Skip to main content
NCBI home page
Veterinární Medicína logoLink to Veterinární Medicína
. 2025 Jul 3;70(7):261–271. doi: 10.17221/18/2025-VETMED

Toxicity of oxalic acid and its toxic effect on antioxidative enzymes in honey bee larvae

Tomas Majchrak 1, Marek Ratvaj 2,*, Lucia Sabova 3, Juraj Toporcak 1, Ladislav Molnar 1
PMCID: PMC12342124  PMID: 40809947

Abstract

The production of food of plant origin is critically dependent on the pollination ability of honey bees, whose health has been deteriorating for a long time, and whose population is declining. In our in vivo experiment on a honey bee brood at the 4-day larval stage, we tested the following concentrations of oxalic acid: 0% (control – applied distilled water), 0.87%, 1.75%, 3.5% and 7%, corresponding to doses of 0 mg, 2.61 mg, 5.25 mg, 10.5 mg, and 21 mg of oxalic acid per dm2 of honeycomb with the brood. The LC50 values (72 h) ranged between 3.17% and 3.33%. The different LC50 values obtained resulted from three different methods used to calculate this indicator. The therapeutic index (TI) of oxalic acid was set to be 1.1, indicating a high risk to the honey bee brood. We observed an increased gene expression for the detoxifying enzyme glutathione-S-transferase (GST), but did not detect an increased gene expression for superoxide dismutase (SOD1 and SOD2), which protects the organism from oxidative stress. A decrease in gene expression was observed for prophenoloxidase and hymenoptaecin, while defensin and lysozyme did not show significant changes. These results emphasise the need for the accurate dosage and application of oxalic acid in the treatment of varroosis.

Keywords: Apis mellifera, detoxifying enzymes, gene expression, oxalic acid, toxicity, Varroa destructor

The production of food of plant origin is directly dependent on pollinators, and their ability to pollinate effectively depends on their abundance and health. However, pollinators are exposed to a wide range of negative factors, including those of anthropogenic origin, such as environmental modifications, air pollutants, plant protection products, veterinary products, as well as substances of natural origin such as mycotoxins and phytotoxins (Smith et al. 2015).

Among the dominant pollinators of plants are honey bees (Apis mellifera). Beekeeping worldwide shows a long-term declining trend, which can be attributed to the high honey bee morbidity due to parasitic, bacterial, and viral diseases and environmental pollution. Quantifying the relative impact of different chemicals on honey bee health compared to other stressors, such as varroosis, bacterial infections, viruses, and nutrition, was identified as a priority to support the development of comprehensive risk assessment methods (Carnesecchi et al. 2019).

Varroa destructor is currently the most important parasite of the honey bee and the main cause of colony mortality. The increasing resistance of this parasite to traditional treatments highlights the need for intensive research on new methods to combat varroosis (Bahreini et al. 2020).

Medications used to treat varroosis are divided into four main groups. The first group consists of synthetic pyrethroids, such as flumethrin and tau-fluvalinate. The second group consists of essential oils, the third of organic acids, and the fourth of amitraz, a non-systemic acaricide and insecticide. Each of these groups has specific properties and mechanisms of action (Toporcak et al. 2020).

An essential requirement for the registration and use of drugs is the determination of their toxicity to the target organism (parasite) as well as their toxicity to the treated individual, in this case, the honey bee and its brood. Prospective drugs for the treatment of varroosis include low-molecular-weight organic acids such as formic acid, oxalic acid, and lactic acid (Girisgin and Aydin 2010).

In toxicity tests, monitoring changes in the superoxide dismutase (SOD) activity is essential when assessing the cellular damage in the test organism. SOD is an extremely valuable antioxidant that helps protect cells from destruction. The substrate of SOD is the superoxide radical anion (O2–), which is formed by the transfer of one electron to molecular oxygen. This radical is responsible for direct damage to biological macromolecules and the formation of other reactive oxygen species. SOD maintains the concentration of superoxide radicals at a low level, thus playing a key role in defence against oxidative stress (Fridovich 1997).

Glutathione-transferases are known to protect against oxidative stress. Primary antioxidant enzymes play a largely preventive role, degrading reactive oxygen species (ROS) and thereby preventing damage to cellular components, while also initiating lipid peroxidation. In the case of ROS-induced lipid peroxidation, secondary defence enzymes are involved in the removal of lipid hydroperoxides (LOOH), thereby terminating the autocatalytic chain of lipid peroxidation and protecting cell membranes.

Glutathione peroxidase (GPx) and glutathione-S-transferase (GST), which catalyse the glutathione-dependent reduction of LOOH through their peroxidase activity, are the major secondary defence against ROS-induced lipid peroxidation. Glutathione reductase plays an important role in cellular antioxidant protection. This enzyme catalyses the regeneration of GSH, a substrate for GPx (Alghazal et al. 2008).

The enzymes present in honey bees in the form of superoxide dismutases (SOD1, SOD2), catalase (CAT), and glutathione-S-transferase (GST) protect the honey bee organism from free radicals (Corona and Robinson 2006). The production of free radicals is a physiological process, but their overproduction can occur due to external factors, such as pesticides (He et al. 2021), electromagnetic radiation (Migdal et al. 2021), or seasonal changes (Orcic et al. 2017).

