Histopathology of nasopharyngeal and palatine tonsils in Japanese black calves naturally infected with Mycoplasma bovis

Abstract

Mycoplasma bovis (M. bovis) is an important bacterium in the bovine respiratory disease complex (BRDC), which causes significant economic losses. The nasopharyngeal and palatine tonsils are mucosal-associated lymphoid tissue components that are the initial barrier to respiratory pathogens. In the present study, we investigated 5 pneumonic Japanese black and 3 control calves (2 Japanese black and 1 Holstein). The localization of M. bovis in the nasopharyngeal, palatine tonsils, and lungs was examined using nested and multiplex polymerase chain reaction (PCR), histopathology, and in situ hybridization (ISH) techniques. Nested PCR revealed that all examined tissues from all pneumonic calves were positive for M. bovis infection, but not the control. Histopathology revealed suppurative nasopharyngeal tonsillitis and palatine tonsillar cryptitis in all cases. Surprisingly, prominent histologic changes were observed in the palatine tonsils but not in the nasopharyngeal tonsils. Necrotizing suppurative bronchopneumonia was observed in 4 pneumonic calves. In ISH analysis, positive hybridization signals adherent to and/or within the surface epithelium of nasopharyngeal tonsils and crypt epithelium of nasopharyngeal and palatine tonsils were observed. Additionally, these signals were seen in the palatine tonsillar cryptic detritus. In the lungs, ISH signals were observed in necrotic areas, the bronchial epithelium, and pulmonary inflammatory exudate. These findings suggest that the nasopharyngeal and palatine tonsils are the primary sites of M. bovis infection. Also, M. bovis can colonize the detritus in the crypts of the palatine tonsils of the pneumonic animals.

INTRODUCTION

Bovine respiratory disease complex (BRDC) poses a global threat to the cattle industry due to high infection and death rates [23]. In 2021, the Ministry of Agriculture, Forestry, and Fisheries reported that the updated incidence rate of respiratory diseases in Japan was 21% (http://www.maff.go.jp/j/tokei/kouhyou/katiku_kyosai/) (in Japanese). In the United States, the death rate among feedlot cattle ranges from 50% to 70%, whereas the infection rate approaches 75% [9]. The estimated financial losses caused by bovine respiratory diseases were reported recently to be $1–3 billion annually [15]. Such significant economic losses are attributed to ineffective antibiotic use, weight loss, disposal of unresponsive affected animals, and decreased milk production [31].

BRDC is a multifactorial disease caused by a combination of viral and bacterial agents and the effects of environmental and management-related stressors [56]. Numerous viral agents can contribute to the development of BRDC, such as bovine viral diarrhea virus (BVDV), bovine coronavirus, bovine parainfluenza virus 3, bovine respiratory syncytial virus, and bovine herpesvirus 1 (BHV1) [21, 56]. The bacteria most often identified in BRDC-affected animals include Mannheimia haemolytica, Pasteurella multocida, Histophilus somni, Trueperella pyogenes, and Mycoplasma spp. [6].

Three species from the genus Mycoplasma, family Mycoplasmacetae, class Mollicutes-Mycoplasmosis (Mycoplasma) bovis (M. bovis), M. dispar, and M. bovirhinis have been identified as being associated with BRDC [32]. The genus Mycoplasma includes some of the smallest self-replicating organisms, which are characterized by the lack of a cell wall and only a minimal amount of genetic material [14]. Infection with and shedding of M. bovis can begin in the early stages of cattle life, as early as 5 days after birth [54]. Infection with M. bovis can affect many host tissues, thus leading to multiple clinical manifestations, including bronchopneumonia, mastitis, arthritis, keratoconjunctivitis, and abortion [39]. Included among the variety of M. bovis virulence factors are immunogenic variable surface proteins (Vsps) in the plasma membrane with variable size and phase expression, as well as the ability for biofilm formation, and hydrogen peroxide production by the organism [12, 26, 28, 33]. Infection with M. bovis is characterized by its chronicity. This results from phagocytic resistance, negative regulation of the neutrophilic oxidative burst, and decreased lymphocyte proliferation induced by M. bovis [24, 51, 57]. Other factors that contribute to chronicity include the predominance of T helper 2 cellular immune reactions and humoral immunity characterized by a predominance of IgG1, which exhibits low opsonization capacity [61].

