Tackling carbapenem-resistant Acinetobacter baumannii (CRAB) and their virulence factors using biosynthesized silver nanoparticles combined with imipenem

Abstract

Carbapenem-resistant Acinetobacter baumannii is an extremely hazardous microorganism due to its high level of resistance to a wide array of antibiotics, making it a significant public health concern. Herein, this study aimed to biofabricate silver nanoparticles using a cell-free filter derived from Streptomyces sp., with a focus on characterizing their physicochemical properties, and use them to combat CRAB and their virulence factors. The biofabricated Ag-NPs were predominantly spherical with an average size 50 nm, confirmed through TEM analyses, while DLS measurements showed an average hydrodynamic diameter of approximately 36.78 nm. UV–Vis spectroscopy displayed a characteristic surface plasmon resonance peak in the range of 420 nm, indicative of nanoparticle formation. XRD confirmed the crystalline structure, presenting peaks corresponding to face-centered cubic silver. FTIR spectroscopy revealed active participation of metabolite compounds derived from the Streptomyces cell-free filter in both reduction and stabilization processes. Eight clinical bacterial isolates were identified as CRAB using the Vitek-2 system, and biofilm formation with 100 % was assessed through Congo red and microplate assays. The MIC for Ag-NPs and imipenem (IMP) were found to be between 4 and 5 μg/mL and 13 and 15 μg/mL, respectively. Additionally, the fractional inhibitory concentration index (FICI) for the synergistic combinations of Ag-NPs and IMP ranged from 0.5 to 0.375, indicating a notable decrease in the MIC values for both IMP and Ag-NPs from 14 and 5 μg/mL to 1.75 and 1.25 μg/mL, respectively. The qRT-PCR demonstrated a significant reduction in the expression levels of the Bap and ompA genes by up to 4.0-fold (p ≤ 0.001). The time-killing assay confirmed that the bacterial strain was effectively eliminated through the synergistic action of Ag-NPs and IMP. Moreover, the cytotoxicity assessment of Ag-NPs and their combination with IMP revealed low toxicity of the combination of Ag-NPs and IMP, with an IC₅₀ of 26.13 ± 0.24 and 45.33 ± 0.21 μg/mL, respectively (p < 0.0019), indicating good biosafety, while the hemolysis rates were recorded at 0.4 and 0.7 at 12 and 24 h, respectively. We concluded that the combination of Ag-NPs with IMP could serve as a promising alternative strategy for treating CRAB.

Graphical abstract

1. Introduction

Acinetobacter baumannii is frequently responsible for infections within hospital settings. It predominantly impacts critically ill patients who are on ventilators and can result in severe bloodstream infections. The emergence of multidrug-resistant strains of Acinetobacter has raised significant alarm among healthcare professionals.¹ In this context, A. baumannii accounts for approximately 2 % of all healthcare-associated infections in the United States and Europe, a figure that is doubled in regions such as Asia and the Middle East. Although these infections are less prevalent compared to other Gram-negative pathogens, the patterns of resistance they exhibit are alarming. Worldwide, 45 % of isolates are identified as multidrug-resistant (MDR), with certain areas, including Latin America and the Middle East, reporting MDR rates as high as 70 %.² Furthermore, A. baumannii is known for its resistance to carbapenems and is an opportunistic pathogen frequently found in hospital settings. It poses a significant threat, contributing to elevated morbidity and mortality rates. Infections caused by CRAB are challenging to manage, as the available treatment options are limited by high toxicity and inadequate distribution within the body. The World Health Organization has classified CRAB as a pathogen of critical importance.³ This designation highlights the pressing necessity for the development of new medications to address the escalating threat posed by Acinetobacter infections in healthcare. Treating these infections is particularly challenging due to the presence of biofilms, which serve as a protective barrier that significantly enhances bacterial resistance. Biofilms consist of microbial communities embedded within an extracellular polymeric substance (EPS) matrix. This protective structure not only heightens the bacteria's resistance to antibiotics but also diminishes the effectiveness of the host's innate immune responses, making the treatment of Acinetobacter infections more complex. Additionally, biofilms promote the transmission of infections between individuals and contribute to difficult-to-manage outbreaks.⁴ The capacity to create biofilms significantly improves the adherence and longevity of A. baumannii on both biological tissues and inanimate surfaces. The formation of pili and the synthesis of the Bap surface-adhesion protein are essential for biofilm development, acting as key contributors to the advancement of A. baumannii infections.⁵ These bacteria secrete outer membrane proteins (Omps) along with the biofilm-associated protein (Bap), which are crucial in biofilm formation, thereby enhancing their pathogenicity and resistance to antibiotic treatment.⁶ The excessive production of OmpA has been identified as a standalone risk factor associated with elevated mortality rates in instances of nosocomial pneumonia and bacteremia linked to A. baumannii.