Dismutases act in the first step of defence against free radicals and convert the superoxide radical into oxygen and hydrogen peroxide. SOD1 acts in the cytoplasm, while SOD2 acts in the mitochondria. CAT acts in the second step, breaking down hydrogen peroxide into water and oxygen. Hydrogen peroxide is also broken down by GST, which, however, has a detoxifying effect as well (Fukui and Zhu 2010).

The immune system of honey bees consists of humoral and cellular components, similar to those of mammals, but is much simpler. The humoral immune response is primarily mediated by antimicrobial peptides (Danihlik et al. 2015). Concentrations of lysozyme and hymenoptaecin, which belong to this group, are physiologically elevated in infected larvae (Chan et al. 2009).

Our experimental study aimed to determine the toxicity of oxalic acid to young honey bee larvae under in vivo conditions and to analyse changes in the relative expression of the genes responsible for detoxification and the immune response in honey bee larvae, including the immune response.

MATERIAL AND METHODS

Determination of the toxicity of oxalic acid in honey bee larvae

To test the toxicity of oxalic acid in honeybee larvae, we employed a modified methodology by Sabova et al. (2019). This involved the selection and rearing of suitable honey bee colonies and the subsequent selection of suitable larvae under in vivo conditions.

Currently registered veterinary drugs against varroosis based on oxalic acid recommend a therapeutic dose of 0.3 ml of a 3% solution per dm2 of honeycomb (EMA 2017; EMA 2018). In our in vivo experiment on the honey bee brood at the 4-day larval stage, we tested the following concentrations of oxalic acid (VWR BDH Prolabo® Chemicals, Leuven, Belgium): 0% (control – applied distilled water), 0.87%, 1.75%, 3.5% and 7%, corresponding to doses of 0 mg, 2.61 mg, 5.25 mg, 10.5 mg, and 21 mg of oxalic acid per dm2 of honeycomb with the brood. One dm2 of honeycomb contains an average of 100 cells, as shown in Figure 1. The number of larvae in the tested area of 1 dm2 differed in each case. The individual doses of oxalic acid per honeycomb cell are as follows: control, 26.1 μg, 52.5 μg, 105 μg, and 210 μg per cell in a spray form. The recommended dose of 0.3 ml per dm2 of brood comb was applied in this experiment.

Figure 1. Original application template (1 dm2, one hundred honey bee cells/larvae).

Figure 1

Open in a new tab

To ensure that the larvae in the experiment were four days old at the time of application, the queens needed to be confined in their colony in an exclusion cage containing an empty comb – Organisation for Economic Co-operation and Development 237 (OECD 2013). We followed the guidelines outlined in OECD 237 (OECD 2013). After synchronisation of the larvae, a plastic sheet for the hygiene test containing 100 cells of 5.4 mm was used. Three applications of the solution were made to three locations within one hive. The solution, preheated to 37.5 °C, was applied at a right angle (90°) from a distance of 25 cm from the honeycomb. The control larvae were sprayed with distilled water. The larval mortality was checked and recorded 72 h (3 days) after application. The mortality data are expressed as the number of dead larvae and as adjusted percentages, following the guidelines (OECD 2013; Sabova et al. 2019).

The following mathematical programs and methods were used to calculate toxicity: ToxRat Professional v3.3.0, Finney’s Probit Analysis, and the interpolation method of Roth et al. (1962).

Determination of the relative gene expression of the detoxifying enzymes

To determine the relative gene expression, the larvae were homogenised in two steps due to their high volume. First, the honey bee larvae were mechanically homogenised in a tube using a pestle. A portion of this homogeneous mass was then transferred to a tube containing 1 ml of TRIzol (Thermo Fisher Scientific, Waltham, USA) and further homogenised using 1.4 mm diameter zirconia beads (Bertin Technologies, Montigny-le-Bretonneux, France) on a Precellys 24 homogeniser (Bertin Technologies, Montigny-le-Bretonneux, France). The homogenisation was performed at 4 500 rpm with the cycle consisting of two 30-second phases separated by a 15-second break.

RNA was isolated from the prepared homogenate according to the TRIzol manufacturer’s protocol. The RNA quality and quantity were assessed spectrophotometrically using a NanoDrop 8000 instrument (Thermo Fisher Scientific, Waltham, USA). From each sample, 1 000 ng of RNA was collected as a template for the cDNA synthesis using the commercial QuantiTect Reverse Transcription Kit (QIAGEN, Hilden, Germany). This protocol also included the removal of gDNA from the samples. The resulting cDNA was stored at –20 °C until further analysis.

The relative gene expression was determined in the samples by quantitative polymerase chain reaction (qPCR) on a Bio-Rad CFX96 instrument (Bio-Rad Laboratories, Hercules, USA). The reaction mixture had a total volume of 10 μl and contained: 5 μl of the Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA), 0.3 μl of a forward and reverse primer (c = 10 μM/μl), 4 μl cDNA (c = 10 ng/μl), and deionised water to make up the volume. The samples were analysed in duplicate. β-actin and rp49 were used as the reference genes; the primer sequences are listed in Table 1.

Table 1. List of the used primers.