Waldeyer’s ring is a component of the mucosa-associated lymphoid tissue (MALT) that consists primarily of the unpaired nasopharyngeal tonsils, the paired palatine tonsils, lingual tonsils, and the tubal tonsils [8, 45]. They are perfectly positioned to sample antigens arriving via either the nasal or oral passages, as they are situated at the confluence of the nasopharynx and oropharynx [37, 42, 43]. For instance, humans have well-developed mucosal lymphoid tissues in the nasopharynx (adenoids) and the oropharynx (tonsils) [41]. However, they lack constitutively structured lymphoid tissues in the nasal passage [49]. In mice, nasal-associated lymphoid tissue, which is a paired structure found on the dorsal side of the soft palate at the bottom of the nasal passages, is suspected to be analogous to human Waldeyer’s ring [16]. Although no discernible lymphoid tissues are found in the noses of dogs or cats [41], horses and sheep have nasal structures that resemble isolated lymphoid follicles [27]. Because of the difficulty in dissecting the nasal mucosa from the bone-enclosed nasal cavity and the time-consuming work, there are relatively few histological studies about the MALT of the nasopharynx. The terms such as nasal-associated lymphoid tissue, nasopharynx-associated lymphoid tissue, and nasopharyngeal tonsils describe the MALT of the nasal and nasopharyngeal cavity in humans and animals [8, 16, 27]. Bovines were reported to have both nasopharyngeal tonsils and nasopharyngeal MALT in their nasopharynx [27, 35]. While tonsillar tissues were experimentally studied in BHV1 [44] and BVDV [11], nasopharyngeal MALT is reportedly involved in the pathogenesis of a variety of infections, such as primary and persistent foot-and-mouth disease in cattle and sheep [4, 52, 53].

Histological investigation of the upper respiratory tract, which represents the first line of defense against respiratory infections, is a useful approach for studying the pathophysiology of infectious diseases such as caused by BRDC pathogens, porcine reproductive and respiratory syndrome virus, and porcine circovirus 2 [19, 38, 59]. Both nasopharyngeal and palatine tonsils are MALT components of the upper respiratory tract. In cattle, however, these tonsils have been studied primarily in experimental infections [11, 44], and few studies have examined their pathological roles in naturally infected cattle [19]. Additionally, the earlier research investigated the relationship between M. bovis infection and nasopharyngeal and palatine tonsils, mostly using swabbing, PCR, and bacterial culture, but not histology [30]. Although tonsillitis has been reported in the palatine tonsils of pneumonic cattle [55], histopathological differences were not examined between nasopharyngeal tonsils and palatine tonsils. The present study, therefore, histopathologically investigated the pathogenesis of M. bovis in the nasopharyngeal and palatine tonsils of pneumonic calves. A greater understanding of the pathogenesis of M. bovis infection could help the development of treatments to better control and prevent BRDC.

MATERIALS AND METHODS

Animals and sampling

Five recently dead and farm-euthanized Japanese black calves were obtained from several farms in Miyazaki Prefecture, Japan (Table 1). The necropsy was done in the Department of Veterinary Pathology, University of Miyazaki, on the same day of death. The calves were between 1.5 and 6 months old; all calves exhibited respiratory signs. The nasopharyngeal, corresponding to the pharyngeal tonsil, and palatine tonsils were collected from the nasopharynx and oropharynx, following Casteleyn et al [13]. Three additional calves euthanized due to disorders unrelated to the respiratory system (2 Japanese black [nos. 6 and 8] and 1 Holstein [no. 7]) were used as controls. Fresh tissue samples of nasopharyngeal tonsils, palatine tonsils, and lungs were submitted to a nested polymerase chain reaction (PCR) for detecting M. bovis and a multiplex PCR for detecting M. dispar and M. bovirhinis. To prepare samples for light microscopy and in situ hybridization (ISH), fresh tissue samples were fixed in 4% paraformaldehyde (PFA).

Table 1. PCR detection of Mycoplasma spp. and M. bovis ISH in nasopharyngeal tonsils, palatine tonsils, and lungs of pneumonic (nos. 1–5) and control (nos. 6–8) calves.

