating the PI3K-Akt signaling pathway.
Fig. 6. Effects of YW on PI3K-Akt-FoxO3α/mTOR signaling pathway. (A) Protein expression of gastrocnemius muscle in mice with dexamethasone-induced muscle atrophy and (B) PI3K-Akt protein expression in wortmannin-treated C2C12 cells with or without dexamethasone. The results are presented as mean ± SE. The protein expression was calculated as the fold-change relative to the NC group or vehicle group.
YW, yuja peel hot water extract; PI3K, phosphatidylinositol 3-kinase; Akt, protein kinase B; FoxO3α, forkhead box O3 alpha; mTOR, mammalian target of rapamycin; NC, normal control group; DEX, dexamethasone-treated group; YW200, dexamethasone and YW (200 mg/kg/day)-treated group; p-PI3K, phosphorylated phosphatidylinositol 3-kinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; p-Akt, phosphorylated protein kinase B; p-FoxO3α, phosphorylated forkhead box O3 alpha; p-mTOR, phosphorylated mammalian target of rapamycin; Wor, wortmannin; AU, arbitrary units.
a-cValues not sharing common letters are significantly different among the groups at P < 0.05.
Furthermore, DEX-induced muscle atrophy led to a significant decrease in the phosphorylation of FoxO3α and mTOR, whereas YW significantly increased their phosphorylation levels (Fig. 6). These findings suggest that YW exerts protective effects against DEX-induced muscle atrophy by activating the PI3K-Akt signaling pathway, promoting FoxO3α phosphorylation to suppress protein degradation, and by enhancing mTOR phosphorylation to stimulate protein synthesis.
DISCUSSION
This study demonstrated that YW (200 µg/mL) significantly increased the number and diameter of myotubes while reducing the protein markers associated with muscle atrophy, such as atrogin-1 and MuRF-1, in DEX-treated C2C12 cells compared to YE. Various dietary factors, including low protein intake, insufficient energy consumption, and a ketogenic diet, may contribute to muscle loss by impairing muscle protein synthesis [19,20]. Vitamin C deficiency can lead to muscle atrophy in mice by increasing the expression of atrogin-1 and MuRF-1 while promoting excessive production of reactive oxygen species [21]. Additionally, dietary supplementation with vitamin C has been found to help mitigate age-related muscle loss in middle-aged and older adults [22]. Vitamin C, which is more abundant in the water-soluble extract than in the fat-soluble extract, is a potent antioxidant that reduces cellular damage and inflammation, thereby promoting muscle recovery [23]. In this study, the vitamin C content in YW (80.6 ± 0.85 mg/100 g) was found to be 44.44% higher than in YE (55.8 ± 1.00 mg/100 g) (unpublished data). Thus, in our study, despite containing slightly lower levels of antioxidant compounds such as hesperidin and naringin compared to YE (997.92 mg/100 g and 359.23 mg/100 g, respectively), YW (881.97 mg/100 g and 330.59 mg/100 g, respectively) demonstrated superior efficacy in alleviating DEX-induced muscle atrophy. Additionally, inhibition of elastase helps preserve elastin, a key component of muscle connective tissue, thereby supporting the recovery of damaged muscle [24]. In our earlier study, YW, at a concentration of 200 µg/mL, exhibited a 2.1-fold greater elastase inhibition than YE (YW, 27.77 ± 0.09% and YE, 13.09 ± 0.37%).
YW (200 mg/kg/day) was orally administered to mice with DEX (10 mg/kg/day)-induced muscle atrophy to confirm its anti-sarcopenic effect. This study showed that YW upregulated the levels of phosphorylated PI3K and Akt compared to the DEX group. PI3K is phosphorylated by growth factors and insulin, which promotes the phosphorylation of Akt. Activated Akt then phosphorylates and inactivates FoxO3α proteins [25]. Inactivated FoxO suppresses the expression of proteins such as atrogin-1 and MuRF-1, which reduces muscle protein degradation and helps prevent muscle loss [26]. This is similar to the results of a study in which the PI3K-Akt pathway was activated to improve the expression of atrogin-1 and MuRF-1 in C57BL/6 mice treated with Citri unshius pericarpium extract (100 and 200 mg/kg) and DEX (20 mg/kg) for 10 days [27]. Additionally, the significant reduction in ubiquitin protein expression in the YW200 group compared to the DEX group confirms YW’s inhibitory effects on protein degradation.
