Canagliflozin ameliorates high-salt-induced renal injury and premature aging in male Dahl salt-sensitive rats, with associated changes in SIRT6/HIF-1α signaling

Abstract

Sodium–glucose cotransporter 2 inhibitors (SGLT2is) exhibit renoprotective effects in diabetic and nondiabetic patients; however, the underlying mechanism remains unclear. This study aimed to investigate the effects of canagliflozin (an SGLT2i) on salt-sensitive hypertensive kidneys. Male Dahl salt-sensitive rats were fed a high-salt (8%) diet and then orally administered canagliflozin 30 mg/kg/day or 0.5% hydroxypropyl methylcellulose solution for 12 weeks. Thus, a high-salt-induced model of hypertensive kidney injury with premature aging was established to evaluate the protective effects and related mechanisms of canagliflozin on hypertensive kidneys. Canagliflozin reduced blood pressure, the serum creatinine concentration, and urinary albumin excretion in high-salt rats. Hematoxylin and eosin, Masson, and senescence-associated β-galactosidase (staining were performed on rat kidneys, revealing that canagliflozin alleviated renal fibrosis and premature aging. Immunohistochemical analysis and protein detection demonstrated that canagliflozin increased the expression of silent information regulator 6 (SIRT6) in the kidney, inhibited the expression of the hypoxia-inducible factor-1 alpha (HIF-1α) protein and its target genes, and alleviated kidney damage and premature aging. In summary, canagliflozin ameliorates renal injury and premature aging in male Dahl salt-sensitive rats fed high salt with associated changes in SIRT6/HIF-1α signaling.

1. Introduction

Arterial hypertension is a key contributor to the pathogenesis of chronic kidney disease (CKD) [1,2]. Hypertension is closely associated with both CKD and premature renal senescence [3]. Renal aging is characterized by nonspecific morphological and functional changes, including reduced kidney volume, loss of intact glomeruli, glomerulosclerosis, interstitial fibrosis, a decreased glomerular filtration rate (GFR), disorders of sodium and potassium excretion, and increased oxidative stress [4]. Urine proteomic analysis in humans has revealed a significant overlap between the molecular signatures of renal aging and CKD [5].

Currently, human sodium intake exceeds the recommended daily allowance. Excessive sodium consumption is directly linked to hypertension [6], with approximately 50% of hypertensive patients exhibit salt-sensitive hypertension [7]. Although the underlying pathogenesis of salt-sensitive hypertension remains undefined, numerous studies have implicated the kidney as a critical organ in regulating this condition [8]. High-salt intake induces premature renal senescence. Emerging evidence shows that excessive sodium promotes progressive renal fibrosis, accompanied by cellular senescence, extracellular matrix (ECM) accumulation, and immune cell infiltration [7].

Persistent blood pressure elevation in patients with essential hypertension is associated with premature vascular aging [9]. Both in vitro and in vivo studies have demonstrated that SGLT2is ameliorate multiple pathological processes associated with kidney disease progression, including inflammation, endothelial dysfunction, mitochondrial damage, fibrosis, and cellular senescence [10]. As a representative SGLT2i, canagliflozin has been shown in previous studies to exert organ-protective effects in both diabetic and nondiabetic contexts. However, no study to date has investigated the impact of canagliflozin on high-salt diet-induced premature kidney failure.

SIRT6 belongs to the nicotinamide adenine dinucleotide (NAD⁺)-dependent class III histone deacetylase (HDAC) family and serves as a conserved regulator of aging and cardiovascular diseases. SIRT6 activity is elevated in long-lived species, and this enzymatic activity correlates with lifespan [11]. SIRT6 deficiency shortens the lifespan of mice. SIRT6 is also implicated in hypertensive nephropathy in both humans and mice [12].

HIF-1α and its target genes mediate diverse biological and pathological processes, including fibrosis, angiogenesis, cell proliferation, erythropoiesis, metabolic reprogramming, inflammation, and apoptosis, thereby exacerbating target organ damage and senescence [13]. SIRT6 deficiency in endothelial cells leads to HIF-1α accumulation and histone H3 lysine 9 (H3K9) acetylation at the endoplasmic reticulum oxidoreductin 1α (Ero1α) promoter, thereby exacerbating oxidative stress. The SIRT6/HIF-1α axis regulates podocyte pyroptosis in diabetic nephropathy [14]. Thus, we investigated whether canagliflozin ameliorates high-salt-induced renal injury and premature aging using the SIRT6/HIF-1α axis.

Dahl salt-sensitive rats exhibit phenotypic similarities to high-risk clinical populations, including marked increases in blood pressure, kidney disease progression, and dietary salt sensitivity [15]. In this study, Dahl salt-sensitive rats were fed a high-salt diet to establish a model of renal injury with premature aging, with the aim of investigating the mechanism by which SGLT2is ameliorate renal function.