Case no.	Age	Sex	Nasopharyngeal tonsils				Palatine tonsils				Lungs
			M. bovis	M. dispar	M. bovirhinis	ISHa	M. bovis	M. dispar	M. bovirhinis	ISHa	M. bovis	M. dispar	M. bovirhinis	ISHa
1	1.5	F	+	+	+	1+	+	+	-	2+	+	+	-	2+
2	2	F	+	+	-	1+	+	+	-	2+	+	+	-	3+
3	3	M	+	+	-	1+	+	+	-	1+	+	+	-	1+
4	4	F	+	+	-	1+	+	+	-	1+	+	+	-	1+
5	6	M	+	+	+	1+	+	+	-	1+	+	+	-	2+
6	2	F	-	+	-	-	-	+	-	-	-	+	+	-
7	5	F	-	+	-	-	-	-	-	-	-	-	-	-
8	6	F	-	+	-	-	-	-	-	-	-	-	-	-

F, female; M, male; +, positive; -, negative; ^a, ISH scoring based on the percentage of positive cells in 10 random high-power fields: - = <1%; 1+= 1%−33%; 2+= 34%−66%; 3+= >66%.

PCR

DNA templates were extracted from the fresh tissues using proteinase K (Takara Bio, Kusatsu, Japan). Nested PCR primers and analysis conditions were as described by Pinnow et al [46], with minor modifications to the cycling conditions. The presence of M. dispar and M. bovirhinis in the examined tissues was examined using multiplex PCR with primers and conditions adopted from Maya-Rodríguez et al [32]. All trials included both positive and negative controls.

Probe preparation

Reverse transcription PCR was employed for probe preparation. RNA was extracted via TRIzol^R Reagent according to the manufacturer’s instructions (Thermo Fisher Scientific Inc., Waltham, MA, USA). Briefly, 10% (w/v) tissue homogenate was added to TRIzol reagent. After adding chloroform (Wako, Osaka, Japan) and centrifuging well, the RNA in the aqueous phase was precipitated with isopropanol. The final ethanol-washed RNA pellet was dried with air, then dissolved in diethyl-pyrocarbonate-treated water and stored at −20°C until use. A primer set consisting of 23SCom-F: GTAACTATAACGGTCCTAAG and 23SCom-R: GTTACTCTTTAGGAGGCGAC, which target the M. bovis highly conserved 23S ribosomal RNA (rRNA) region, was utilized as reported by Koike and Usami [25]. Briefly, samples were reverse transcribed for 45 min at 45°C and then preheated at 94°C for 3 min, followed by denaturation at 94°C for 1 min, annealing at 57°C for 1 min, extension at 72°C for 1 min, and final elongation at 72°C for 5 min. Digoxigenin (DIG)-labeled and fluorescein isothiocyanate (FITC)-labeled cRNA probes were prepared using an RNA labeling kit (Roche, Sigma Aldrich, Tokyo, Japan), as described previously [60].

Histopathological examination

Fixed tissues embedded in paraffin were sectioned into 3–5 µm thickness and stained with hematoxylin and eosin (HE). The nasopharyngeal and palatine tonsils were evaluated for histological changes, including epithelial degeneration and necrosis, and neutrophilic and macrophage infiltration in the surface epithelium, subepithelium, and crypts. The degrees of necrosis and inflammatory cell infiltration were graded as absent, mild, moderate, or severe [47]. Lung tissues were examined for histological changes in the bronchial, bronchiolar, and alveolar linings, and the presence and type of inflammatory exudate were also evaluated.