Gene Sequence (5'–3') Reference
Catalase (cat) F: GGCGGCTGAATTAAGTGCTA Collins et al. (2004)
R: TTGCGTTGTGTTGGAGTCAT
Superoxide dismutase (sod1) F: AGCAGATGCAAGTGGTGTTG Collins et al. (2004)
R: GAGCACCAGCATTTCCTGTAG
Superoxide dismutase (sod2) F: GTCGCCAAAGGTGATGTCAATAC Li et al. (2014)
R: CGTCTGGTTTACCGCCATTTG
Glutathione-S-transferase 1 (gst-1) F: AGGAGAGGTGTGGAGAGATAGTG Li et al. (2014)
R: CGCAAATGGTCGTGTGGATG
Defensin 1 (def-1) F: TGTCGGCCTTCTCTTCATGG Li et al. (2016)
R: TGACCTCCAGCTTTACCCAAA
Lysozyme (lys) F: CCAAATTAACAGCGCCAAGT Evans et al. (2006)
R: GCAATTCTTCACCCAACCAT
Hymenoptaecin (hym) F: CTCTTCTGTGCCGTTGCATA Evans et al. (2006)
R: GCGTCTCCTGTCATTCCATT
Prophenoloxidase activator (ppoa) F: GTTTGGTCGACGGAAGAAAA Evans et al. (2006)
R: CCGTCGACTCGAAATCGTAT
Beta-actin (β-act) F: TGCCAACACTGTCCTTTCTG Scharlaken et al. (2007)
R: AGAATTGACCCACCAATCCA
Ribosomal protein 49 (rp49) F: AAGTTCATTCGTCACCAGAG de Miranda and Fries (2008)
R: CTTCGAGTTCCTTGACATTATG
Open in a new tab

The PCR protocol consisted of the following steps: initial denaturation at 95 °C for 60 s, followed by 40 cycles of denaturation at 95 °C for 15 s and hybridisation with extension at 60 °C for 30 seconds. A melting curve analysis was performed to confirm the amplification of the specific product.

The gene expression results were evaluated by the 2−ΔΔCT method relative to the reference genes. A statistical analysis was performed using the JASP software (v0.19.2) and one-way analysis of variance (ANOVA), supplemented with Tukey’s post-hoc test.

RESULTS

The toxic effects of the observed concentrations of oxalic acid on the honey bee larvae were evaluated under in vivo conditions after spraying. The assessment was conducted in accordance with OECD Guideline 237 (OECD 2013). The average mortality rate of the honey bee larvae brood at the different application concentrations of oxalic acid is presented in Table 2.

Table 2. Mortality (72 h) of the honey bee larvae after the application of different concentrations of oxalic acid (three applications).

Test concentration (% of oxalic acids) No. of cells tested Average number of live larvae before application Average number of dead larvae after application % Mortality (72 h) ±SD
0 (control group) 100 68.33 1.67 2.41 0.45
0.87 100 50.33 5.67 10.94 2.68
1.75 100 68.00 24.50 36.21 15.92
3.50 100 80.50 41.50 51.54 19.30
7.00 100 56.33 44.00 79.39 17.25
Open in a new tab

As shown by the results, the highest mortality percentage of honey bee larvae after 72 h was observed with the application of a 7% oxalic acid concentration, where an average mortality of 79.39% was recorded among the honey bee larvae. On the contrary, the lowest mortality percentage after 72 h was recorded at the 0.87% oxalic acid concentration, with an average mortality of 10.94%. In the control group, the average mortality was 2.41%. The average percentage survival of the honey bee larvae in our experiment in the control group after 72 h and the experimental groups is shown in Figure 2.

Figure 2. Survival of the honey bee larvae 72 h after the application of different concentrations of the oxalic acid solution.

Figure 2

Open in a new tab

The median lethal concentration (LC50) of the oxalic acid solution was calculated using ToxRat Professional v3.3.0. Finney’s Probit Analysis and the method according to Roth et al. (1962) were simultaneously used to calculate the LC50. Figure 3 presents the curves and 95% confidence interval calculated by ToxRat Professional v3.3.0. The statistical significance value for the LC50 (72 h) calculation is P(F) ≤ 0.05. The LC50 range values after a single spray of oxalic acid solution for A. mellifera larvae are between 3.17% (ToxRat Professional v3.3.0) and 3.33% (Finney’s Probit Analysis). The LC50 (72 h) for young larvae after a single spray of oxalic acid solution, calculated according to Roth et al. (1962), is 3.26% (Table 3).

Figure 3. Mortality curve of the honey bee larvae as related to the oxalic acid concentration (ToxRat Professional v3.3.0).

Figure 3

Open in a new tab

Table 3. Toxicity of the oxalic acid solution to the honey bee larvae.

Method LC50 (72 h) (percent of solution) Confidence interval (percent of solution)
ToxRat Professional v3.3.0 3.17 2.65–3.89
Finney’s Probit Analysis 3.33 2.12–5.23
Roth et al. (1962) 3.26 2.07–5.13
Open in a new tab

The LD50 of oxalic acid for a single honey bee larva was calculated based on the obtained LC50 (72 h) values of this acid, the applied dose per 1 dm2, and the known number of honeycomb cells to which the acid was applied. The LD50 values (μg/larva) of oxalic acid, with the 95% confidence intervals obtained by the methods used, are given in Table 4. Figure 4, for demonstration, shows the toxic effect of the 7% oxalic acid application on the honey bee brood after 72 h of exposure in vivo.

Table 4. Toxicity (72 h) of the oxalic acid to the young honey bee larva (4-day-old).

