AMPK/mTOR/ULK1 Pathway Participates in Autophagy Induction by Curcumin in Colorectal Adenoma Mouse Model

ABSTRACT

Colorectal adenoma (CRA) represents a pathological condition characterized by the aberrant development of intestinal epithelial cells and alterations in cellular differentiation within the colorectal mucosal epithelium, posing an increased risk for malignant transformation if not adequately addressed. Curcumin has been shown to exhibit a range of therapeutic effects across various diseases, which motivated this investigation utilizing C57BL/6 mice as a model system. Methodologies including hematoxylin‐eosin staining (HE), western blot analysis, RT‐PCR, immunofluorescence, and electron microscopy were employed to evaluate proteins associated with the AMPK/mTOR/ULK1 signaling pathway. The study specifically examined variations in key autophagy‐related proteins such as Beclin‐1, LC3, P62, alongside intestinal junction proteins Occludin, ZO‐1, and Claudin‐1. This study seeks to elucidate whether curcumin can influence autophagy‐related mechanisms in intestinal mucosal epithelial cells affected by colorectal adenoma to achieve potential therapeutic outcomes.

1. Introduction

Colorectal adenoma (CRA) is a benign neoplasm that develops within the colorectal mucosal epithelium as a result of aberrant differentiation and proliferation of intestinal epithelial cells. While CRA generally lacks specific clinical manifestations, its unchecked progression significantly elevates the risk for malignant transformation; colorectal cancer (CRC) is classified as a malignant tumor and ranks as the third most prevalent cancer worldwide, characterized by high incidence and mortality rates, thus constituting the fourth leading cause of cancer‐related fatalities (Dekker et al. 2019). The pathogenesis of CRC involves an array of complex mechanisms, with the adenomato‐cancer sequence identified as one of the principal pathways contributing to its development—approximately 90% of sporadic CRC cases are believed to arise from CRA (Eng et al. 2022; Harada and Morlote 2020). Current therapeutic strategies for CRA primarily encompass endoscopic mucosal resection and endoscopic mucosal dissection; however, these interventions are associated with considerable recurrence rates following treatment. In terms of pharmacological options for CRA management, there exists a significant gap in safe and effective agents (Saltz 1991). Given the chronic nature of CRA, many patients prefer Chinese herbal medicine due to its favorable safety profile during treatment interventions (Zou et al. 2023; Zhao et al. 2021). Recently, Chinese herbal extracts have attracted increasing attention owing to their multifaceted mechanisms against various cancers and precancerous lesions. Active constituents known as monomers in traditional Chinese herbal formulations serve as foundational elements underlying their therapeutic efficacy. For example, aloe emodin (Cheng and Dong 2018) (an anthraquinone) induces apoptosis through reactive oxygen species‐mediated endoplasmic reticulum stress while influencing cell viability in colorectal carcinoma cell lines such as SW620 and HT‐29; related studies (Shimpo et al. 2014) have also substantiated its chemopreventive effects in murine models exhibiting colorectal tumors. Celastrol (a triterpene) effectively alleviates ulcerative colitis‐associated CRC by inhibiting inflammatory responses alongside azoxymethane‐induced/glucan sulfate sodium (AOM/DSS)‐induced epithelial‐mesenchymal transition (EMT), including suppression of HCT‐116 and HT‐29 cell proliferation (Lin et al. 2016).