ISH

ISH was performed as previously reported [60]. Briefly, tissue sections were deparaffinized and rehydrated. After blocking endogenous peroxidase activity, proteinase K digestion was performed for 15 min at 37°C. The sections were then fixed in 4% PFA, deproteinated in 0.1 N HCL, and acetylated with 0.1 M triethanolamine buffer (pH 8.0) containing 0.25% acetic anhydride. Hybridization was performed using 100 µL of hybridization buffer (Genostaff, Tokyo, Japan) containing 0.5 µL (102 ng/µL) of the M. bovis probe for 18 hr. at 42°C. After hybridization, the sections were washed in 50% formamide-2× saline–sodium citrate (SSC) buffer. RNase treatment was carried out for 30 min at 37°C, then the tissue sections were washed in 2× SSC, 0.2× SSC, and 0.1× SSC buffer. Tissues were sensitized using Biotin tyramide working solution (Akoya Biosciences, Marlborough, MA, USA). After washing with Tris-NaCl-Tween buffer, anti-DIG horseradish peroxidase–labeled streptavidin (Dako, Tokyo, Japan) in Tris-NaCl blocking buffer was applied to stain biotin deposits. The reaction was visualized using a DAB kit (Dako) and counterstaining with hematoxylin. Quantitative analysis of the ISH results was performed using Fiji (ImageJ 1.54p) [48] to detect the percentage of positive cells in 10 random high-power (40x) fields. The recorded percentage of positive cells was scored as: −= <1%; 1+= 1%−33%; 2+= 34%−66%; 3+= >66% [50].

Probe specificity was assessed using three approaches with serial lung tissue sections: (1) no probe, in which test tissues were hybridized using only buffer lacking the DIG-labeled probe; (2) prehybridization RNase, in which test tissues were treated with RNase for 30 min at 37°C before hybridization; and (3) competition test, in which the same test tissue was treated with FITC-labeled and DIG-labeled M. bovis probes at a ratio of 40:1.

RESULTS

PCR detection of Mycoplasma spp. in the nasopharyngeal tonsils, palatine tonsils, and lungs of pneumonic and control animals

Nested PCR analysis of nasopharyngeal and palatine tonsils showed M. bovis positivity in 5 cases (nos. 1–5). Lung tissues from the same cases tested positive for M. bovis (Table 1). By contrast, samples from control (nos. 6–8) were negative for M. bovis in the nasopharyngeal and palatine tonsils and lungs. Multiplex PCR analysis of the nasopharyngeal tonsils revealed that all pneumonic cases were positive for M. dispar, whereas only nos. 1 and 5 were positive for M. bovirhinis (Table 1). Similarly, palatine tonsil and lung samples from the same animals exhibited PCR positivity for M. dispar in all cases, whereas no cases were positive for M. bovirhinis. In all control cases, nasopharyngeal samples were positive for M. dispar but negative for M. bovirhinis. In no. 6, the palatine tonsil and lung samples were positive for M. dispar, while the lung sample was positive for M. bovirhinis.

Gross findings

A gross investigation of the nasopharyngeal tonsils revealed no significant lesion, but only congestion in no. 4. In all cases, analysis of cut sections revealed that some palatine tonsillar crypts were dilated and filled to varying degrees with yellowish-white necrotic material. In nos. 1–3 and 5, analysis of the lung tissues revealed a cranioventral pattern of caseous necrosis and the formation of abscesses, but no. 4 showed only intrabronchial caseous material without gross abscess formation. Diffuse consolidation was noted in the right and left lungs in no. 4. Thoracic adhesions due to fibrinous pleuritis were found in nos. 1, 2, and 5. Two calves exhibited otitis media (nos. 2 and 5).

Histopathologic and ISH analysis of nasopharyngeal tonsils

Histologically, in the control cases, the normal lining epithelium of nasopharyngeal tonsils is folded, forming multiple invaginations like the intestinal villi (Fig. 1A). These invaginations are lined by a pseudostratified, ciliated columnar epithelium with goblet cells on the nasal side and stratified squamous epithelium on the laryngopharyngeal side. The core of these villi contains primary and secondary lymphoid follicles separated by interfollicular lymphoid tissue, and the epithelium forms crypts surrounded by lymphoid follicles. The pneumonic animals involved in our study were primarily diagnosed with suppurative nasopharyngeal tonsillitis. Epithelial degeneration characterized by multifocal vacuolation, loss of cilia, and occasional cells with increased eosinophilia was observed in the superficial epithelium. In addition, these cases exhibited mild to moderate infiltration of neutrophils and macrophages in the surface epithelium, subepithelium, and crypts (Table 2, Fig. 1B and 1C). In nos. 4 and 5, a small number of crypt lumina exhibited caseonecrotic cellular debris surrounded by macrophages, lymphocytes, and a few neutrophils with occasional calcification (Fig. 1D). Simultaneously, the crypts walls showed noticeable epithelial degeneration of the same type as the surface epithelium. Focal or diffuse goblet cell hyperplasia was also evident in all pneumonic cases.