Furthermore, activated PI3K-Akt activates mTOR, promoting the expression of MyoD1 and MyoG, which are involved in muscle protein synthesis, thereby stimulating muscle cell formation and growth [28]. The increased synthesis of MyoD1 and MyoG promotes muscle growth and recovery [29], while MHC enhances the structural stability and strength of the muscles [30]. In contrast, DEX, as a glucocorticoid drug, inhibits the PI3K-Akt pathway, leading to muscle atrophy [31], and reduces mTOR activity, thereby inhibiting muscle protein synthesis [32,33]. In this study, the protein expression of mTOR was significantly reduced in mice with DEX-induced muscle atrophy compared to the NC group. However, mTOR activation, along with a significant increase in MyoD1 and MyoG protein expression, was observed in the YW200 group compared to the DEX group. Additionally, the expression of MHC, a protein involved in muscle contraction and a major component of muscle filaments [34], was significantly decreased in the mouse model with DEX-induced muscle atrophy compared to the NC group. However, it was upregulated to normal levels in the YW200 group. The effect of YW on protein synthesis was confirmed through puromycin labeling analysis in vitro, which showed that the expression of puromycin protein was significantly higher in the YW (200 µg/mL)-treated group compared to C2C12 cells treated with DEX. Thus, YW promoted protein synthesis in atrophied muscle tissues. To confirm whether treatment with YW prevented muscle loss through PI3K-Akt pathway, differentiated C2C12 myotubes with or without DEX were treated with wortmannin, a PI3K inhibitor. The wortmannin-treated group showed decreased PI3K and Akt protein expression compared to the NC group. However, in the YW-treated group, the phosphorylation of PI3K-Akt, which was inhibited by wortmannin, was restored to normal levels. This suggests that YW directly upregulates the PI3K-Akt pathway to improve muscle atrophy. Thus, YW stimulated protein synthesis and inhibited protein breakdown in atrophied muscle, contributing to an increase in grip strength and CSA. Suebthawinkul et al. [35] reported that an increase in muscle CSA is associated with an improvement in grip strength. However, YW did not significantly affect muscle weight. Previous studies have shown that some markers of muscle atrophy, including grip strength, can change independently of muscle weight [36,37].
In this study, the serum levels of LDH and the CPK were higher in the DEX-induced muscle atrophy group than in the NC group, confirming DEX-induced muscle damage. However, YW significantly reduced the activity of these enzymes compared to the DEX group, demonstrating its effectiveness in alleviating muscle damage.
In conclusion, YW inhibited muscle protein degradation by regulating the PI3K-Akt-FoxO3α pathway and suppressing the expression of atrogin-1 and MuRF-1. In contrast, it improved muscle function, such as muscle fiber area and grip strength, in mice with muscle atrophy by activating the PI3K-Akt-mTOR pathway and promoting the synthesis of muscle proteins, such as MHC, MyoG, and MyoD1. These results suggest that YW could be used as a potential agent for the prevention and amelioration of muscle atrophy.
Footnotes
Conflict of Interest: The authors declare no potential conflicts of interests.
- Conceptualization: Lee MK, Lee HI.
- Data curation: Kim SH, Choi SY.
- Formal analysis: Kim SH, Choi SY.
- Resources: Lee MK.
- Supervision: Lee MK.
- Writing - original draft: Kim SH, Lee MK.
- Writing - review & editing: Lee MK.
References
- 1.Narici MV, Maffulli N. Sarcopenia: characteristics, mechanisms and functional significance. Br Med Bull. 2010;95:139–159. doi: 10.1093/bmb/ldq008. [DOI] [PubMed] [Google Scholar]
- 2.Marcell TJ. Sarcopenia: causes, consequences, and preventions. J Gerontol A Biol Sci Med Sci. 2003;58:M911–M916. doi: 10.1093/gerona/58.10.m911. [DOI] [PubMed] [Google Scholar]
- 3.Lexell J. Human aging, muscle mass, and fiber type composition. J Gerontol A Biol Sci Med Sci. 1995;50:11–16. doi: 10.1093/gerona/50a.special_issue.11. [DOI] [PubMed] [Google Scholar]