2. Materials and methods

2.1. Animals

A total of 21 male Dahl salt-sensitive rats (5–6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co. and housed in the specific pathogen-free facility of the Animal Experiment Center, Hebei General Hospital. After one week of adaptation, 21 rats were randomly divided into three groups [1]: the high-salt diet (HSD) group (n = 7), which was fed an irradiated AIN-76A diet supplemented with 8% NaCl to induce hypertension and renal injury [2]; the normal-salt diet (NSD) control group (n = 7), which was fed an irradiated AIN-76A diet containing 0.3% NaCl; and [3] the HSD + canagliflozin (CANA) intervention group (n = 7) [16]. The rats had free access to food and water, and the bedding in their cages was changed daily. Canagliflozin was dissolved in 0.5% hydroxypropyl methylcellulose. The HSD + CANA group received oral gavage of canagliflozin at 30 mg/kg/day, whereas both the HSD and NSD groups were administered 0.5% hydroxypropyl methylcellulose vehicle (5 mL/kg/day) for 12 weeks. During the experiment, the weight, food intake, mental state, physical signs, blood pressure values, etc., of the rats were recorded. The experimental flowchart is shown in Figure 1. This animal study was approved by the Animal Ethics Committee of Hebei General Hospital (Approval No. 202383) and adheres to international laboratory animal care and use guidelines.

Figure 1.

Flowchart of the animal experiment.

2.2. Blood pressure measurement

Following a 1-week adaptation period, tail artery blood pressure in Dahl-SS rats was monitored using a tail sphygmomanometer (BP-2000, Visitech Systems, Inc., USA). Given that the tail-cuff method reliably estimates only systolic blood pressure (SBP), only SBP data were recorded. Blood pressure was measured weekly, with the average calculated from six valid readings.

2.3. Plasma and urine collection

Urine was collected from the rats in metabolic cages over a 24-h period during ad libitum feeding and drinking, one week prior to the termination of the experiment. The rats were fasted overnight the day before the experiment was terminated. At the end of the experiment, the rats were anesthetized by an intraperitoneal injection of 3% sodium pentobarbital (30 mg/kg). The skin was disinfected with 75% ethanol before injection into the left lower abdomen (1 cm from the midline, 2 cm above the pubic symphysis). Deep anesthesia was confirmed by the absence of a pain response and bilateral corneal reflexes, along with decreased and stable respiratory and heart rates. A midline laparotomy was then performed, and blood was collected from the abdominal aorta into tubes. Immediately after blood collection, an overdose of sodium pentobarbital (70 mg/kg) was administered using the original route until cardiac arrest was confirmed (monitored for 3 min). The blood was allowed to clot at room temperature for 30 min and then centrifuged at 3000 × g for 10 min, after which the supernatant was aliquoted into Eppendorf tubes, labeled, and stored at −80 °C. Serum albumin, blood urea nitrogen (BUN), cystatin C, creatinine, and sodium were measured using an automatic biochemical analyzer. Random urine samples were tested for glucose, protein, sodium, and creatinine. The heart, liver, lungs, spleen, and kidneys were harvested, weighed, and processed.

2.4. Kidney histology

Kidneys were collected and washed with ice-cold sterile normal saline solution and then fixed in 4% paraformaldehyde for 12 h at 4 °C. Serial sections (5 μm thickness) were stained with H&E. For collagen detection, the sections were stained with Masson’s trichrome and washed with acidified water before being dehydrated. The slides were visualized under a light microscope (Ni-U model eclipse; Nikon, Tokyo, Japan) with cellSens image acquisition software (Olympus, Tokyo, Japan). The levels of collagen and elastic fibers were quantified by the ImageJ analysis system.

2.5. Senescence-associated β-galactosidase staining

To prepare SA-β-gal-stained tissues, fresh renal tissue samples were fixed overnight in 30% sucrose and subjected to cryoprotection. The samples were frozen in OCT compound and sliced into 4 μm sections. The tissue slices were incubated overnight in SA-β-galactosidase staining solution at 37 °C and then counterstained with nuclear fast red. ImageJ software was used to analyze the proportion of SA-β-gal-positive kidney tissues.