Fig. 1.

Nasopharyngeal tonsils, cattle. (A) Lower magnification of nasopharyngeal tonsils showing its multiple invaginations, no. 8. Hematoxylin and eosin (HE). Bar, 250 µm. (B) Infiltration of macrophages and neutrophils in the degenerated superficial epithelium, no. 5. HE. Bar, 50 µm. (C) Macrophage infiltration in the crypt wall, no. 1. HE. Bar, 100 µm. (D) Caseonecrotic debris surrounded by inflammatory cells in the crypt lumen, no. 4. HE. Bar, 250 µm. (E) Serial section of (C), showing positive hybridization signals attached to and inside the crypt epithelium and within the infiltrating macrophages. ISH. Bar, 100 µm. Inset, higher magnification of the positive signals within macrophages. Bar, 25 µm. (F) Serial section from (D), showing positive in situ hybridization signals in the caseonecrotic debris. ISH. Bar, 250 µm.

Table 2. Histopathological findings in nasopharyngeal and palatine tonsils of the pneumonic (nos. 1–5) and control (nos. 6–8) calves.

Case no.	Nasopharyngeal tonsils					Palatine tonsils
	Crypts			Surface epithelium*	Subepithelium*	Crypts			Surface epithelium*	Subepithelium*
	Neutrophils and macrophages	Necrosis	Detritus			Neutrophils and macrophages	Necrosis	Detritus
1	1+	-	-	1+	2+	3+	3+	2+	-	-
2	2+	-	-	2+	2+	3+	3+	2+	-	-
3	2+	-	-	2+	1+	1+	1+	3+	-	-
4	2+	1+	-	2+	1+	1+	1+	3+	-	-
5	1+	1+	-	1+	1+	1+	1+	3+	-	-
6	-	-	-	-	-	-	-	1+	-	-
7	-	-	-	-	-	-	-	1+	-	-
8	-	-	-	-	-	-	-	1+	-	-

-, absent; 1+, mild; 2+, moderate; 3+, severe; *, inflammatory cell infiltration.

Positive ISH signals in the nasopharyngeal tonsils were observed on the surface or within the cytoplasm of degenerated epithelial and goblet cells. Moreover, positive ISH signals were observed in the infiltrating neutrophils and macrophages, and luminal necrotic cellular debris present in crypts (Fig. 1E and 1F). The percentage of ISH-positive cells was low (score 1+) in all pneumonic cases (Table 1). The newly designed ISH probe proved reliable for specific testing (Supplementary Fig. 1). Positive hybridization signals appeared as brown-colored reactions both intra- and extracellularly. No specific positive signals were observed in any examined tissues from control animals.

Histopathologic and ISH analysis of the palatine tonsils

The palatine tonsils of control animals appeared as epithelium-lined crypts surrounded by dense clusters of lymphoid follicles (Fig. 2A). The lymphoepithelium of the crypts appeared normal. Some crypts exhibited no inflammatory response and were filled with detritus composed of necrotic materials, including sloughed epithelial cells, non-epithelial cells, bacterial aggregates, and occasionally degenerated neutrophils (Fig. 2B). In the pneumonic animals, in contrast to nasopharyngeal tonsils which lack detritus, moderate to severe detritus was observed in the palatine tonsillar crypts of all cases (Table 2, Fig. 2C). In nos. 3–5, the palatine tonsillar crypts showed mild infiltration with neutrophils and macrophages with mild luminal caseous necrosis, manifested by aggregations of fragmented neutrophils and amorphous granular debris, as well as hyperemic blood vessels in the reticular epithelium. On the other hand, nos. 1 and 2 exhibited degenerative and necrotic changes represented by severe cell swelling, increased cytoplasmic eosinophilia, pyknosis, karyorrhexis, and karyolitic changes in the cryptic epithelium. The lumen of these tonsillar crypts was occluded with caseonecrotic cellular debris surrounded by viable neutrophils, macrophages, and lymphocytes, producing microabscesses (Fig. 2D). Hyperemia also was noted in the blood vessels around the crypts. Calcification was occasionally observed in the context of cryptic detritus and microabscesses. No histologic changes were noted in the surface epithelium and subepithelium in any of the examined cases, opposite to nasopharyngeal tonsil samples.