- 4.Metter EJ, Conwit R, Tobin J, Fozard JL. Age-associated loss of power and strength in the upper extremities in women and men. J Gerontol A Biol Sci Med Sci. 1997;52:B267–B276. doi: 10.1093/gerona/52a.5.b267. [DOI] [PubMed] [Google Scholar]
- 5.Padilla Colón CJ, Molina-Vicenty IL, Frontera-Rodríguez M, García-Ferré A, Rivera BP, Cintrón-Vélez G, Frontera-Rodríguez S. Muscle and bone mass loss in the elderly population: advances in diagnosis and treatment. J Biomed (Syd) 2018;3:40–49. doi: 10.7150/jbm.23390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lee DC, Shook RP, Drenowatz C, Blair SN. Physical activity and sarcopenic obesity: definition, assessment, prevalence and mechanism. Future Sci OA. 2016;2:FSO127. doi: 10.4155/fsoa-2016-0028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cruz-Jentoft AJ, Bahat G, Bauer J, Boirie Y, Bruyère O, Cederholm T, Cooper C, Landi F, Rolland Y, Sayer AA, et al. Sarcopenia: revised European consensus on definition and diagnosis. Age Ageing. 2019;48:16–31. doi: 10.1093/ageing/afy169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Shim D, Kim HJ, Lee J, Lee YM, Park JW, Yang S, Lee GH, Chung MJ, Chae HJ. Citrus junos tanaka peel extract ameliorates HDM-induced lung inflammation and immune responses in vivo . Nutrients. 2022;14:5024. doi: 10.3390/nu14235024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hirota R, Roger NN, Nakamura H, Song HS, Sawamura M, Suganuma N. Anti-inflammatory effects of limonene from yuzu (Citrus junos Tanaka) essential oil on eosinophils. J Food Sci. 2010;75:H87–H92. doi: 10.1111/j.1750-3841.2010.01541.x. [DOI] [PubMed] [Google Scholar]
- 10.Yoo KM, Lee KW, Park JB, Lee HJ, Hwang IK. Variation in major antioxidants and total antioxidant activity of yuzu (Citrus junos Sieb ex Tanaka) during maturation and between cultivars. J Agric Food Chem. 2004;52:5907–5913. doi: 10.1021/jf0498158. [DOI] [PubMed] [Google Scholar]
- 11.Kang SK, Jang MJ, Kim YD. A study on the flavor constituents of the citron (Citrus junos) Korean J Food Preserv. 2006;13:204–210. [Google Scholar]
- 12.Kim SH, Shin EJ, Hur HJ, Park JH, Sung MJ, Kwon DY, Hwang JT. Citrus junos Tanaka peel extract attenuates experimental colitis and inhibits tumour growth in a mouse xenograft model. J Funct Foods. 2014;8:301–308. [Google Scholar]
- 13.Kim SH, Hur HJ, Yang HJ, Kim HJ, Kim MJ, Park JH, Sung MJ, Kim MS, Kwon DY, Hwang JT. Citrus junos Tanaka peel extract exerts antidiabetic effects via AMPK and PPAR-γ both in vitro and in vivo in mice fed a high-fat diet. Evid Based Complement Alternat Med. 2013;2013:921012. doi: 10.1155/2013/921012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Heo YJ, Lee MK, Im JH, Kim BS, Lee HI. Anti-obesity effects of ethanol extract of green Citrus junos peel enriched in naringin and hesperidin in vitro and in vivo . Nutr Res Pract. 2025;19:1–13. doi: 10.4162/nrp.2025.19.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kim S, Choi SY, Lee HI, Lee MK. Protective responses of green yuja peel extracts to lipopolysaccharide-induced inflammation and reactive oxygen species production in RAW264.7 cells. Prev Nutr Food Sci. 2024;29:301–310. doi: 10.3746/pnf.2024.29.3.301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yun J. Comparison of antioxidant activity and anti-adipogenic effects of hot water and ethanol extracts from yuzu (Citrus junos Sieb.) peel based on harvest period [master’s thesis] Suncheon: Sunchon National University; 2023. [Google Scholar]
- 17.Tolosa L, Donato MT, Gómez-Lechón MJ. General cytotoxicity assessment by means of the MTT assay. Methods Mol Biol. 2015;1250:333–348. doi: 10.1007/978-1-4939-2074-7_26. [DOI] [PubMed] [Google Scholar]