2.6. Western blot analysis

Kidneys were homogenized in extraction buffer [composition in mM: Tris/HCl 20 (pH 7.5), NaCl 150, Na₃VO₄ 1, Na₄P₂O₇ 10, NaF 20, okadaic acid 0.01, 1% Triton X-100, and protease inhibitor cocktail (Complete Mini, Roche)]. Total proteins (15 μg) were separated by 10% SDS–PAGE and electrophoretically transferred onto a nitrocellulose membrane (GE Healthcare Life Sciences). After being blocked with 5% bovine serum albumin in Tris-buffered saline (TBS) containing 0.1% Tween 20 for 1 h at room temperature, the membranes were incubated overnight at 4 °C with the following primary antibodies: rabbit monoclonal anti-SIRT6 (1:2000, Abcam, ab191385), rabbit polyclonal anti-p53 (1:5000, Proteintech, 10442-1-AP), rabbit polyclonal anti-p21 (1:1000, Proteintech, 10355-1-AP), rabbit polyclonal anti-HIF-1α (1:1000, Affinity, AF1009), rabbit polyclonal anti-collagen IV (1:1000, Bioss, bs-4595R), rabbit monoclonal anti-αSMA (alpha smooth muscle actin, 1:1000, Zenbio, R380653), rabbit monoclonal anti-α-tubulin (1:10,000, Servicebio, GB11200-100), and mouse monoclonal anti-β-actin (1:10,000, Abcam, ab8226). After washing, the membrane was incubated with goat anti-mouse and goat anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibodies (diluted 1:5000) at room temperature for 1 h. Protein detection was performed using an ECL system, followed by analysis with ImageJ software.

2.7. Quantitative real-time polymerase chain reaction (RT–PCR)

Briefly, total RNA was extracted from kidney tissues using TRIzol reagent (Takara, Japan) according to the manufacturer’s protocol. Two micrograms of total RNA was reverse transcribed into cDNA using a PrimeScript^™ RT reagent kit (TakaRa, Japan). The specific sequences of the primers used for the reactions are listed in Table 1. These include heme oxygenase-1 (HMOX-1), B-cell lymphoma-2 (BCL-2), vascular endothelial growth factor (VEGF) and tissue inhibitor of metalloproteinases-1 (TIMP-1). The PCR conditions were set as follows: 95 °C for 30 s (initial denaturation), followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. RT–PCR was performed using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA) with SYBR Green Real-time Master Mix (Toyobo, Japan). Relative mRNA expression was analyzed by the ΔΔCT method and normalized to β-actin expression [17].

Table 1.

Primer sequences used in real-time PCR.

Gene	Primer	Sequence (5′–3′)
Rat HIF-1α	F	ACCGTGCCCCTACTATGTCG
	R	GCCTTGTATGGGAGCATTAACTT
VEGF	F	GCACTGGACCCTGGCTTTACT
	R	AACTTCACCACTTCATGGGCTTT
HOMX-1	F	CACAGGGTGACAGAAGAGGCT
	R	TCTGTGAGGGACTCTGGTCTTTG
BCL-2	F	CATGTGTGTGGAGAGCGTCAA
	R	CAGCCAGGAGAAATCAAACAGA
TIMP-1	F	AATGCCACAGGTTTCCGGTT
	R	TTCCGTTCCTTAAACGGCCC
β-actin	F	TGCTATGTTGCCCTAGACTTCG
	R	GTTGGCATAGAGGTCTTTACGG

2.8. Immunohistochemical analysis

All the tissues were fixed in 4% formaldehyde, embedded in optimal cutting temperature compound, and cut into 7 μm sections. The tissue sections were subsequently blocked with normal goat serum for 1 h at room temperature and then incubated with specific antibodies. The antibodies used for rat tissues included rabbit monoclonal anti-SIRT6 (1:1000, Abcam, ab191385), rabbit polyclonal anti-p53 (1:800, Proteintech, 10442-1-AP), rabbit polyclonal anti-p21 (1:5000, Proteintech, 10355-1-AP), rabbit polyclonal anti-HIF-1α (1:100, affinity, AF1009), and rabbit monoclonal anti-αSMA (alpha smooth muscle, 1:1000, Zenbio, R380653) antibodies. Then, the sections were incubated with the appropriate secondary antibodies. Staining was visualized using the Dako Cytomation Envision HRP system, followed by counterstaining with hematoxylin. Images were collected with an upright light microscope (Olympus, Tokyo, Japan) at 20× magnification.

2.9. Statistical analysis

All the data are presented as the means ± SDs. Differences between groups were compared with one-way ANOVA by the statistical software programs SPSS 27.0 and Prism 8.0. When the variances were combined, the least significant difference (LSD) test was used. Alternatively, Dunnett’s T3 test was applied. A p value < 0.05 was regarded as statistically significant in all analyses.

3. Results

3.1. Comparison of the results of food intake, water intake, urine output, body weight, and organ mass/tibia length among the three groups of rats after 12 weeks

High salt led to an increase in water intake and urine output in rats, as well as an increase in the mass of organs such as the heart and lungs. We found that the kidney weight-to-tibial length ratio and the urine albumin-to-creatinine ratio were increased in the HSD group. After treatment with canagliflozin, the weight of the organs was reduced, attributed to its diuretic effects, which promoted weight loss (Table 2).

Table 2.

Effects of canagliflozin on different organs, body weights, and serum and urine biochemical indicators after 12 weeks of treatment.