The rising incidence of antibiotic resistance has prompted researchers to investigate nanotechnology-based solutions for antimicrobial treatment. Nanoparticles (NPs) are natural or synthetic materials that contain particles in the size range of 1 nm–100 nm and possess unique physicochemical characteristics that enable them to effectively tackle antibiotic resistance through various mechanisms. NPs are synthesized with different methods, including chemical, physical, and biological methods. Biological methods use bacteria, actinomycetes, fungi, algae, and plant extracts to avoid the use of harmful chemicals and energy-demanding processes The most important category of microorganisms that can be harnessed for the creation of novel pharmaceutical and commercial products, such as drugs, is bacteria, particularly Actinomycetes. Actinomycetes, which include Streptomyces sp., are proficient in generating powerful bioactive substances like antibiotics. Furthermore, they are regarded as suitable nanoparticle producers, as various methods can be employed to synthesize them both extracellularly and intracellularly.7, 8, 9, 10, 11 NPs present distinct benefits in drug delivery, attributed to their diminutive size, extensive surface area-to-volume ratio, and adaptable surface chemistry. These distinctive properties of NPs enhance their interactions with biological entities, such as bacteria, in comparison to conventional microparticles.⁸ They can selectively target specific biomolecules and microorganisms that contribute to the emergence of resistant strains.9, 10, 11, 12 Their ability to penetrate the cell membrane and wall of pathogenic organisms allows them to disrupt essential molecular pathways, leading to the development of novel antimicrobial strategies. A viable approach to combat the escalating problem of bacterial resistance is the integration of antibiotics with metal nanoparticles to boost their activity.^13,14

Researchers have shown considerable interest in silver nanoparticles owing to their exceptional characteristics and wide array of applications, particularly within the biomedical field. Numerous studies have been undertaken to investigate the antibacterial properties of silver nanoparticles and the mechanisms through which they operate.^7,15, 16, 17 The antibacterial properties of silver ions are widely acknowledged, with silver nanoparticles exhibiting enhanced antimicrobial efficacy compared to their larger counterparts. The antimicrobial action of silver nanoparticles is primarily due to their capacity to compromise plasma membrane integrity, inhibit respiratory enzymes, and disrupt DNA replication processes.^16,17 Research indicates that Ag-NPs possess strong antibacterial properties, with MIC and minimum bactericidal concentrations (MBC) ranging from 0.46 to 1.87 μg/mL against multidrug-resistant pathogens. Notably, interactions between Ag-NPs and meropenem have shown synergistic and additive effects against A. baumannii strains, leading to a reduction in meropenem MIC values from 4 to 8-fold. This combination resulted in complete bacterial eradication (with undetectable colony counts) within a timeframe of 10 min–24 h post-treatment, alongside significant protein leakage across all treated groups, indicating membrane disruption. Furthermore, the meropenem-Ag-NP combination inhibited biofilm formation in clinical and ATCC 19606 strains of A. baumannii by 21 % and 19 %, respectively, while also disrupting existing biofilms by 22–50 %.18, 19, 20 Additionally, the effectiveness of antibiofilm properties was observed when Ag-NPs were used in conjunction with polymyxin B against CRAB isolates and ATCC 19606, demonstrating biofilm inhibition rates ranging from 4.9 % to 100 %, as well as biofilm disruption rates between 6.8 % and 77.8 % in established communities.²¹