Fig. 2.

Palatine tonsils, cattle. (A) Tonsils from control animals showing normal lymphoid follicles (F), crypts (Cr), and surface epithelium (Se), no. 7. HE. Bar, 1 mm. (B) Detritus in the crypts of control palatine tonsils, no. 8. HE. Bar, 100 µm. (C) Cryptic detritus with bacterial colonies surrounded by sloughed epithelial cells, no. 5. HE. Bar, 100 µm. (D) Necrosis of the crypt epithelium with luminal caseonecrotic material surrounded by neutrophilic infiltrate, no. 2. HE. Bar, 100 µm. Inset, lower magnification of multiple cryptic micro-abscesses. Bar, 500 µm. (E) Serial section from (C), showing positive extracellular brown signals in the cryptic detritus. ISH. Bar, 100 µm. (F) Serial section of (D), showing necrotic debris and the surrounding neutrophils exhibiting positive in situ hybridization signals. Bar, 100 µm. Inset, lower magnification of multiple cryptic micro-abscesses showing positive in situ hybridization signals. Bar, 500 µm.

The cryptic detritus and micro-abscesses showed clear hybridization signals with the M. bovis probe (Fig. 2E and 2F). Compared with the ISH results of nasopharyngeal tonsils, M. bovis nucleic acids were localized within the crypt epithelium and the infiltrating neutrophils and macrophages, or extracellularly in the necrotic areas and detritus. On the other hand, the positive signals were not seen in the apical side of the surface epithelium in the palatine tonsils, unlike the nasopharyngeal tonsils. Furthermore, in two cases (nos. 1 and 2), the observed ISH-positivity percentage of cells in the palatine tonsils was higher than in the nasopharyngeal tonsils. In the control animals, the cryptic detritus showed no ISH signals for the M. bovis probe.

Histopathologic and ISH analysis of the lungs

Necrotizing fibrino-suppurative bronchopneumonia was diagnosed in nos. 2 and 3. These cases were characterized by cell swelling, loss of cilia, focal hyperplasia, and necrosis of the bronchial epithelium, while the alveolar epithelium showed vacuolation and necrosis, accompanied by a neutrophilic and fibrinous exudate in the lumen. Necrotizing suppurative bronchopneumonia was recorded in nos. 1 and 5, with fibrosis also observed in no. 5 (Fig. 3A and 3B). No. 4 exhibited suppurative broncho-interstitial pneumonia, in which the alveolar wall was thickened due to infiltration of mononuclear cells. Suppurative bronchopneumonia, intrabronchial and bronchiolar caseonecrotic foci, and hyperplasia of peribronchial lymphoid tissue were also observed. In the lung tissues of nos. 1–5, ISH revealed Mycoplasma-positive signals attached to or inside bronchial and bronchiolar epithelial cells and within the intraluminal and alveolar neutrophils and macrophages (Fig. 3C). These ISH-positive inflammatory cells were identified as macrophages and neutrophils. Mycoplasma-positive ISH signals were also observed in the necrotizing areas (Fig. 3D).

Fig. 3.

Lungs, cattle. (A) Suppurative exudate in the bronchial lumen, with bronchial-associated lymphoid tissue hyperplasia, no. 3. HE. Bar, 250 µm. (B) Necrotizing suppurative bronchopneumonia, necrotic centers with suppurative exudate in the surrounding alveoli, no. 1. HE. Bar, 500 µm. (C) Serial section from (A), showing positive in situ hybridization signals attached to the bronchial epithelium and within the luminal neutrophils and macrophages. ISH. Bar, 250 µm. (D) Serial section of (B), showing positive necrotic area and positive infiltrating neutrophils. ISH. Bar, 500 µm. Inset, higher magnification of the positive signals within neutrophils. Bar, 50 µm.