	NSD	HSD	HSD+CANA
Food intake (g/24 h)	18.21 ± 1.29	18.47 ± 1.14	23.79 ± 0.91##
Water intake (ml/24 h)	32.43 ± 2.82	90.29 ± 8.84**	171.00 ± 13.80##
Urine volume (ml/24 h)	14.29 ± 2.56	54.86 ± 4.74**	110.29 ± 6.15##
Heart (mg mm−1)	19.82 ± 0.66	27.65 ± 2.52**	21.35 ± 1.23##
Left kidney (mg mm−1)	22.59 ± 1.74	29.75 ± 2.37**	26.74 ± 1.47#
Right kidney (mg mm−1)	22.08 ± 1.97	29.19 ± 2.17**	25.88 ± 1.49#
Liver (mg mm−1)	159.78 ± 13.38	172.59 ± 11.08*	156.66 ± 7.27#
Spleen (mg mm−1)	14.69 ± 1.35	17.12 ± 2.76*	16.44 ± 1.38
Left lung (mg mm−1)	9.86 ± 0.55	11.51 ± 0.59**	10.13 ± 0.30##
Lung, all 3 lobes (mg mm−1)	27.90 ± 2.51	33.53 ± 1.24**	28.33 ± 0.78##
Tibial length (mm)	58.00 ± 1.00	55.29 ± 1.25**	56.43 ± 0.79
Body weight (g)	369.00 ± 9.76	328.00 ± 12.78**	296.71 ± 10.34##
Serum creatinine (μmol/l)	56.60 ± 13.96	154.15 ± 26.85***	100.13 + 12.41###
Serum urea nitrogen (mg/l)	0.46 ± 0.14	4.23 ± 1.96***	1.57 ± 0.63###
Serum sodium (mmol/l)	105.86 ± 11.18	108.04 ± 11.89	104.31 ± 10.30
Serum albumin (g/l)	44.53 ± 8.60	36.71 ± 7.20	38.94 ± 6.60
Serum cystatin C (μg/l)	7.91 ± 0.69	12.80 ± 1.83***	9.14 ± 0.40###
Urine sodium (mmol/l)	21.18 ± 2.48	183.26 ± 12.21***	131.72 ± 15.00###
Urine glucose (mmol/l)	0.55 ± 0.23	0.45 ± 0.28	44.54 ± 8.05###
Urine albumin/creatinine	0.19 ± 0.08	1.72 ± 0.47***	0.52 ± 0.13###
Urine glucose (mmol/24 h)	7.49 ± 2.61	24.08 ± 13.82	4885.85 ± 728.28###
Urine albumin (mg/24 h)	2.01 ± 0.66	91.54 ± 22.77***	54.08 ± 4.62###

NSD: normal salt Dahl salt-sensitive rats; HSD: high salt Dahl salt-sensitive rats; HSD + CANA: high salt Dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. HSD vs. HSD + CANA: ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001 (n = 7).

3.2. A high-salt diet led to increases in the systolic blood pressure of rats, whereas canagliflozin reduced blood pressure

At the beginning of the experiment, there was no significant difference in systolic blood pressure among the three groups of rats. At week 4, compared with the NSD group, the HSD group presented a statistically significant increase in systolic blood pressure (p < 0.05). Compared with the HSD group, the HSD + canagliflozin group showed a statistically significant decrease in systolic blood pressure after canagliflozin treatment (p < 0.05) (Figure 2).

Figure 2.

Changes in blood pressure over time in the three groups of rats. NSD: normal salt dahl salt-sensitive rats; HSD: high salt dahl salt-sensitive rats; HSD + CANA: high salt dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05. HSD vs. HSD + CANA: #p < 0.05 (n = 7).

3.3. A high-salt diet induced kidney damage and fibrosis in rats, whereas canagliflozin alleviated these lesions

Compared with those in the NSD group, the rats in the high-salt diet group developed renal glomerular atrophy and tubular degeneration (Figure 3 A–G), whereas the use of canagliflozin reduced both glomerular and tubular lesions. Renal fibrosis was observed through Masson’s trichrome staining, and the high-salt group showed significant renal fibrosis, with collagen fibers stained bright blue. However, after canagliflozin treatment, fibrosis was reduced (Figure 3C), and the difference was statistically significant (p < 0.01, Figure 3H). The extracellular matrix proteins collagen IV and α-SMA are markers of renal fibrosis. The HSD group showed significantly elevated expression of collagen IV and α-SMA proteins, but their levels decreased after the use of canagliflozin (p < 0.05, Figure 3I–K).

Figure 3.

Representative images of HE staining, masson’s trichrome staining, and fibrotic protein expression in the kidneys of the three groups of rats. A. Representative HE staining of the glomeruli of the three groups of rats. A indicates glomerular atrophy, B indicates vascular sclerosis, C indicates vacuolar degeneration of renal tubules, D indicates recruitment of inflammatory cells. B. Representative HE staining of the renal interstitium. C. Representative masson’s trichrome staining of the kidney. Magnification, ×100; scale bar, 100 μm. D. Ratio of glomerular atrophy. E. Long diameter of the glomeruli. F. Transverse diameter of the glomeruli. G. Renal tubular injury score. H. Positive area of renal staining (H indicates glomerulosclerosis). I–K. Measurement of collagen-IV and α-SMA protein levels. NSD: normal salt dahl salt-sensitive rats; HSD: high salt dahl salt-sensitive rats; HSD + CANA: high salt dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. HSD vs. HSD + CANA: #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 (n = 5 or 6).