Curcumin (CUR) is one of the most widely studied polyphenolic compounds extracted from the rhizome of turmeric (Figure 1). It demonstrates solubility in acetic acid, ketones, bases, and chloroform; however, it remains insoluble in water at both acidic and neutral pH levels. Due to its hydrophobic nature, CUR can traverse cell membranes into the endoplasmic reticulum, mitochondria, and nucleus where it exerts a variety of biological functions (Nelson et al. 2017). Moreover, CUR has exhibited an extensive range of pharmacological benefits, including lipid‐lowering effects, hypoglycemic activity, antimicrobial properties against pathogenic microorganisms, antiviral effects, cardiovascular protective mechanisms, immune modulation capabilities, as well as antioxidant and anti‐dementia activities (Fu et al. 2021). Notably, substantial research has been conducted on its anticancer properties which reveal its ability to inhibit cancer cell proliferation; numerous studies have confirmed that CUR possesses significant anticancer efficacy against breast cancer, lung cancer, hematologic malignancies such as leukemia, gastric cancer, colorectal cancer, pancreatic neoplasms, hepatic carcinoma among other malignancies (Jalili‐Nik et al. 2018). Furthermore, CUR shows potential therapeutic effects in tumor management by modulating various programmed cell death pathways including autophagy, apoptosis, pyroptosis, and ferroptosis (Peng et al. 2022). Researchers have demonstrated that curcumin improves pancreatic cancer outcomes by inhibiting the PI3K/Akt/NF‐κB pathway, reducing ROS and hydrogen peroxide production via SOD, and attenuating EMT in cancer cells (Li et al. 2018). Wang et al. (2024) experimentally validated that CUR could enhance regeneration of atrophic intestinal mucosal epithelial cells via regulation of miR‐195‐3p. Curcumin also exhibits remarkable efficacy in managing colorectal disorders. Liu, Rokavec et al. (2023) substantiated through animal models and cellular assays that curcumin activates the KEAP1/NRF2/miR‐34a/b/c pathway inhibiting tumor progression while suppressing metastasis associated with colorectal cancers. Weng and Goel (2020) conducted a comprehensive literature review revealing that curcumin enhances intestinal alkaline phosphatase activity, upregulates tight junction proteins within intestines, mitigates local inflammation thus reducing genotoxicity within intestinal epithelium, ultimately decreasing incidence rates for both cancers along with lesions. Liu et al. (2013) and Wei et al. (2020) provided experimental evidence demonstrating how curcumin contributes therapeutically towards ulcerative colitis via STATS, Treg/Th17 pathways or ameliorating DSS‐induced ulcerative colitis by balancing oxidative stress, thereby diminishing inflammatory factor release (Arafa et al. 2009).

Figure 1.

The chemical structure of Curcumin.

Research on colorectal adenoma is currently in its early stages and remains largely exploratory. A multitude of studies are dedicated to the prevention and treatment of adenomatous carcinogenesis; for instance, Faux et al. (2022) and Wada et al. (2022) investigate the Wnt signaling pathway to determine whether NSAIDs such as Sulindac, Resveratrol, and Wnt inhibitors can attenuate the inflammatory response associated with colorectal adenomas and impede carcinogenesis. In a similar vein, Liu et al. (2022) explore the PTEN signaling pathway to assess the effects of pharmacological agents on apoptosis in intestinal epithelial cells within colorectal adenomas. Furthermore, additional research has focused on the tumor microenvironment; Grenier et al. (2023) and Liu, You et al. (2023), for example, examine how intestinal microbiota contribute to inflammatory mechanisms involved in cancer transformation both in colorectal adenoma and its malignant progression while utilizing pharmacological or interventionist approaches.

This study presents autophagy—a novel mechanism pertinent to previous investigations—by examining curcumin's influence on AMPK‐mediated autophagy‐related signaling pathways within the intestinal mucosal epithelium of CRA mice.

2. Methods

2.1. Materials

2.1.1. Animals

Forty SPF‐grade male C57BL/6 mice, aged 6 weeks and weighing 20 ± 2 g, were obtained from Beijing SPF Biotechnology Co. Ltd., under animal qualification certificate No. SCXK (Beijing) 2019‐0010. The animals were maintained in the Experimental Animal Center of Hebei Hospital of Traditional Chinese Medicine under strictly controlled conditions: temperature was kept between 22°C and 25°C, relative humidity ranged from 40% to 60%, with a diurnal light cycle of 12 h alternating between day and night; they were provided with standard maintenance rat chow. This study was approved by the Animal Ethics Committee of Hebei Provincial Hospital of Traditional Chinese Medicine (Experimental ethics review approval number: IACUC‐HPHCM‐2024033).

2.1.2. Drugs

Curcumin monomer suspension, batch number wkq23011013, was supplied by Sichuan Vicchi Company.

2.1.3. Main Reagents and Instruments

The primary reagents included HE dye solution set (Servicebio, lot number: G1005); electron microscope fixative (Servicebio, lot number: G1102); anti‐AMPK antibody (sabbiotech, lot No.: 21191); anti‐p‐AMPK antibody (sabbiotech, lot No.: 11183); anti‐mTOR antibody (sabbiotech, Lot No.: 66888‐1‐Ig); anti‐p‐mTOR antibody (sabbiotech, Lot No.: 67778‐1‐Ig); anti‐ULK1 antibody (sabbiotech. Ltd., Batch No.: 20986‐1‐AP); anti‐p‐ULK1 antibody (sabbiotech, Lot No.: 80218‐I‐RR); anti‐Occludin antibody (sabbiotech, Lot No.: 27260‐I AP) ；anti‐ZO‐1 antibody (Sabbiotech, Lot No.: 21773‐I AP); anti‐Claudin‐1 antibody (Sabbiotech, Lot No.: 28674‐I AP); anti‐LC3B antibody (Wuhan Service Biology, Lot No.: GB113801); anti‐Beclin‐1 antibody (Wuhan Service Biology, Lot No.: GB15003); anti‐P62 antibody (Wuhan Service Biology, Lot No.: GB11531); Actin protein (Wuhan Service Biology, Lot No.: GB15003); IL−6, IL−1β, and TNF−α assay kit (Bioswamp, Lot Nos.: MU30044‐48T, MU30369‐48T, MU30030‐48T).