Method LD50 (μg/larva) Confidence interval (μg/larva)
Roth et al. (1962) 97.8 62.1–153.9
Finney’s Probit Analysis 99.9 63.6–156.9
ToxRat Professional v3.3.0 95.1 79.5–116.7
Open in a new tab

Figure 4. Toxic effect of the 7% oxalic acid on the honey bee brood 72 h after the single exposure under the in vivo experimental conditions.

Figure 4

Open in a new tab

After applying different concentrations of oxalic acid to the honey bee brood, we did not observe statistically significant increases in the expression of the CAT, SOD1, and SOD2 genes in the experimental larval groups compared to the control, nor between the groups relative to each other. In summary, the expression results of the detoxification genes after application of different acid concentrations are shown in Table 5. For the GST gene, we observed increased expression. There was a significant increase in the expression of the GST gene when 7% oxalic acid was applied compared to the control group and to the group of larvae to which 1.75% oxalic acid was applied (Figure 5).

Table 5. Relative gene expression of the selected genes.

Gene Control (0%) 0.87% 1.75% 3.5% 7%
cat 1.012 ± 0.158 1.343 ± 0.108 1.11 ± 0.087 1.443 ± 0.171 1.204 ± 0.275
sod1 1.012 ± 0.15 1.357 ± 0.414 0.905 ± 0.233 1.047 ± 0.173 1.237 ± 0.124
sod2 1.04 ± 0.282 1.031 ± 0.123 0.801 ± 0.13 1.045 ± 0.134 0.909 ± 0.063
gst 1.03 ± 0.261 2.162 ± 0.690 1.225 ± 0.341 1.787 ± 0.313 2.934 ± 0.193a*,d*
def 1.509 ± 0.942 5.626 ± 1.679a* 0.620 ± 0.259b*,c** 2.576 ± 0.737c** 7.813 ± 0.374a**
lys 1.095 ± 0.429 1.885 ± 0.644 1.227 ± 0.046 2.329 ± 0.709 2.502 ± 0.658
hym 1.250 ± 0.642 1.576 ± 0.275 0.647 ± 0.002 1.918 ± 0.587 1.819 ± 0.184
ppoa 1.094 ± 0.423 0.833 ± 0.085 0.884 ± 0.099 1.654 ± 0.302b* 1.476 ± 0.124
Open in a new tab

*P ≤ 0.05; **P ≤ 0.01

Results calculated as 2−ΔΔCT and presented with the standard deviation; Significant difference compared to a = control, b = 0.87%, c = 7%, d = 1.75%

Figure 5. Relative gene expression of gst.

Figure 5

Open in a new tab

Significant difference compared to: a = control, and d = 1.75%

To evaluate the stimulation of the larval immune system following the single oxalic acid spray application, we monitored the relative gene expression of DEF, LYS HYM, and PPOA. No statistically significant change was observed for the antimicrobial peptides encoded by the LYS and HYM genes. However, significant changes in the expression of DEF and PPOA were observed. The relative gene expression of DEF was significantly increased at the oxalic acid concentrations of 0.87% and 7% compared to the control group. The group receiving 1.75% oxalic acid showed significantly lower expression compared to the 0.87% and 7% concentration groups. The group exposed to 3.5% oxalic acid had a significantly reduced relative expression of DEF compared to the 7% concentration group (Figures 6 and 7).

Figure 6. Relative gene expression of def-1.

Figure 6

Open in a new tab

Significant difference compared to: a = control, b = 0.87% and c = 7%

Figure 7. Relative gene expression of ppoa.

Figure 7

Open in a new tab

Significant difference compared to b = 0.87%

The relative gene expression of PPOA was significantly increased in the 3.5% acid group compared to the 0.87% acid group (Figure 7).

DISCUSSION

The production of food of plant origin is critically dependent on pollinators, including honey bees, whose pollination ability depends on their population size and health. Globally, the number of honey bee colonies has been declining for a long time, primarily due to environmental pollution and high honey bee morbidity. One of the most serious parasites of honey bees (A. mellifera) is currently the V. destructor mite, whose resistance to acaricides poses a major challenge. Consequently, developing new integrated pest management control procedures for Varroa destructor remains a major focus of scientific interest (Rosenkranz et al. 2010; Goulson et al. 2015).

The acaricide amitraz has long been used to treat varroosis. In recent years, this has created strong selection pressure on V. destructor mite populations. This pressure has contributed to the development of resistance to amitraz. Mutations N87S and Y215H in the β2-adrenergic-like octopamine receptor (Octβ2R), the target site of amitraz, have been identified as causes of this resistance (Hernandez-Rodriguez et al. 2025).

Therefore, low-molecular-weight organic acids (formic acid, lactic acid, and oxalic acid), or their combinations with amitraz or coumaphos, have been introduced to treat varroosis. These therapies have involved monitoring the effect of oxalic acid on Varroa destructor mites while evaluating its effect on honey bees under in vitro and in vivo conditions. A 4% oxalic acid in sugar solution demonstrated up to 93.7% efficacy on the Varroa destructor when applied in autumn. No reductions in the queen bee’s egg-laying or adult honey bee deaths due to the treatment were observed during the experiments (Girisgin and Aydin 2010).