3.4. The SA-β-gal positive rate increased in rats in the high-salt group, and the expression of senescence-related proteins also increased: the use of canagliflozin inhibited these changes

Senescent cells exhibit characteristics that differ from those of normal cells. An indispensable marker of senescent cells is stable cell cycle arrest. In addition, there is an increase in the proportion of cells positive for SA-β-gal activity. It is the most extensively used biomarker to identify senescent cells both in vitro and in vivo [18]. The protein expression of p53 and p21 are also significantly increased in senescent cells [19].

In this study, in the kidney, SA-β-gal was predominantly localized in the proximal and distal tubules of the renal cortex (Figure 4A). The proportion of SA-β-gal-positive cells in the renal cortex was greater in HSD rats than in NSD rats (p < 0.01, Figure 4C). The SA-β-gal positive rate decreased in the group treated with canagliflozin (p < 0.01, Figure 4C). P53 and P21 protein expression in the kidneys of HSD group rats was significantly increased (p < 0.01, Figure 4B), whereas P53 and P21 protein expression was significantly decreased after canagliflozin treatment (p < 0.05, Figure 4D, F).

Figure 4.

Representative images of senescence-associated β-galactosidase (SA-β-gal) staining and the expression of aging-related proteins in the kidneys of the three groups of rats. A. Renal SA-β-gal staining. Magnification, ×200; scale bar, 50 μm. B. Expression of the aging-related proteins P53 and P21 in the kidneys. C. SA-β-gal-positive area in rat kidneys (n = 4). D. P53 protein expression. E. P21 protein expression. (D, E, n = 6). NSD: normal salt dahl salt-sensitive rats; HSD: high salt dahl salt-sensitive rats; HSD + CANA: high salt dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. HSD vs. HSD + CANA: #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001.

3.5. Canagliflozin upregulated the depletion of SIRT6 caused by high salt and downregulated the expression of HIF-1α and its downstream target genes

The SIRT6/HIF-1α axis plays an important role in regulating aging. Therefore, we measured the expression of SIRT6 and HIF-1α in the kidneys of the three groups of rats. We found that in the HSD rats, SIRT6 expression was significantly lower than that in the NSD group (p < 0.01), whereas HIF-1α expression was significantly increased (p < 0.01). However, after treatment with canagliflozin, SIRT6 expression increased (p < 0.05) and HIF-1α expression decreased (p < 0.05) (Figure 5A–C).

Figure 5.

Changes in the SIRT6/HIF-1α axis after canagliflozin therapy. A. Changes in SIRT6 and HIF-1α protein expression in the kidneys. B. Expression of the SIRT6 protein. C. Expression of the HIF-1α protein (B, C, n = 6). D. Expression of HIF-1α mRNA. E. Expression of HO-1 mRNA. F. Expression of BCL-2 mRNA. G. Expression of TIMP-1 mRNA. H. Expression of VEGF mRNA (D–H, n = 5). NSD: normal salt dahl salt-sensitive rats; HSD: high salt dahl salt-sensitive rats; HSD + CANA: high salt dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. HSD vs. HSD + CANA: #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001.

SIRT6 and HIF-1α are both nuclear proteins, and multiple studies have confirmed that HIF-1α and SIRT6 do indeed interact with each other [20]. Next, we investigated whether the reduction in HIF-1α protein expression is regulated at the transcriptional or protein level. By measuring HIF-1α mRNA via RT–PCR, we found that, compared with the canagliflozin group, there was no significant increase in HIF-1α mRNA in the HSD group (Figure 5D). Therefore, we believe that SIRT6 regulates HIF-1α at the protein level rather than at the transcriptional level. This finding is consistent with previous research [21]. To investigate the effect of canagliflozin on HIF-1α target genes, we used RT–PCR to measure the expression of HIF-1α target genes in the kidney [22]. The results revealed that the expression of HIF-1α target genes increased in the HSD group, whereas the expression of HIF-1α target genes decreased after treatment with canagliflozin (Figure 5E–H). Therefore, canagliflozin may alleviate high salt-induced renal aging and fibrosis in Dahl salt-sensitive rats through the SIRT6/HIF-1α axis.