Main instruments included an optical microscope (OLYMPUS model BX43), DYCZ−24DN vertical electrophoresis apparatus from Beijing Liuyi Instrument Factory; VE−386 transfer electrophoresis tank provided by Beijing Yuanpinghao Biotechnology Co.; Type721 visible spectrophotometer sourced from Shanghai Shunyu Hengping Scientific Instrument Co.

2.2. Methods

2.2.1. Animal Grouping, Model Preparation, and Administration

After a 1‐week adaptive feeding period, 40 male C57BL/6 mice were randomly allocated into four groups (Figure 2): the normal group (N), model group (M), low‐dose curcumin administration group (L), and high‐dose curcumin administration group (H), with each group comprising 10 mice. The normal and model groups received an equal volume of 0.9% saline solution, while the group H was administered a suspension of curcumin at a dosage of 100 mg/kg/day, and the group L received a suspension at 50 mg/kg/day. Intragastric administration or saline treatment commenced on the day of model induction and continued for 9 weeks. The colorectal adenoma modeling protocol involved intraperitoneal injection of AOM (10 mg/kg) on the first experimental day; simultaneously, mice had unrestricted access to drinking water containing 3% DSS for 5 days before transitioning to standard drinking water for an additional 16 days. This 3‐week regimen constituted one cycle, which was repeated three times throughout the study duration. After 9 weeks, three mice from the model cohort were randomly euthanized, and their intestinal tissues were excised for histological examination; HE staining was performed to evaluate tissue changes. Successful modeling was confirmed by observing tuberoid‐like protrusions on the surface of intestinal mucosa identified as colorectal adenomas via HE staining analysis. Throughout this investigation, daily monitoring encompassed evaluations of mental state, fur condition, appetite, stool characteristics, alongside biweekly weight assessments.

Figure 2.

A detailed timeline of in vivo experiments was delineated. Azomethane oxide (AOM) was administered through intraperitoneal injection at a dosage of 10 mg/kg, while the sodium dextran sulfate (DSS) group received drinking water containing 3% DSS for a period of 5 days, followed by normal drinking water for an additional 16 days. The other experimental groups were subjected to treatment over three cycles, initially receiving DSS for 5 days and subsequently undergoing curcumin gavage for 16 days. AOM denotes azomethane oxide; DSS refers to dextran sodium sulfate; Cur‐H represents high‐dose curcumin; and Cur‐L indicates low‐dose curcumin.

2.2.2. Specimen Collection

After 9 weeks of pharmacological intervention followed by a 12‐h water deprivation period before anesthesia using intraperitoneal injection of pentobarbital sodium at a concentration of 0.3% (0.05 g/kg), blood samples were collected via ocular puncture into sterile serum separation tubes allowed to clot for 2 h before centrifugation at 3500 rpm for 15 min with a radius set at 10 cm; after collecting the serum for ELISA testing, the next step was to work on the intestinal tissue. The part between the cecum and anus was taken and quickly dissected while staying cold to remove the fat. A long cut was then made along the mesenteric lines inside the intestine. During this process, the adenomas that were found were counted and measured, and the length and weight of the tissue were checked after rinsing it with saline. The sections containing adenomas were fixed in formaldehyde, and a 1 mm³ sample of fresh tissue was excised and subsequently fixed in glutaraldehyde for observation under the electron microscope, while the remaining samples were immediately frozen in liquid nitrogen and stored at −80°C.

2.3. Detection Indicators and Methods

2.3.1. Growth of Mouse Adenoma

Colorectal length and weight were meticulously measured and recorded, while the incidence of intestinal adenomas was documented following the resection of the intestinal cavity.

2.3.2. Serum Levels of TNF‐α, IL‐6, and IL‐1β in Mice Detected by ELISA

Serum levels of TNF‐α, IL‐6, and IL‐1β were quantified using an enzyme‐linked immunosorbent assay (ELISA, Bioswamp), strictly adhering to the manufacturer's operational guidelines.