- 18.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 19.Ersoy U, Kanakis I, Alameddine M, Pedraza-Vazquez G, Ozanne SE, Peffers MJ, Jackson MJ, Goljanek-Whysall K, Vasilaki A. Lifelong dietary protein restriction accelerates skeletal muscle loss and reduces muscle fibre size by impairing proteostasis and mitochondrial homeostasis. Redox Biol. 2024;69:102980. doi: 10.1016/j.redox.2023.102980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nakao R, Abe T, Yamamoto S, Oishi K. Ketogenic diet induces skeletal muscle atrophy via reducing muscle protein synthesis and possibly activating proteolysis in mice. Sci Rep. 2019;9:19652. doi: 10.1038/s41598-019-56166-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang Y, Liu Q, Quan H, Kang SG, Huang K, Tong T. Nutraceuticals in the prevention and treatment of the muscle atrophy. Nutrients. 2021;13:1914. doi: 10.3390/nu13061914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lewis LN, Hayhoe RPG, Mulligan AA, Luben RN, Khaw KT, Welch AA. Lower dietary and circulating vitamin C in middle- and older-aged men and women are associated with lower estimated skeletal muscle mass. J Nutr. 2020;150:2789–2798. doi: 10.1093/jn/nxaa221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bryer SC, Goldfarb AH. Effect of high dose vitamin C supplementation on muscle soreness, damage, function, and oxidative stress to eccentric exercise. Int J Sport Nutr Exerc Metab. 2006;16:270–280. doi: 10.1123/ijsnem.16.3.270. [DOI] [PubMed] [Google Scholar]
- 24.Arecco N, Clarke CJ, Jones FK, Simpson DM, Mason D, Beynon RJ, Pisconti A. Elastase levels and activity are increased in dystrophic muscle and impair myoblast cell survival, proliferation and differentiation. Sci Rep. 2016;6:24708. doi: 10.1038/srep24708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang X, Tang N, Hadden TJ, Rishi AK. Akt, FoxO and regulation of apoptosis. Biochim Biophys Acta. 2011;1813:1978–1986. doi: 10.1016/j.bbamcr.2011.03.010. [DOI] [PubMed] [Google Scholar]
- 26.Sanchez AMJ, Candau RB, Bernardi H. FoxO transcription factors: their roles in the maintenance of skeletal muscle homeostasis. Cell Mol Life Sci. 2014;71:1657–1671. doi: 10.1007/s00018-013-1513-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Seo SW, Im SC, Kim K. Citri unshius pericarpium improves dexamethasone-induced muscle atrophy in mice. Pharmacogn Mag. 2022;18:851–858. [Google Scholar]
- 28.Wei X, Luo L, Chen J. Roles of mTOR signaling in tissue regeneration. Cells. 2019;8:1075. doi: 10.3390/cells8091075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Berkes CA, Tapscott SJ. MyoD and the transcriptional control of myogenesis. Semin Cell Dev Biol. 2005;16:585–595. doi: 10.1016/j.semcdb.2005.07.006. [DOI] [PubMed] [Google Scholar]
- 30.Schiaffino S, Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev. 1996;76:371–423. doi: 10.1152/physrev.1996.76.2.371. [DOI] [PubMed] [Google Scholar]
- 31.Schakman O, Gilson H, Thissen JP. Mechanisms of glucocorticoid-induced myopathy. J Endocrinol. 2008;197:1–10. doi: 10.1677/JOE-07-0606. [DOI] [PubMed] [Google Scholar]
- 32.Wang XJ, Yang X, Wang RX, Jiao HC, Zhao JPJ, Song ZG, Lin H. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways. Biosci Rep. 2016;36:e00346. doi: 10.1042/BSR20160096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kwon D, Kim C, Woo YK, Hwang JK. Inhibitory effects of chrysanthemum (chrysanthemum morifolium Ramat.) extract and its active compound isochlorogenic acid a on sarcopenia. Prev Nutr Food Sci. 2021;26:408–416. doi: 10.3746/pnf.2021.26.4.408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Irving M. Regulation of contraction by the thick filaments in skeletal muscle. Biophys J. 2017;113:2579–2594. doi: 10.1016/j.bpj.2017.09.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Suebthawinkul C, Panyakhamlerd K, Yotnuengnit P, Suwan A, Chaiyasit N, Taechakraichana N. The effect of vitamin D2 supplementation on muscle strength in early postmenopausal women: a randomized, double-blind, placebo-controlled trial. Climacteric. 2018;21:491–497. doi: 10.1080/13697137.2018.1480600. [DOI] [PubMed] [Google Scholar]
- 36.Wilson JM, Lowery RP, Joy JM, Walters JA, Baier SM, Fuller JC, Jr, Stout JR, Norton LE, Sikorski EM, Wilson SM, et al. β-Hydroxy-β-methylbutyrate free acid reduces markers of exercise-induced muscle damage and improves recovery in resistance-trained men. Br J Nutr. 2013;110:538–544. doi: 10.1017/S0007114512005387. [DOI] [PubMed] [Google Scholar]
- 37.Yamamoto D, Maki T, Herningtyas EH, Ikeshita N, Shibahara H, Sugiyama Y, Nakanishi S, Iida K, Iguchi G, Takahashi Y, et al. Branched-chain amino acids protect against dexamethasone-induced soleus muscle atrophy in rats. Muscle Nerve. 2010;41:819–827. doi: 10.1002/mus.21621. [DOI] [PubMed] [Google Scholar]