3.6. Immunohistochemical results of the three groups of rats

The immunohistochemical results for the rat kidney were consistent with the Western blot results. As shown in Figure 5, both SIRT6 and HIF-1α were expressed in the nucleus. The expression of SIRT6 decreased in the HSD group (p < 0.001) but increased after canagliflozin treatment (p < 0.05) (Figure 6A). Moreover, the HIF-1α protein level increased as the level of SIRT6 decreased (Figure 6B). The expression of the fibrosis marker α-SMA increased in the HSD group (p < 0.01), and its expression decreased after canagliflozin treatment (p < 0.05) (Figure 6C). The cyclin proteins P53 and P21 are aging-related proteins. The expression of these proteins increased in the HSD group (p < 0.01) but decreased after canagliflozin treatment (p < 0.01) (Figure 6 D, E).

Figure 6.

Immunohistochemical results of the three groups of rats. A. Representative image of SIRT6 in the kidney. B. Representative image of HIF-1α in the kidney. C. Representative image of α-SMA in the kidney. D. Representative image of P53 in the kidney. E. Representative image of P21 in the kidney. Magnification, ×200; scale bar, 20 μm. NSD: normal salt dahl salt-sensitive rats; HSD: high salt dahl salt-sensitive rats; HSD + CANA: high salt dahl salt-sensitive rats + canagliflozin (30 mg/kg/day). HSD vs. NSD: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. HSD vs. HSD + CANA: #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 (n = 6).

4. Discussion

In our study, we observed that Dahl salt-sensitive rats fed a high-salt diet developed markedly elevated blood pressure, which was concurrent with kidney damage. Pathologically, this was characterized by pronounced collagen fiber proliferation and glomerular atrophy. Functionally, there were increases in urea nitrogen, creatinine, proteinuria, and other indicators.

Excessive salt intake is closely related to hypertension and renal aging. Studies have shown that as people age, salt sensitivity gradually increases and is associated with renal aging [23]. Moreover, excessive intake of sodium chloride promotes inflammation and renal fibrosis in aging mice [24]. There are no specific changes unique to kidney aging. The pathological changes in elderly kidneys caused by ischemia, hypoxia, and hypertension include tubular atrophy, inflammation, interstitial fibrosis, glomerulosclerosis, vascular rarefaction, and arteriosclerosis. These findings are extremely similar to the pathological features and pathogenesis of CKD caused by hypertension [4].

In aging kidneys, one of the most common pathological changes is focal and global glomerulosclerosis. Through pathological staining, we found that the glomeruli of the rats in the HSD group presented obvious sclerosis and atrophy. Tubular atrophy and interstitial fibrosis are considered the main interstitial changes in aging kidneys. In our study, we detected tubular damage and interstitial fibrosis in the kidneys of the HSD rats. By assessing aging-related enzymes and proteins, we detected significant pathological aging in the kidneys of high-salt diet-fed rats. Moreover, this alteration was accompanied by changes in the SIRT6/HIF-1α pathway. Subsequent treatment with canagliflozin led to amelioration of the aforementioned changes.

Hypertension is a complex multifactorial disease influenced by a variety of genetic and environmental factors. Studies have shown that hypertension is closely related to sirtuins (SIRTs). HDACs constitute an enzyme family that balances the acetylation activity of histone acetyltransferases in chromatin remodeling and is crucial for the regulation of gene transcription. SIRTs, also known as class III HDACs, are highly conserved NAD⁺-dependent deacetylases or ADP-ribosyltransferases related to the silent information regulator 2 (Sir2) gene. Seven SIRTs (SIRT1–7) have been identified in mammals [11]. The occurrence of renovascular hypertension is associated with decreased expression of SIRT1 in the heart and ischemic kidneys [25]. Furthermore, decreased SIRT3 expression and redox inactivation of Sirt3 lead to hypertension [26]. In addition, mitochondrial dysfunction mediated by insufficient SIRT5 signaling leads to hypertension capillary rarefaction [27]. Studies have shown that SIRT6 reduces oxidative stress, inflammation, and renal fibrosis, which is highly important for maintaining cellular homeostasis and delaying the chronic progression of kidney disease [28]. However, the role of SIRT6 in the renal injury and premature aging induced by high salt in hypertensive conditions remains unclear.

Current research indicates that SGLT2is play crucial roles in diseases other than diabetes, particularly cardiovascular and kidney disorders. SGLT2i induce a fasting-like metabolic state due to energy and glucose deficits and trigger a metabolic switch from carbohydrate to lipid usage and ketogenesis, with subsequent nutrient deprivation pathway activation and the effects of reduced oxidative stress and reduced proinflammatory and fibrotic processes. These pharmacologic agents also contribute to increased uptake of free fatty acids in muscles and to increased catabolic pathways. Ketones, which are a more efficient fuel than glucose from an energetic point of view, contribute to lower oxygen consumption and subsequent renal protection [29]. The mechanism may involve enhancing carbohydrate metabolism and fatty acid metabolism, improving hemodynamics, and inhibiting oxidative stress, among other aspects [30]. The level of oxidative stress increases, the expression of inflammatory factors increases, and autophagy decreases in aged tissues and organs. Current studies have shown that canagliflozin can reduce oxidative stress, promote autophagy, and inhibit the expression of inflammatory factors, thereby suppressing the dysfunction and aging of the liver, endothelial cells, cardiomyocytes, and other cells [31–33].