2.3.3. Histopathological Changes in Mouse Adenoma Observed via HE Staining

Adenoma tissue was fixed in a 4% paraformaldehyde solution for 24 h, followed by dehydration through gradient ethanol series, clearing with xylene, wax impregnation, embedding, and sectioning. Following HE staining procedures, histopathological alterations within the adenoma were examined under an optical microscope at a magnification of 200×.

2.3.4. Expression Analysis of Beclin‐1, LC3, P62, Occludin, ZO‐1, and Claudin‐1 in Mouse Adenoma Tissue via Immunofluorescence Chemistry (IF)

Tissue sections underwent standard dewaxing to water before high‐pressure antigen retrieval using a 3% citric acid solution for 10 min after releasing pressure; subsequently cooled to room temperature with tap water followed by washing with distilled water for 5 min each time before soaking in PBS for one additional minute; then treated with 3% hydrogen peroxide for 20 min before another round of washing in distilled water lasting 5 min before soaking into PBS again; next BSA (5%) was added for incubation at room temperature for half an hour without subsequent washing before adding primary antibody working solution overnight at 4°C; samples were washed three times using PBS buffer solution each lasting 5 min before applying fluorescent secondary antibody incubated at 37°C also lasting 30 min repeating wash steps three times as previously described concluding with DAPI incubation at room temperature lasting 10 min finally rinsed off excess using tap water; nuclei exhibited blue fluorescence while target proteins displayed red or green fluorescence when observed through a fluorescence microscope.

2.3.5. The mRNA Expression Levels of P62 and Beclin‐1 in Murine Adenoma Tissues Were Quantified Using RT‐PCR

Adenoma tissue samples were collected, and total RNA was isolated with TRIzol Reagent. Following this, cDNA synthesis was conducted through reverse transcription for subsequent Real‐time PCR analysis. The reaction conditions comprised an initial denaturation at 95°C for 30 s, followed by denaturation at 95°C for 5 s and annealing at 60°C for 30 s, repeated over a total of 40 cycles to generate the amplification curve. β‐actin was utilized as the internal control, and the expression levels of target genes were calculated using the formula $2^{-\mathrm{\Delta \Delta }t}$. Primer sequences are provided in Table 1.

Table 1.

Primer sequences used for RT‐PCR analysis.

Genes	ID	Primer sequences (5′‐3′)	Product size (bp)
Beclin‐1	56208	Forward primer 5′‐TCAGCCGGAGACTCAAGGT‐3′	76
		Reverse primer 5′‐CACAGCGGGTGATCCACATC‐3′
P62	18412	Forward primer 5′‐GAACTCGCTATAAGTGCAGTGT‐3′	131
		Reverse primer 5′‐AGAGAAGCTATCAGAGAGGTGG‐3′
β‐actin	11461	Forward primer 5′‐GTGACGTTGACATCCGTAAAGA‐3′	245
		Reverse primer 5′‐GCCGGACTCATCGTACTCC‐3′

2.3.6. Western Blot Analysis of Protein Expression Levels of AMPK, mTOR, ULK1, p‐AMPK, p‐mTOR, p‐ULK1, LC3I, LC3II, P62, Beclin‐1, Occludin, ZO‐1, and Claudin‐1 in Mouse Adenoma Tissue

In accordance with the protocol provided by the protein extraction kit, total protein was extracted from adenoma tissue and quantified using a nucleic acid analyzer. A 20 μL aliquot of the protein sample was subjected to boiling for 10 min to facilitate denaturation. Following this, membranes were blocked with 5% skim milk powder at room temperature for 2 h after a transfer duration of 3 h. Subsequently, diluted primary antibody was added and incubated overnight at 4°C. The membranes underwent three washes with TBST before the addition of secondary antibody (1:8000), followed by incubation at room temperature for an additional 2 h, concluding with three further washes in TBST lasting 15 min each. A gel imaging system was utilized to scan and capture images of the samples, enabling analysis of gray values corresponding to target protein bands; β‐actin bands were employed as internal controls. The relative expression levels of AMPK, mTOR, ULK1, p‐AMPK, p‐mTOR, p‐ULK1, LC3I, LC3II, P62, Beclin‐1, Occludin, ZO‐1 and Claudin‐1 were subsequently calculated.

2.3.7. Statistical Analysis

Statistical analyses were conducted using SPSS version 23.0 software. Measurement data are presented as $\overline{\mathrm{x}}\pm s$, adhering to the assumptions of normal distribution and homogeneity of variance. A one‐way ANOVA was performed, followed by the LSD test for intergroup comparisons. In cases where normality and homogeneity of variance were not met, non‐parametric tests were employed. A p value of less than 0.05 was considered statistically significant.