The LC50 (72 h) value of the oxalic acid solution, determined by us and applied in spray form to a honey bee (A. mellifera) brood under in vivo conditions, calculated using various methods – ToxRat Professional v3.3.0., Finney’s Probit Analysis, and the method according to Roth et al. (1962) – ranged from 3.17% to 3.33% (Table 3). Using the OECD 237 methodology Sabova et al. (2019) determined the LC50 (72 h) value of an oxalic acid solution applied in spray form to a honey bee brood under in vitro conditions. The LC50 (72 h) value found was 2.425%. Our slightly higher LC50 (72 h) value can be explained by the fact that our experiments were carried out under in vivo conditions, where the hygienic behaviour capacity of honey bees plays a significant role in the application of chemicals. Honey bees can metabolise or excrete toxic substances, reducing their effectiveness and leading to a higher tolerance of the organism. This explains the higher LC50 values compared to the in vitro conditions.

It is also similar in the case of the determination of the LD50 for spray application to the honey bee larvae. In our experiment, we determined LD50 (72 h) ranging from 95.1 to 99.9 μg per larva under in vivo conditions (Table 4). The authors Sabova et al. (2019) reported an estimated LD50 (72 h) of 45 μg for a honey bee larva. The differences between our results and those of Sabova et al. (2019) highlight the importance of experimental conditions (in vivo vs in vitro) when assessing the toxicity of chemicals to honey bees. The higher LD50 values under in vivo conditions can again be explained by the metabolic activity and hygienic behaviour of honey bees, which contribute to the reduced substance toxicity. These differences between the in vivo and in vitro conditions highlight the importance of considering the biological mechanisms of bees when assessing the toxicity of chemicals.

In a feeding toxicity study, the LC50 of oxalic acid was determined for a honey bee brood. Oxalic acid was administered at different concentrations in a diet containing 50% royal jelly and 50% sucrose. The LC50 values ranged from 0.649% to 0.959%, depending on the brood age (Terpin et al. 2019). The high toxicity observed after oral administration can be explained by damage to the larval gut epithelium. Gregorc et al. (2004) have shown that necrotic damage to 25% of the epithelial cells occurs as early as 5 h after the oral application of a 2.97% oxalic acid solution in a 31.97% sucrose solution. It follows from the above that although treating honey bees against varroosis with the recommended dose of 5 ml of 3–5% oxalic acid in a sugar solution (applied by trickling) is safe for adult bees, it poses a high risk to the honey bee brood. Therefore, applying oxalic acid by trickling in the bee colonies is particularly suitable during the winter broodless period. For this reason, a spray application of oxalic acid is significantly safer as it minimises the risk to the honey bee brood.

The therapeutic index (TI) provides information on the relative safety of a drug. This value is given as the ratio between the median toxic dose and the median therapeutic dose of the drug. Safe drugs have TI values in the tens to hundreds. Our calculations show a TI value of 1.1 for oxalic acid for the honey bee larvae. A low TI value of oxalic acid indicates a high risk to the honey bee brood. Therefore, the precise preparation of the oxalic acid application solution and the correct dosage on the brood comb are essential in practice.

The effect of oxalic acid on Varroa destructor is due to the mite’s high sensitivity to the oxalic acid – the LD50 (24 h) of oxalic acid after spray application is 5.12 μg per Varroa destructor under in vitro conditions (Aliano et al. 2006). The LD50 (72 h) value determined by us for the spray application to the honey bee larvae ranges from 95.1 μg to 99.9 μg per larva under in vivo conditions. Thus, the toxicity of oxalic acid to Varroa destructor is 20 times higher than to the honey bee larvae. Due to the toxicity of oxalic acid to the brood, the application method and dosage must be carefully considered to minimise any negative effects on the colony.

The toxic effect of oxalic acid on the honey bee brood demonstrates its biological effect. As shown by the results of Qi et al. (2020), honey bee larvae are sensitive to chemical exposure, and high doses can increase the production of antioxidant enzymes. Oxalic acid, commonly used to control varroosis, is generally considered safe for bees. In our experiment, we did not observe the increased expression of SOD1, SOD2 or CAT genes in the exposed larvae. This suggests that, at a given concentration, oxalic acid does not stimulate the honey bees’ antioxidant system. This lack of activation of the antioxidant response could weaken the organisms of the larvae or increase their mortality (Sagona et al. 2024).

In our study, the GST gene expression was significantly affected only at high concentrations of oxalic acid, 7% (Figure 5). This enzyme is usually associated with exposure to xenobiotics, particularly pesticides (Li et al. 2017; Decio et al. 2021), and its activity increases in such cases. Thus, our results suggest that the use of oxalic acid in colonies is safe as long as the concentration does not exceed the level that activates the natural detoxification response in larvae.

The immune system of honey bees, although simpler than that of mammals, consists of humoral and cellular immunity. The humoral immune response is mainly provided by antimicrobial peptides (AMPs) (Danihlik et al. 2015), including lysozyme and hymenoptaecin, the levels of which are physiologically elevated in the infected larvae (Chan et al. 2009). In our study, we observed no change in the relative expression of these antimicrobial peptides, which is consistent with the study of Boncristiani et al. (2012). This may be due to a different mechanism of stimulation of AMP synthesis during bacterial infection.

On the other hand, synthetic acaricides, such as flumethrin, fluvalinate, and amitraz, used in beekeeping, increased the hymenoptaecin expression, but did not affect the lysozyme or defensin expression (Garrido et al. 2013). Regarding defensin, in our study, we observed an increased relative expression in the group exposed to the highest oxalic acid concentration (7%), but, paradoxically, also in the group exposed to the lowest oxalic acid concentration (0.87%) (Figure 6). This may be due to the individual variability in the defense in expression, which varies considerably between individuals. Thus, in larvae, the immune response was stimulated.