DISCUSSION

In the present study, M. bovis-infected cases exhibited mild to moderate suppurative nasopharyngeal tonsilitis and mild to severe suppurative necrotizing palatine tonsillar cryptitis. Compared with negative controls, the superficial epithelium, subepithelium, and crypts of nasopharyngeal tonsils and crypt walls of the palatine tonsils of pneumonic animals exhibited infiltration of neutrophils and macrophages. Caseonecrotic areas were observed in the nasopharyngeal tonsillar crypts of 2 pneumonic cases, while microabscesses were noticed in the palatine tonsillar crypts of all pneumonic cases in variable degrees. Because ISH enables localization of target organisms within the context of the tissue structure, it is a helpful approach for investigating the etiology of infectious diseases. A DNA probe targeting a portion of the primary vspA gene, conserved across all vsp genes, was developed in a prior successful study of M. bovis in lung tissues of experimentally infected calves [22]. It is also thought that rRNA genes are generally conserved among Mycoplasma spp., making these genes valuable targets in studies of the pathophysiology of Mycoplasma infections [62]. In the present study, ISH-treated tissue sections showed positive signals associated with and/or within the cytoplasm of the degenerated superficial and cryptic epithelium of nasopharyngeal tonsils, palatine tonsillar crypt epithelium, and their invading and luminal inflammatory cells in the pneumonic animals. These results were consistent with those reported by Suwanruengsri et al. [55], who detected positive M. bovis immunohistochemical signals in the crypt epithelium, luminal necrotic material, and involved inflammatory cells in the palatine tonsils of naturally infected Japanese black cattle. We suggest that M. bovis infections are, at least partially, a possible cause of the noted epithelial degeneration and necrosis and the development of nasopharyngeal tonsilitis and palatine tonsillar cryptitis.

The percentage of ISH-positive cells was higher in the palatine tonsils than in nasopharyngeal tonsils in nos. 1 and 2, which showed severe histological alterations. This observation is consistent with the difference in the amount and frequency of cryptic luminal caseonecrosis and detritus observed in both tissues. The nasopharyngeal tonsils’ histological phenotype (pseudostratified ciliated columnar epithelium including lymphoepithelium) was discovered to have well-developed tight junctions, making the barrier function stronger than that of the palatine tonsillar epithelium with a different histological phenotype [40]. Furthermore, the palatine tonsillar crypt reticulated epithelial layer may be thin and devoid of a basement membrane [3]. This would facilitate the interaction between the antigen-presenting cells in cryptic epithelium and M. bovis, inducing an inflammatory reaction [43], usually predominated by macrophages and neutrophils, from which M. bovis can effectively escape [5]. In addition, mucociliary escalators are one feature of the respiratory epithelium [17]. These mucociliary escalators may represent another possible reason why nasopharyngeal and palatine tonsils differ in terms of the severity of lesions.

In our study, goblet cell hyperplasia was a common histological change observed in the nasopharyngeal tonsils of the pneumonic cases. In addition, positive ISH signals adhering to the apical surface and within the cytoplasm of goblet cells were seen. Studies have revealed that goblet cells play multiple defensive roles against invading foreign bodies. Goblet cells can eliminate invading pathogens through non-specific endocytosis, triggering MUC2 secretion and the washing out of invading pathogens [7]. In addition, goblet cells create a mucous barrier consisting of antimicrobial compounds and a distinctive chemical composition useful for bacterial encapsulation and capture [10]. These defensive functions of goblet cells may explain their hyperplastic reaction in pneumonic animals.

Histologically, palatine tonsils are known for their deep crypts where epithelial tissue, inflammatory debris, bacteria, and food can be trapped, supporting detritus formation [29]. In the control and pneumonic animals, some tonsillar crypts showed the buildup of detritus in their lumens with occasional calcification. This detritus exhibited positive hybridization with the M. bovis ISH probe only in pneumonic animals. The extracellular DNA retrieved from necrotic and apoptotic cells during cellular turnover, diseases, and immune responses was identified as a nutritional trigger for M. bovis proliferation and cytotoxicity under cell culture conditions [63]. This led us to suggest that tonsillar detritus may be associated with increased nutrition of M. bovis or other pathogenic bacteria, leading to infection and inflammation. In contrast to palatine tonsils, nasopharyngeal tonsillar crypts have not developed detritus in either control or pneumonic cases.