3. Results

3.1. Effects of Curcumin on General Condition and Body Weight of Mice

Compared with group N, no significant changes in body weight were observed in mice from group M during the first to the fifth week. However, significant fluctuations in body weight were noted between the 5th and 9th weeks. Specifically, body weight increased from the 5th to the 6th week but then decreased significantly thereafter. In comparison with group M, the body weight changes of the two groups of mice administered the medication were more gradual. Furthermore, during the latter half of the experiment, the body weights of the medicated mice were consistently higher than those of the mice in group M (Figure 3A).

Figure 3.

(A) The impact of curcumin on body weight regulation in murine models. (B) The impact of curcumin on intestinal morphology. (C) The impact of curcumin on intestinal length, weight, and the incidence of intestinal adenomas in murine models. (D) Impact of curcumin on serum concentrations of TNF‐α, IL‐6, and IL‐1β in murine models. *p < 0.05, **p < 0.01 vs Group M.

3.2. Effects of Curcumin on Colorectal Length, Weight, and Number of Adenomas in Mice

The comparative analysis of colorectal length revealed that, relative to group N, the colorectal lengths in groups M, H, and L exhibited varying degrees of reduction (p＜0.05; p＜0.01), with statistically significant differences identified. Further examination of colorectal weight demonstrated that intestinal weights in groups M, H, and L were significantly lower than those observed in group N, while groups H and L displayed markedly reduced intestinal weights compared to group M. Moreover, the assessment of adenoma counts indicated that both groups H and L had a significantly lower number of adenomas compared to group M (p＜0.05), confirming statistical significance (Figure 3B,C).

3.3. Effects of Curcumin on Serum Levels of TNF‐α, Il‐6, and IL‐1β in Mice

Compared to group N, serum levels of TNF‐α, IL‐6, and IL‐1β were markedly elevated in group M. In contrast, the serum concentrations of TNF‐α, IL‐6, and IL‐1β in the cur‐H and cur‐L groups demonstrated a significant reduction relative to those observed in group M (Figure 3D).

3.4. Effects of Curcumin on the Histopathological Morphology of Mouse Adenomas

HE staining analysis demonstrated that all layers of intestinal tissue in group N displayed distinct structural organization and clear demarcation, characterized by a complete mucosal epithelium. The morphology and architecture of epithelial cells were within normal limits, while the lamina propria was rich in intestinal glands arranged systematically. Staining of the muscularis layer exhibited uniformity, with both morphology and arrangement of muscle fibers appearing normal and orderly. In contrast to group N, the intestinal crypt structure in mice from group M was predominantly intact; however, there was a notable increase in glandular numbers correlating with varying degrees of extension within the intestinal crypts. The configuration of these glands was irregular, exhibiting variability in thickness and shape of glandular cavities as well as discrepancies in cell size among glandular cells. Numerous instances of dysplastic intestinal glands were observed; proliferative glands presented irregular morphologies marked by stratified nuclei at different levels, accompanied by intensified nuclear staining. Furthermore, significant lymphocytic microfocal infiltrates were identified within both the lamina propria and submucosa. When compared to group M, histopathological findings for groups H and L indicated varying degrees of improvement (Figure 4A).

Figure 4.

(A) HE changes in murine models (200×, 400×). (B) Ultrastructural alterations of the colorectal mucosa across all groups.

3.5. Ultrastructural Changes of Colorectal Mucosa in Each Group

The ultrastructural modifications of the colorectal mucosa across all experimental groups were meticulously analyzed using electron microscopy (Figure 4B). In group N, the cells exhibited a highly organized architecture with robust intercellular connections, and both microvilli and apical junction complexes preserved their structural integrity. The double‐layered nuclear membrane was distinctly discernible without significant fusion; mitochondrial swelling was minimal, while the endoplasmic reticulum appeared predominantly normal with occasional mild dilation noted. Conversely, group M demonstrated disorganized cellular arrangements within the colorectal mucosa, characterized by a reduction in goblet cell populations and an absence of villi; microvilli displayed loose configurations, junction complex integrity was compromised, and intercellular connections were notably lax. Importantly, there was an increase in nuclear heterochromatin accompanied by enlarged perinuclear spaces; mitochondrial swelling either diminished or completely resolved; severe expansion of the endoplasmic reticulum occurred alongside a pronounced elevation in autophagosome numbers. When compared to group M, notable improvements in cellular arrangement disorder were observed in group H where tighter cell connections prevailed and structural integrity of microvilli as well as apical junction complexes remained intact; some mitochondria exhibited reduced or absent swelling ridges while others maintained normal morphology; however, substantial expansion of the endoplasmic reticulum persisted alongside observable autophagosomes. Although further enhancements in cellular arrangement disorder were evident in group L relative to group H, it is noteworthy that intercellular connections became less tight once again—nuclear heterochromatin increased further while perinuclear spaces continued to expand; several mitochondria displayed marked swelling with diminished or absent ridges whereas some reverted to normal morphology—the endoplasmic reticulum experienced partial expansion accompanied by visible autophagosomes.