The organ protective effect of SGLT2 inhibitors is closely related to SIRTs. Some studies have shown that dapagliflozin alleviates osteogenic transdifferentiation of vascular smooth muscle cells by targeting the SGLT2/SIRT1 signaling pathway [34]. Moreover, canagliflozin promotes mitochondrial metabolism and alleviates salt-induced cardiac hypertrophy by preserving SIRT3 expression [35]. Previous investigations have demonstrated that SGLT2i can ameliorate the aging of the kidney and vascular endothelium caused by natural aging and diabetes [17,36,37]. Among them, caloric restriction is an important mechanism [38,39]. In diet-restricted mice, the overexpression of SIRT6 can prevent age-related changes [40]. Thus, we speculate that SIRT6 is very likely to be the target for SGLT2i to prevent premature senescence of target organs in hypertension.

SIRT6 is a histone deacetylase, targeting specific sites on histone H3, which is important for chromatin compaction, transcriptional repression, and DNA damage responses [41]. SIRT6 acts as a corepressor for several transcription factors related to aging, cancer, and metabolism (such as NF-κB, HIF-1, and c-Myc); promotes DNA damage-dependent chromatin changes, which are crucial for DNA repair, and maintains telomeric chromatin structure to prevent genomic instability and cellular senescence [42–44]. Aging is a biological process in which cells stop dividing and enter a state of permanent cell cycle arrest, and the levels of cyclin proteins increase. Thus, these proteins are called senescence-associated proteins, among which the representative ones are p53 and p21 [45,46]. In senescent cells, apoptosis increases, the BCL-2 protein is upregulated, the lysosomal content increases, and β-galactosidase serves as a marker for increased lysosomal activity [47].

We performed protein analysis and immunohistochemical analysis and found that SIRT6 was significantly depleted in the kidneys of the rats in the HSD group, whereas their p53 and p21 protein levels were increased. Through SA-β-Gal staining of the kidneys, we found that the activity of SA-β-Gal in the kidneys of the rats in the HSD group was increased, and PCR detection revealed increased BCL-2 transcription. These findings suggest that SIRT6 is involved in the kidney aging of rats caused by a high-salt diet.

HIF-1α is a downstream regulator of SIRT6. HIF-1α is a hypoxia-inducible factor that accumulates stably under hypoxic conditions. Under normoxic conditions, it is hydroxylated by prolyl hydroxylase (PHD) and then rapidly degraded by the proteasome [48]. SIRT6 can deacetylate H3K9 and inhibit the expression of HIF-1α by its promoter [49]. In our study, with the depletion of SIRT6 in the kidneys, the expression of HIF-1α increased. We once again confirmed through immunohistochemistry that SIRT6 and HIF-1α are localized in the nucleus. We further found that an increase in SIRT6 does not result in changes in HIF-1α mRNA, suggesting that SIRT6 regulates HIF-1α at the protein level, which is consistent with previous research [21]. Most studies have shown that SIRT6 inhibits HIF-1α expression at the protein level, reducing pathological remodeling. In a rat model of diabetes, increasing the expression of SIRT6 and reducing the expression of HIF-1α inhibits reactive oxygen species and reduces podocyte pyroptosis in rats [14]. During pulmonary arterial hypertension vascular ­remodeling, SIRT6 inhibits the increased expression of HIF-1α caused by hypoxia, thereby improving vascular remodeling [17]. In non-small cell lung cancer A549 cells, the overexpression of SIRT6 can inhibit the expression of HIF-1α and VEGF, thus suppressing tumor angiogenesis. However, studies have also shown that SIRT6 promotes the protein expression of HIF-1α in thyroid cancer cell lines under both hypoxic and normoxic conditions, thereby promoting the expression of various vascular factors, angiogenesis, and bleeding [50]. This is contrary to our results, perhaps due to differences in disease models.

An important pathological manifestation of kidney aging is renal fibrosis. During the fibrosis process, HIF-1α is induced along with fibrosis and fractionation markers, including collagen, TIMP1, vimentin, and α-SMA [51]. The downstream genes of HIF-1α, including HMOX-1, BCL-2, VEGF, and TIMP-1, are activated, resulting in an increase in their transcription. In our study, we observed significant increases in the levels of all the aforementioned markers. These alterations were inhibited after canagliflozin treatment. The expression of senescence-associated proteins and enzymes was decreased. Moreover, the SIRT6 level was restored, and the expression of both HIF-1α and its target genes was decreased. Therefore, the regulation of the SIRT6/HIF-1α pathway by canagliflozin contributes to the amelioration of renal fibrosis and premature aging in hypertensive rats.