As resistance levels increase and the availability of treatment options decreases, there is a significant shortage of published studies on new antibiotics to address carbapenem-resistant CRAB. The innovation of this research lies in the biofabrication of silver nanoparticles utilizing cell-free filter Streptomyces species. This method does not necessitate the use of any harmful substances. In comparison to conventional methods, this technique is more cost-effective, easier to implement, and more environmentally friendly, thus classified as ‘green’. The nanoparticles were evaluated through various in vitro assays to assess their antibacterial efficacy against CRAB strains. Furthermore, the potential synergistic effects of combining the nanoparticles with imipenem were examined to improve treatment effectiveness against these resistant pathogens. Examine the multifunctional abilities of Ag-NPs, which include their potential to inhibit biofilm formation and their function in downregulating genes related to clinical strains of CRAB, along with their hemocompatibility. Thus, this study was designed to assess the in vitro antibacterial effects of biosynthesized Ag-NPs, both separately and in combination with imipenem, on isolates of carbapenem-resistant A. baumannii.

2. Materials and methods

2.1. Chemicals

Dextrose, yeast extract, and malt extract were obtained from El-Gomhoria Company, based in Cairo, Egypt. AgNO₃ (purity 99.98) was obtained from Sigma Aldrich, St. Louis, USA.

2.2. Green synthesis of Ag-NPs by cell free filter of Streptomyces sp

The cell-free filtrate derived from Streptomyces sp. was utilized for the extracellular biosynthesis of silver nanoparticles.²² Streptomyces sp. was cultivated in 250 mL flasks containing 50 mL of International Streptomyces Project-2 Medium (ISP2), which comprised the following components (g/L): 4.0 dextrose, 4.0 yeast extract, and 10.0 malt extract, with the pH adjusted to 7.2. The inoculated flasks were incubated for seven days at a temperature range of 30–32 °C while being agitated in a rotary shaker set to 200 rpm. After the incubation, the cultures underwent centrifugation at 12,000 rpm for 15 min to separate the supernatants. Subsequently, 50 mL of a 1 mM AgNO₃ aqueous solution (Sigma Aldrich, St. Louis, Missouri, USA) was added dropwise to the supernatant (50 mL), and the mixtures were incubated at 37 °C for 48 h with continuous stirring at 120 rpm in a dark environment. The formation of Ag-NPs was visually indicated by a color change in the solution from colorless to deep brown.^23,24 Consequently, the deep brown colloidal supernatant from the promising strain was characterized for further analysis. A portion of this solution was centrifuged for 30 min at 8000 rpm to isolate the Ag-NPs, which were then dried for characterization and subsequent application.

2.3. Characterization of biosynthesized nanoparticles

Characterization plays a crucial role in the successful synthesis of nanoparticles and in identifying their physicochemical properties, including size, size distribution, and shape. The biosynthesis of Ag-NPs was confirmed by observing a significant peak in the absorption spectrum of the solution, as analyzed using UV–visible spectroscopy with a JASCO V630 spectrophotometer (Easton, USA).²⁵ The crystalline structure of Ag-NPs was evaluated using X-ray diffraction (XRD) facilitated by a PAN analytical X'pert PRO diffractometer (Eindhoven, Netherlands). The analysis was performed at 40 kV and 30 mA, employing Cu Ka1 radiation. The scanning range for 2θ was set from 10° to 80° at a speed of 0.02° per minute.²⁶ The identification of functional groups present in the compound involved in the biosynthesis of Ag-NPs was performed using Fourier transform infrared spectroscopy (FTIR) with a FTIR 6100 spectrometer (Jasco, Tokyo, Japan). Initially, the nanoparticles were mixed with potassium bromide (KBr) from Sigma-Aldrich, St. Louis, USA, to prepare for the analysis. The infrared spectra were subsequently recorded over a wavenumber range of 4000-400 cm⁻¹.²⁷ The structural properties and morphology of the Ag-NPs were examined using transmission electron microscopy (TEM) imaging at 80 kV at the Regional Center for Mycology and Biotechnology (RCMB) at Al-Azhar University, Cairo, Egypt. For sample preparation, a drop of the solution was placed on carbon-coated copper grids (CCG) and allowed to evaporate slowly at room temperature before capturing the TEM micrograph.²⁸ Additionally, dynamic light scattering (DLS) analysis of the Ag-NPs was performed using a Zetasizer Nano Particle Analyzer (Malvern Instruments Ltd., UK).²⁹

