Applicability of a Real-Time Quantitative PCR Assay for Diagnosis of Respiratory Syncytial Virus Infection in Immunocompromised Adults

Volume 41, no. 9, p. 4378-4381, 2003. Page 4379, Table 1: The sequence of the RSA-2 primer should read “5′ TTCTGCACATCATAATTAGGAGTATCAAT,” and its nucleotide position should read “1220”; the sequence of the RSB-2 primer should read “5′ TGATATCCAGCATCTTTAAGTATCTTTATAGTG,” and its nucleotide position should read “1350”; and the sequence of the RSB probe should read “5′ TTCCCTTCCTAACCTGGACATAGCATATAACATACCT,” and its nucleotide position should read “1315.”