Within the group of larvae treated with 1.75% oxalic acid, we observed reduced DEF expression. It would be detrimental to both larvae and adult bees if the product used to treat them reduced their immune response. The aforementioned synthetic acaricides, as well as oxalic acid, are used to treat honey bees infested with Varroa destructor that transmits a number of pathogens (Kang et al. 2016). Potentially, an immunosuppressed individual would have a more difficult time defending itself against these pathogens, leading to its death. Moreover, the immune system of honey bees develops with age; a stronger immune response is observed in adult honey bees (Wilson-Rich et al. 2008), which increases the infection risk in developing larvae.

The phenoloxidase cascade, which leads to melanisation, is one of the basic defence mechanisms of invertebrates against microorganisms. This biochemical process involves several successive reactions. Upon recognition of a pathogen, prophenoloxidase is activated by the prophenoloxidase-activating enzyme (PPOA) (Ashida and Brey 1998). In our study, we observed no change in the PPOA gene expression compared to the control group (Figure 7). This result can be viewed as positive because melanisation is critical not only for the immune response, but also for bee exoskeleton formation (Sugumaran 2022). The disruption of this process could lead to developmental or colour abnormalities (Bitondi et al. 1998; Liu et al. 2015), as well as a weakened immune response (Luz et al. 2022).

Similar selective changes in antioxidant enzyme activity in homogenates of whole surviving larvae were reported by Sabova et al. (2019) at the same doses of oxalic acid. The specific activities of superoxide dismutase and catalase showed similar trends, depending on the oxalic acid concentration. At the lowest oxalic acid concentration (0.87%), the authors have not observed any changes in the activity of these enzymes. A slight activation of the enzymes (approximately 1.5-fold) was observed at the 1.75% oxalic acid concentration. With a further increase in the oxalic acid concentration, the enzyme activity gradually decreased. The specific glutathione-S-transferase (GST) activity increased significantly at the 3.5% oxalic acid concentration (1.0 U/mg ± 0.2 U/mg) compared to the control group (0.66 U/mg ± 0.03 U/mg) and the 0.87% oxalic acid group (0.547 U/mg ± 0.003 U/mg). At this oxalic acid concentration (3.5%), a statistically significant increase in the level of the biochemical marker of oxidative stress, TBARS (Thiobarbituric Acid Reactive Substances), was observed, which was more than 1.7 times higher compared to the control group.

The obtained results show that oxalic acid is safe for adult bees at a therapeutic dose of 0.3 ml of a 3% solution per dm2 of honeycomb, but poses some toxicological risk to young honey bee larvae. This risk is supported by the low therapeutic index value (TI = 1.1), indicating a narrow safety margin between efficacy and toxicity. In addition, oxalic acid may inhibit the larvae’s immune response, increasing their susceptibility to infections. Therefore, it is essential in the treatment of varroosis to strictly follow the recommended concentration (3%) and dosage (0.3 ml per dm2) of oxalic acid in spray applications to minimise the risk of brood intoxication. These precautions are key to maintaining the health of colonies and maintaining their pollination ability, which is essential for agricultural production.

Funding Statement

Supported by the Project No. 1092/2022/MPRVSR-930, by the Slovak Grant Agency APVV-21-0185, Slovak Grant Agency VEGA 1/0161/23, VEGA 1/0454/22 and by the National Reference Laboratory for Pesticides of the University of Veterinary Medicine and Pharmacy in Košice, Slovak Republic.

Conflict of interest

The authors declare no conflict of interest.