3.6. Effects of Curcumin on AMPK/mTOR/ULK1 Pathway Proteins in Adenoma Tissue From CRA Mice

Compared to group N, the expression levels of P‐AMPK/AMPK proteins in groups M, H, and L were significantly reduced to varying degrees. In comparison with group M, the expression levels of P‐AMPK/AMPK proteins in groups H and L exhibited notable increases (p＜0.05, p＜0.01). Conversely, relative to group N, the expression levels of P‐mTOR/mTOR proteins in groups M, H, and L showed significant elevations across different extents. In contrast to group M, protein expression levels of P‐mTOR/mTOR in both groups H and L were markedly decreased (p＜0.05, p＜0.01). Furthermore, when compared with group N again, the expression levels of P‐ULK1/ULK1 proteins in groups M, H and L were diminished; however, a significant increase was observed for P‐ULK1/ULK1 protein expressions within both groups H and L when compared with group M (p＜0.05), indicating statistical significance (Figure 5A).

Figure 5.

(A) Expression levels of AMPK/mTOR/ULK1 pathway‐related proteins in mouse intestinal tissues $(\overline{\mathrm{x}}\pm s,n=3).$ (B) Expression Levels of Beclin‐1, LC3, and P62 proteins across various experimental groups. (C) A comparative analysis of Beclin1 and P62 mRNA expression levels in the intestinal mucosal tissues of mice across different experimental groups $(\overline{\mathrm{x}}\pm s,n=3).$ (D) Expression Levels of Claudin‐1, Occludin, and ZO‐1 across various experimental groups. *p < 0.05, **p < 0.01 vs Group M.

3.7. Effects of Curcumin on Autophagy‐Related Indices in Adenomas of CRA Mice

3.7.1. Effects of Curcumin on Autophagy‐Related Proteins Beclin‐1, Lc3, and P62 in Adenoma Tissue From CRA Mice

Compared to group N, the expression levels of P62 protein in groups M, H, and L exhibited varying degrees of elevation. In contrast to group M, the expression levels of P62 protein in groups H and L demonstrated a reduction at different extents (p＜0.05; p＜0.01), indicating statistically significant differences. Conversely, when assessed against group N, Beclin‐1 protein expression levels in groups M, H, and L revealed varying degrees of decline. Notably, compared to group M, Beclin‐1 protein expression levels in both H and L groups were significantly elevated (p＜0.05; p＜0.01). Additionally, relative to group N, LC3 protein expression levels across groups M, H, and L showed reductions of various magnitudes; however, when re‐evaluated against group M, LC3 protein expression levels in both H and L groups exhibited increases at differing rates (p＜0.05; p＜0.01), further confirming statistical significance (Figure 5B).

3.7.2. Influence of Curcumin on Beclin‐1 and P62 mRNA Expression in Adenoma Tissue From CRA Mice

Compared to group N, the expression levels of Beclin‐1 mRNA in group M were significantly diminished (p＜0.05, p＜0.01), whereas P62 mRNA expression was substantially elevated (p＜0.05, p＜0.01), indicating a statistically significant difference. In contrast, when comparing group M with the cur‐H and cur‐L groups, Beclin‐1 mRNA levels in mice from these groups exhibited a significant increase (p＜0.05, p＜0.01), while P62 mRNA levels demonstrated a marked decrease (p＜0.05, p＜0.01), both reflecting statistical significance (Figure 5C).

3.7.3. Comparative Analysis of Immunofluorescence Intensity of Beclin‐1, LC3, and P62 Proteins Involved in Autophagy Within Colonic Mucosal Tissues of Mice Across Distinct Experimental Groups

Compared to group N, the fluorescence intensities of Beclin‐1 and LC3 in the colonic mucosal tissues from group M demonstrated a significant reduction, while the intensity of P62 exhibited a notable increase (p＜0.05). In contrast to group M, both Beclin‐1 and LC3 fluorescence intensities were significantly elevated in the colonic mucosal tissues from groups H and L, whereas P62 fluorescence intensity was markedly decreased (p＜0.05) (Figure 6).

Figure 6.