Infection with M. bovis was detected in the nasopharyngeal and palatine tonsils of pneumonic calves using a nested PCR assay, which also revealed the presence of M. bovis in the lungs of these calves. A recent study using PCR detected M. bovis in 21.1% of nasal swabs from calves with respiratory diseases [32]. Another study suggested that the palatine tonsils act as a secondary reservoir of bacteria for the lung microbiota, including M. bovis [34]. These findings suggest that M. bovis proliferating in the nasopharynx and palatine tonsils can migrate to the lower respiratory tract via inhalation. Furthermore, these results suggest that M. bovis can infect animals in early life. Previous studies have suggested that M. bovis infections are transferred to calves while suckling nursing cows afflicted with M. bovis mastitis, and sick calves can shed Mycoplasma organisms as early as 5 days of age [39].

Of the 5 animals infected with M. bovis in our study, 4 had typical Mycoplasma pneumonia with multiple foci of caseous necrosis. Caseonecrotic bronchopneumonia is a characteristic finding of M. bovis pneumonia in both naturally and experimentally infected calves [20]. These characteristic caseonecrotic lesions were also found in the nasopharyngeal and palatine tonsils of pneumonic animals. This observation suggests the infection descended from these organs to the lungs. The percentage of ISH-positive cells in the pulmonary lesions of diseased animals exhibited some correlation with those detected in the nasopharyngeal and/or palatine tonsils of nos. 1, 3, and 4. On the other hand, nos. 2 and 5 exhibited a higher percentage of positive cells in the pulmonary tissue than those observed in the nasopharyngeal and the palatine tonsils. This difference may be related to the ability of M. bovis to form biofilm, which protects the bacteria against host immune responses and antimicrobials [33], possibly leading to further tissue damage by M. bovis persisting in the pulmonary necrotic lesions, progression of the infection stage, or increased bacterial load.

Multiplex PCR assays detected M. dispar in the nasopharyngeal tonsils of all diseased calves and M. bovirhinis in only nos. 1 and 5. Palatine tonsils and lung tissue from all diseased animals also exhibited positive M. dispar PCR signals, whereas M. bovirhinis was not detected in these tissues. The nasopharyngeal tonsils of the 3 control cases and the palatine tonsils and lungs of no. 6 were positive for M. dispar by PCR, whereas M. bovirhinis was detected only in the lung tissues of no. 6. In the nasopharynx and lungs of both healthy and pneumonia-affected animals, M. dispar is one of the most prevalent members of the microbiota, particularly in the first 6 months of life and post-weaning [34, 58]. Additionally, analysis of nasal swabs from animals with a history of respiratory disease revealed that 11.8% of cases involved M. dispar infection and 10.8% M. bovirhinis [32]. The repeated isolation of M. dispar from animals with BRDC suggests its role in the pathogenesis of BRDC [58]. Furthermore, M. dispar is thought to facilitate tissue invasion by other organisms [36]. Previously, M. dispar has been demonstrated to induce degeneration of respiratory epithelial cells, resulting in the loss of ciliary function and ciliostasis following endotracheal injection [1]. In addition, capsular polysaccharides are important virulence factors of M. dispar responsible for inhibiting alveolar macrophages’ functions for itself and other stimuli [2]. This tissue alterations and immune suppression induced by M. dispar possibly paves the way for M. bovis infection. However, positivity for M. bovirhinis in the nasopharyngeal tonsils was observed in only two M. bovis–infected calves, but the palatine tonsils and lungs were negative. M. bovirhinis is frequently associated with infections caused by M. bovis, P. multocida, M. haemolytica, and H. somni [36]. Previous studies suggest that M. bovirhinis should not be considered a “true” pathogen of BRDC but may have a secondary role in disease [18, 36].

Finally, we conclude that the nasopharyngeal and palatine tonsils represent important primary sites for infection by M. bovis. The invaginated structure of the palatine tonsillar crypts significantly increases the total surface area, which in turn facilitates the direct trapping of antigens entering the oropharynx. However, compared with the nasopharyngeal tonsils, the epithelial lining of the palatine tonsillar crypts is weak, thus increasing the likelihood of invasion of the surrounding tissues by M. bovis. In addition, the deep crypts of the palatine tonsils facilitate the trapping and proliferation of M. bovis in the accumulated detritus, representing bacterial stock capable of inducing infection in certain circumstances. The multiplying M. bovis in the nasopharyngeal and palatine tonsils can migrate to the lower respiratory tract, resulting in bronchopneumonia.

CONFLICTS OF INTEREST

The authors declare no conflicts of interest concerning this article’s research, authorship, or publication.