REFERENCES

  1. Alghazal M, Lenartova V, Holovska K, Sobekova A, Falis M, Legath J. Activities of antioxidant and detoxifying enzymes in rats after lead exposure. Acta Vet Brno. 2008;77:347-54. [Google Scholar]
  2. Aliano NP, Ellis MD, Siegfried BD. Acute contact toxicity of oxalic acid to Varroa destructor (Acari: Varroidae) and their Apis mellifera (Hymenoptera: Apidae) hosts in laboratory bioassays. J Econ Entomol. 2006 Oct;99(5):1579-82. [DOI] [PubMed] [Google Scholar]
  3. Ashida M, Brey PT. Recent advances in research on the insect prophenoloxidase cascade. In: Brey PT, Hultmark D, editors. Molecular mechanisms of immune responses in insects. London, UK: Chapman & Hall; 1998. p. 135-72. [Google Scholar]
  4. Bahreini R, Nasr M, Docherty C, de Herdt O, Muirhead S, Feindel D. Evaluation of potential miticide toxicity to Varroa destructor and honey bees, Apis mellifera, under laboratory conditions. Sci Rep. 2020 Dec 9;10(1):21445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bitondi MMG, Mora IM, Simoes ZLP, Figueiredo VLC. The Apis mellifera pupal melanization program is affected by treatment with a juvenile hormone analogue. J Insect Physiol. 1998 May;44(5-6):499-507. [DOI] [PubMed] [Google Scholar]
  6. Boncristiani H, Underwood R, Schwarz R, Evans JD, Pettis J, vanEngelsdorp D. Direct effect of acaricides on pathogen loads and gene expression levels in honey bees Apis mellifera. J Insect Physiol. 2012 May;58(5):613-20. [DOI] [PubMed] [Google Scholar]
  7. Carnesecchi E, Svendsen C, Lasagni S, Grech A, Quignot N, Amzal B, Toma C, Tosi S, Rortais A, Cortinas-Abrahantes J, Capri E, Kramer N, Benfenati E, Spurgeon D, Guillot G, Dorne JL. Investigating combined toxicity of binary mixtures in bees: Meta-analysis of laboratory tests, modelling, mechanistic basis and implications for risk assessment. Environ Int. 2019 Dec;133(Pt B):105256. [DOI] [PubMed] [Google Scholar]
  8. Chan QW, Melathopoulos AP, Pernal SF, Foster LJ. The innate immune and systemic response in honey bees to a bacterial pathogen, Paenibacillus larvae. BMC Genomics. 2009 Aug 21;10:387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Collins AM, Williams V, Evans JD. Sperm storage and antioxidative enzyme expression in the honey bee, Apis mellifera. Insect Mol Biol. 2004 Apr;13(2):141-6. [DOI] [PubMed] [Google Scholar]
  10. Corona M, Robinson GE. Genes of the antioxidant system of the honey bee: Annotation and phylogeny. Insect Mol Biol. 2006 Oct;15(5):687-701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Danihlik J, Aronstein K, Petrivalsky M. Antimicrobial peptides: A key component of honey bee innate immunity: Physiology, biochemistry, and chemical ecology. J Apic Res. 2015;54(2):123-36. [Google Scholar]
  12. de Miranda JR, Fries I. Venereal and vertical transmission of deformed wing virus in honeybees (Apis mellifera L.). J Invertebr Pathol. 2008 Jun;98(2):184-9. [DOI] [PubMed] [Google Scholar]
  13. Decio P, Miotelo LD, Pereira FDC, Roat TC, Marin-Morales MA, Malaspina O. Enzymatic responses in the head and midgut of Africanized Apis mellifera contaminated with a sublethal concentration of thiamethoxam. Ecotoxicol Environ Saf. 2021 Oct 15;223:112581. [DOI] [PubMed] [Google Scholar]
  14. EMA – European Medicines Agency. EPAR summary for the public, EMA/567879/2017 [Internet]. 2017 [cited 2025 Jun 13]. Available from: https://www.ema.europa.eu/en/documents/overview/oxybee-epar-summary-public_en.pdf.
  15. EMA – European Medicines Agency. EPAR summary for the public, EMA/221765/2018 [Internet]. 2018 [cited 2025 Jun 13]. Available from: https://www.ema.europa.eu/en/documents/overview/danys-bienenwohl-epar-summary-public_en.pdf.
  16. Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, Jiang H, Kanost M, Thompson GJ, Zou Z, Hultmark D. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol Biol. 2006 Oct;15(5):645-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fridovich I. Superoxide anion radical (O2–.), superoxide dismutases, and related matters. J Biol Chem. 1997 Jul 25;272(30):18515-7. [DOI] [PubMed] [Google Scholar]
  18. Fukui M, Zhu BT. Mitochondrial superoxide dismutase SOD2, but not cytosolic SOD1, plays a critical role in protection against glutamate-induced oxidative stress and cell death in HT22 neuronal cells. Free Radic Biol Med. 2010 Mar 15;48(6):821-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Garrido G, Barrios M, Penades R, Enriquez M, Garolera M, Aragay N, Pajares M, Valles V, Delgado L, Alberni J, Faixa C, Vendrell JM. Computer-assisted cognitive remediation therapy: Cognition, self-esteem and quality of life in schizophrenia. Schizophr Res. 2013 Nov;150(2-3):563-9. [DOI] [PubMed] [Google Scholar]
  20. Girisgin A, Aydin L. Efficacies of formic, oxalic and lactic acids against Varroa destructor in naturally infested honeybee (Apis mellifera L.) colonies in Turkey. Kafkas Univ Vet Fak Derg. 2010;16:941-5. [Google Scholar]
  21. Goulson D, Nicholls E, Botías C, Rotheray EL. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science. 2015 Mar 27;347(6229):1255957. [DOI] [PubMed] [Google Scholar]
  22. Gregorc A, Pogacnik A, Bowen I. Cell death in honeybee (Apis mellifera) larvae treated with oxalic or formic acid. Apidologie. 2004;35(5):453-60. [Google Scholar]