Immunofluorescent analysis of Beclin‐1 (A), LC3 (B), and P62 (C) expression in the intestinal mucosa. *p < 0.05, **p < 0.01 vs Group M.

3.8. Effects of Curcumin on Intestinal Junction Proteins Occludin, ZO‐1, and Claudin‐1 in Mouse Adenoma Tissue

3.8.1. Influence of Curcumin on the Expression Profiles of Intestinal Junction Proteins Occludin, ZO‐1, and Claudin‐1 in Mouse Adenoma Tissue

A comprehensive analysis of the expression profiles of intestinal junction proteins Occludin, ZO‐1, and Claudin‐1 within colon mucosal tissue across all experimental groups (Figure 5D) demonstrated a significant reduction in protein levels for these junctional proteins in group M compared to group N (p＜0.05). Additionally, when assessing variations within group M under different conditions (M), a further decline was observed for these proteins (p＜0.05). In contrast, an upregulation of Occludin, ZO‐1, and Claudin‐1 expression was identified in colonic mucosal tissue from both H and L groups (p＜0.05).

3.8.2. Comparative Analysis of Immunofluorescence Intensity of Occludin, ZO‐1, and Claudin‐1 in Colon Mucosal Tissue Among Different Mouse Groups

In comparison to group N, the fluorescence intensity of Occludin, ZO‐1, and Claudin‐1 in the colonic mucosa of group M exhibited a significant decrease (p＜0.05). Conversely, when compared to group M, the fluorescence intensities of these proteins in the colonic mucosal tissue from groups H and L showed a notable increase (p＜0.05) (Figure 7).

Figure 7.

The expression levels of Occludin (A), Claudin‐1 (B), and ZO‐1 (C) in the intestinal mucosa were assessed through immunofluorescence analysis. *p < 0.05, **p < 0.01 vs Group M.

4. Discussion

Autophagy is a fundamental cellular process characterized by self‐digestion, serving as a critical pathway for the degradation of proteins and organelles. It has extensive associations with various human diseases and physiological mechanisms, playing an indispensable role in maintaining intracellular homeostasis and facilitating diverse cellular functions. Although autophagy primarily acts as a protective mechanism for cells, it can also participate in programmed cell death (Mizushima and Levine 2008).

In the exploration of signaling pathways related to autophagy, vps34 activation modulates Beclin‐1's function within this context. The initiation phase of autophagy requires the formation of phagocytic vesicles, which involves two essential protein complexes: the vps34 complex and the ULK1 complex; the latter is pivotal for both phagocytic vesicle formation and autophagosome biogenesis (Liu, Yao et al. 2023). The elongation of these vesicles is crucial for establishing their bilayer membrane structure, wherein the Atg5‐Atg12‐Atg16L complex facilitates outer membrane extension while contributing to precursor membranes involved in autophagic processes; notably, Atg16L1 serves as an early marker for detecting nascent autophagosomes (Glick and Barth 2010). During membrane assembly within autophagic structures, LC3 undergoes processing through ATG8 induction, leading to its conversion into LC3‐I. Subsequently, LC3‐I is activated by Atg7 and conjugated with phosphatidyl‐ethanolamine (PE) on membranes to generate processed LC3‐II; this modified form is recruited to expanding phagocytic vesicles. Consequently, LC3‐II serves as a reliable biomarker for monitoring cellular levels of autophagy (Fésüs et al. 2011). Furthermore, p62 plays a significant role during degradation processes by linking with both LC3 and ubiquitinated substrates before being integrated into autophagosomes, where it undergoes lysosomal degradation. Upon activation of autophagy, fusion occurs between the autophagosome and lysosome resulting in decreased levels of P62 following enzymatic breakdown within lysosomes—fluctuations in P62 concentrations thus serve as indicators regarding whether normal autophage activity persists. This study further elucidates alterations in these key proteins; compared with control groups, variations observed in markers such as Beclin‐1, LC3, and P62 among model groups suggest that intestinal mucosal epithelial cells from CRA mice exhibit dysregulated autophage mechanisms incapable of inhibiting abnormal cell proliferation and differentiation.

Adenosine monophosphate‐activated protein kinase (AMPK) is a highly conserved energy sensor that plays a crucial role in the pathogenesis of cardiovascular, neurodegenerative, and inflammatory diseases, as well as cancer and metabolic disorders (Sun et al. 2017). AMPK activation enhances paracellular junction integrity, nutrient transporter functionality, autophagy, and apoptosis; it concurrently inhibits intestinal inflammation and carcinogenesis while significantly promoting intestinal health through the regulation of tight junction expression, antimicrobial peptides, and secreted immunoglobulins. Moreover, AMPK is integral to the maintenance of both the intestinal mechanical barrier and immune barrier.