As an SGLT2i, canagliflozin may affect the expression of SIRT6 through multiple cellular signaling pathways. First, it may be related to energy metabolism. SIRT6 is a member of the NAD⁺-dependent HDAC family. NAD⁺ serves as a key factor in numerous redox reactions and posttranslational modifications within the mitochondrial energy chain. During calorie restriction and exercise, NAD⁺ levels are relatively high, whereas they are lower in cases of excessive calorie intake, a high-fat diet, cancer, and the aging process. Previous studies have shown that NAD⁺ supplementation can activate SIRTs [52]. By inhibiting SGLT2, canagliflozin promotes the excretion of excess calories in urine, mimicking the effect of caloric restriction. This leads to an increase in NAD⁺ levels and the activation of SIRT6, which may be its main mechanism of action. Second, canagliflozin can directly regulate the adenosine monophosphate-activated protein kinase (AMPK) pathway, affect mitochondrial energy metabolism, and increase the expression of SIRTs [53]. Third, at the translational level, endogenous microRNAs can regulate the translation of SIRT6 by binding to its 3′-untranslated region (UTR). Some studies have shown that empagliflozin (an SGLT2 inhibitor) can regulate the axis of SIRT6 and its noncoding RNA regulators (miR-214 and miR-302a-3p) to exert cardioprotective effects. In addition, the activation of SIRT6 by canagliflozin may be related to its chemical structure: canagliflozin has structural similarities to MDL-800, an activator of SIRT6. However, these mechanisms have not been verified in the literature and require in-depth research in the future.

Dahl salt-sensitive rats are an excellent model for hypertensive renal injury, as they display many hypertension-related phenotypic characteristics similar to those of humans. The Dahl model mimics salt-sensitive hypertension, and in terms of key pathological mechanisms of hypertensive nephropathy, such as oxidative stress, the inflammatory response, and the activation of the renin–angiotensin–aldosterone system (RAAS), there are similarities between rats and humans [54]. Thus, to a certain extent, the findings from animal studies can be translated and applied to the research and treatment of human diseases. Given the high incidence and severity of hypertension and its associated renal complications, the results of this study hold significant potential value for clinical practice. These results provide new insights into drug-based interventions for hypertensive renal injury. Moreover, numerous clinical studies have confirmed that SGLT2 inhibitors can reduce the level of proteinuria in patients with type 2 diabetes and delay the progression of chronic kidney disease [55]. This protective effect is independent of the glucose-lowering effect, and the protective effect of SGLT2 inhibitors has been observed in nondiabetic patients and animal models. This benefit is consistent regardless of whether patients have comorbid diabetes and regardless of the etiology of CKD, including diabetic nephropathy, ischemic and hypertensive nephropathy, glomerular diseases such as IgA nephropathy, focal segmental glomerulosclerosis, and other causes of kidney disease. Treatment with SGLT2i results in a similar degree of reduction in the risk of nephropathy progression across these different contexts [16,56]. However, there are many similarities in the pathological processes of diabetic nephropathy, hypertensive nephropathy, and kidney aging, such as changes in renal hemodynamics, activation of oxidative stress, and the inflammatory response.

Our study has enriched the existing knowledge regarding the renoprotective mechanisms of SGLT2i drugs, thus broadening the research scope in relevant fields. These results provide new insights into drug interventions for hypertensive renal injury and premature aging. Theoretically, our work further supplements the understanding of the renoprotective mechanisms of SGLT2i drugs, thereby expanding the research horizons in related areas.

Notably, this study was conducted solely in male rats, with no inclusion of female subjects. Consequently, the research findings are limited in terms of sex differences. Future investigations are thus warranted to explore potential disparities in the effects and underlying mechanisms of canagliflozin in female individuals.

5. Conclusion

In this study, we successfully established a hypertensive kidney injury model in male Dahl salt-sensitive rats using a high-salt diet. Our findings unequivocally demonstrated that canagliflozin exerts a remarkable protective effect on the kidneys in the context of salt-sensitive hypertension. Specifically, canagliflozin effectively decreased blood pressure, serum creatinine concentration, and urinary albumin excretion in these model rats. Moreover, it significantly alleviated renal fibrosis and premature aging. Mechanistically, our research revealed that canagliflozin functions by modulating the SIRT6/HIF-1α signaling pathway: it upregulates renal SIRT6 expression, which in turn suppresses the expression of the HIF-1α protein and its target genes, ultimately reducing kidney injury and premature aging.

Funding Statement

We are grateful for the financial support from the following sources: the S&T Program of Hebei (Grant No. 19277787D, 199776249D); the Natural Science Foundation of Hebei (Grant No. H2023307018); the 2024 Government-funded Program for Cultivating Outstanding Talents in Clinical Medicine (No. ZF2024004); and the 2024 Medical Science Research Project Plan of the Hebei Provincial Health Commission (No. 20242226).

Disclosure statement

The authors declare that there are no conflicts of interest regarding the publication of this paper.

Data availability statement

All the data supporting the findings of this study are available from the corresponding author upon reasonable request.