  23. He B, Liu Z, Wang Y, Cheng L, Qing Q, Duan J, Xu J, Dang X, Zhou Z, Li Z. Imidacloprid activates ROS and causes mortality in honey bees (Apis mellifera) by inducing iron overload. Ecotoxicol Environ Saf. 2021 Sep 3;228:112709. [DOI] [PubMed] [Google Scholar]
  24. Hernandez-Rodriguez CS, Moreno-Marti S, Emilova-Kirilova K Gonzalez-Cabrera J. A new mutation in the octopamine receptor associated with amitraz resistance in Varroa destructor. Pest Manag Sci. 2025 Jan;81(1):308-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kang SK, DeCelles KA, Tilcsik A, Jun S. Whitened resumes: Race and self-presentation in the labor market. Adm Sci Q. 2016;61(3):469-502. [Google Scholar]
  26. Li C, Xu B, Wang Y, Yang Z, Yang W. Protein content in larval diet affects adult longevity and antioxidant gene expression in honey bee workers. Entomol Exp Appl. 2014;151(1):19-26. [Google Scholar]
  27. Li W, Evans JD, Huang Q, Rodriguez-Garcia C, Liu J, Hamilton M, Grozinger CM, Webster TC, Su S, Chen YP. Silencing the honey bee (Apis mellifera) Naked Cuticle Gene (nkd) improves host immune function and reduces Nosema ceranae infections. Appl Environ Microbiol. 2016 Oct 27;82(22):6779-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li Z, Li M, He J, Zhao X, Chaimanee V, Huang W, Nie H, Zhao Y, Su S. Differential physiological effects of neonicotinoid insecticides on honey bees: A comparison between Apis mellifera and Apis cerana. Pestic Biochem Physiol. 2017 Aug;140:1-8. [DOI] [PubMed] [Google Scholar]
  29. Liu S, Wang M, Li X. Pupal melanization is associated with higher fitness in Spodoptera exigua. Sci Rep. 2015 Jun 3;5:10875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Luz GF, Santana WC, Santos CG, Santana LM, Serrao JE. Cuticle melanization and the expression of immune-related genes in the honeybee Apis mellifera (Hymenoptera: Apidae) adult workers. Comp Biochem Physiol B. 2022 Jan;257:110679. [DOI] [PubMed] [Google Scholar]
  31. Migdal P, Murawska A, Bienkowski P, Strachecka A, Roman A. Effect of the electric field at 50 Hz and variable intensities on biochemical markers in the honey bee’s hemolymph. PLoS One. 2021 Jun 24;16(6):e0252858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. OECD – Organisation for Economic Co-operation and Development. Test No. 237: Honey bee (Apis mellifera) larval toxicity test, single exposure. OECD Guidelines for the Testing of Chemicals. Section 2. Paris, France: OECD Publishing; 2013. 36 p. [Google Scholar]
  33. Orcic S, Nikolic T, Purac J, Sikoparija B, Blagojevic DP, Vukasinovic E, Plavsa N, Stevanovic J, Kojic D. Seasonal variation in the activity of selected antioxidant enzymes and malondialdehyde level in worker honey bees. Entomol Exp Appl. 2017;165(2-3):120-8. [Google Scholar]
  34. Qi S, Zhu L, Wang D, Wang C, Chen X, Xue X, Wu L. Flumethrin at honey-relevant levels induces physiological stresses to honey bee larvae (Apis mellifera L.) in vitro. Ecotoxicol Environ Saf. 2020 Mar 1;190:110101. [DOI] [PubMed] [Google Scholar]
  35. Rosenkranz P, Aumeier P, Ziegelmann B. Biology and control of Varroa destructor. J Invertebr Pathol. 2010 Jan;103(Suppl_1):S96-119. [DOI] [PubMed] [Google Scholar]
  36. Roth Z, Trcka V, Josifko M, Maly V. Statisticke metody v experimentalni medicine [Statistical methods in experimental medicine]. Prague, Czech Republic: Státní zdravotnické nakladatelství; 1962. p. 296-318. Czech. [Google Scholar]
  37. Sabova L, Sobekova A, Staron M, Sabo R, Legath J, Staronova D, Lohajova L, Javorsky P. Toxicity of oxalic acid and impact on some antioxidant enzymes on in vitro-reared honeybee larvae. Environ Sci Pollut Res Int. 2019 Jul;26(19):19763-9. [DOI] [PubMed] [Google Scholar]
  38. Sagona S, Tafi E, Coppola F, Nanetti A, Boni CB, Orlando C, Palego L, Betti L, Giannaccini G, Felicioli A. Oxalic acid treatment: Short-term effects on enzyme activities, vitellogenin content, and residual oxalic acid content in house bees, Apis mellifera L. insects. 2024 Jun 3;15(6):409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Scharlaken B, De Graaf DC, Goossens K, Brunain M, Peelman LJ, Jacobs FJ. Reference gene selection for insect expression studies using quantitative real-time PCR: The head of the honeybee Apis mellifera after a bacterial challenge. J Insect Sci. 2007;8(1). [Google Scholar]
  40. Smith MR, Singh GM, Mozaffarian D, Myers SS. Effects of decreases of animal pollinators on human nutrition and global health: A modelling analysis. Lancet. 2015 Nov 14;386(10007):1964-72. [DOI] [PubMed] [Google Scholar]
  41. Sugumaran M. Cuticular sclerotization in insects – A critical review. Adv Insect Physiol. 2022;62:111-214. [Google Scholar]
  42. Terpin B, Perkins D, Richter S, Krafty J, Snell TW, Pierson JA. A scientific note on the effect of oxalic acid on honey bee larvae. Apidologie. 2019 May 13;50(3):363-8. [Google Scholar]
  43. Toporcak J, Bires J, Filo P. Metodika na celorocne osetrovanie vcelstiev proti kliestikovitosti [Methodology for year-round treatment of bee colonies against varroosis]. Banska Bystrica, Slovakia: Stredná odborná škola Pod Bánošom; 2020. Slovak. [Google Scholar]
  44. Wilson-Rich N, Dres ST, Starks PT. The ontogeny of immunity: Development of innate immune strength in the honey bee Apis mellifera. J Insect Physiol. 2008 Oct-Nov;54(10-11):1392-9. [DOI] [PubMed] [Google Scholar]

Articles from Veterinární Medicína are provided here courtesy of Czech Academy of Agricultural Sciences

RESOURCES