AMPK is involved in key signaling pathways such as AMPK/mTOR/ULK1—one of the principal pathways regulating autophagy. The phosphorylation of various sites on ULK1 by activated AMPK leads to the formation of an AMPK/ULK1 complex that facilitates downstream autophagic pathway activation. The autophagy‐promoting enzyme ULK1 interacts with Beclin‐1 to enhance the upregulation of downstream proteins, including P62 and Atg5 along with other related factors, thereby activating autophagy and modulating the nucleation process of autophagosomes. Furthermore, variations in mTOR‐related proteins impact the interaction between AMPK and ULK1—a pivotal element for integrating metabolic signals with growth factors into regulatory mechanisms governing levels of autophagy (Suvorova and Pospelov 2019). Both AMPK and additional modulators are implicated in orchestrating changes within the autophagic processes occurring in intestinal mucosal epithelial cells.

Numerous studies have substantiated the role of the AMPK pathway in the management of colorectal diseases. For example, Bu et al. (2020) elucidated that rhabdoside promotes autophagy in colon cancer cells through modulation of the AMPK/mTOR/ULK1 signaling cascade, suggesting that pharmacological interventions targeting this pathway may effectively inhibit excessive proliferation of colorectal cancer tissues. Sun et al. (2024) explored the mechanisms associated with AMPK deficiency using Caco‐2 cell lines and animal models, revealing that a deficit in AMPK accelerates colorectal cancer (CRC) progression. The influence of AMPK on colorectal pathologies extends beyond its role in autophagy; it also plays a critical part in maintaining intestinal barrier integrity within colonic mucosae. The inactivation of AMPK is posited to contribute to intestinal dysfunction (Wu et al. 2022). Effective repair processes for intestinal mucosal injuries require coordinated proliferation, migration, and differentiation of epithelial cells alongside specific nutritional support strategies. Activation pathways can be harnessed to provide essential nutrients necessary for preserving intestinal mucosal barrier function. A plethora of studies indicates that activation of AMPK positively modulates mechanical barriers within the intestine by enhancing both assembly and expression levels of tight junction proteins. Olivier et al. (2019, 2022) and Wu et al. (2022) demonstrated that loss of AMPK exacerbates inflammatory bowel disease progression; however, subsequent treatment with AMPK activators resulted in significant improvements in mucosal repair and epithelial regeneration following injury events. Through cellular experiments and animal studies employing both AMPK inhibitors and activators, researchers have highlighted the pivotal role played by AMPK in facilitating tight junction reassembly after disruption to the intestinal epithelial barrier.

This study employed AMPK as a central focus to elucidate its associated pathways. The results demonstrated not only the alterations in indices of the AMPK, mTOR, and ULK1 pathways across various groups but also underscored changes in autophagy‐related markers such as Beclin‐1, P62, and LC3, alongside indices related to intestinal connective tissue. Comparative analyses between the normal group and model group, as well as between the model group and treatment group, indicated that curcumin may modulate autophagy processes within the intestinal mucosal epithelium and barrier in colorectal adenoma through the AMPK‐dependent pathway. Nevertheless, this investigation did not thoroughly explore the complex interplay between the AMPK pathway and the intestinal barrier; thus, it opens new avenues for further research into mechanisms underlying colorectal adenoma.

5. Conclusion

Curcumin significantly enhances autophagy in colorectal adenoma cells and promotes the restoration of the intestinal mucosal barrier through modulation of the AMPK/mTOR/ULK1 signaling pathway. This finding provides critical insights into potential therapeutic strategies for colorectal adenomas and clarifies the advantageous effects of curcumin. Therefore, curcumin represents a promising candidate for both prevention and intervention in colorectal adenomas, as well as their possible progression to cancer.

Author Contributions

Yuge Wang and Qian Yang conceptualized the study design. Yuge Wang and Moxixuan Liu conducted the animal experiments and prepared the manuscript. Yuge Wang and Yao Du undertook data collection and analysis. Xuemei Jia offered expertise in image selection. The manuscript was critically revised by Yuge Wang, Xuemei Jia, and Yao Du, with Qian Yang providing oversight throughout the review process. The final version of the manuscript received a comprehensive evaluation from all authors.

Ethics Statement

All experimental protocols were in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health and were approved by the Animal Ethics Committee of First Affiliated Hospital of Hebei University of Traditional Chinese Medicine. Additionally, all animals were handled humanely during the study protocol and during euthanasia.

Consent

Consent for publication was obtained from the participants.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article and its supporting materials.