2.4. Isolation, Identification and antibiotics susceptibility of clinical bacterial isolates

This study involved the collection of eight clinical bacterial isolates, designated AB-1 through AB-8, sourced from sputum, blood, urine, and pus samples from abscesses at a private laboratory in Cairo, Egypt, between January and July 2024. The protocols and procedures were approved by the Institutional Review Board of the National Cancer Institute (NCI) at Cairo University, Egypt (IRB number: IRB00004025; approval number: CB2309-302-071). Prior to participation, all individuals provided written informed consent. The research adhered to the established ethical guidelines. The identification of the isolates and their antibiotic susceptibility testing were conducted using the automated Vitek2 system (GN-card), Version 05.04, produced by BioMerieux SA, France.

2.5. Antibacterial activity and MIC of biosynthesized silver nanoparticles and IMP

The evaluation of the antibacterial efficacy of biosynthesized Ag-NPs against CRAB strains was conducted using the disc diffusion method, according to the CLSI guidelines.³⁰ The MIC of Ag-NPs was determined through the microdilution technique. In summary, bacterial strains were incubated at 37 °C with shaking at 180 rpm until they reached the logarithmic growth phase. The cultures were subsequently diluted in Mueller–Hinton broth (MHB) (HiMedia, India) to achieve a cell density of approximately 1.0 × 10⁶ colony-forming units (CFU/mL). Following this, 20 μL aliquots of the suspension were added to each well of a UV-sterilized polystyrene 96-well microtiter plate (SPL, Pyeongtaek, Korea), which contained 100 μL of MHB containing Ag-NPs solution or IMP which serially diluted from 50 to 0 μg/mL. After incubating the plates at 37 °C for 24 h, the MIC was identified as the lowest concentration at which no visible bacterial growth was observed. For enhanced accuracy, the MIC value was reassessed within the range of 1–6 μg/mL, while the IMP was retested between 12 and 17 μg/mL. The experiment was conducted in triplicate.

2.6. Checkerboard assay

To evaluate the synergistic effects of Ag-NPs and IMP, a checkerboard assay was performed on a 96-well plate utilizing a single strain of CRAB as the model microorganism. The assay involved systematically varying the concentrations of Ag-NPs in a two-fold manner across the columns, while the imipenem concentrations were adjusted along the rows. After incubating the plates for 24 h at 37 °C, the MIC was measured using an Epoch microplate reader (BioTek Instruments, Winooski, USA) at a wavelength of 620 nm. The Fractional Inhibitory Concentration Index (FICI), which quantifies the interactions between the two agents as synergistic, additive, or antagonistic, was calculated using the formula FICI = (MIC of combination/MIC Ag-NPs) + (MIC of combination/MIC IMP). An FICI value of 0.50 or less indicates synergy, while values between 0.50 and 1.00 suggest an additive effect. Values from 1.00 to 2.00 indicate indifference, and any FICI greater than.¹¹

2.7. Time-kill curves evaluation

The synthesized Ag-NPs was applied in time-kill studies on only one CRAB isolate, with a particular focus on analyzing colony counts in relation to treatment with MIC Ag-NPs at predetermined time intervals. To summarize, overnight cultures of the bacteria were grown in nutrient broth, which was derived from a single colony on brain heart infusion agar. The CRAB isolate (0.5 McFarland) underwent treatment at concentrations of ¼ MIC, ½ MIC, ¾ MIC, 1 MIC, and 2 MIC of the Ag-NPs-IMP synergistic combination obtained from the checkerboard assay. At various time intervals over a 12-h period, 100 μL samples were collected, plated onto nutrient agar, and incubated for 18–24 h. After incubation, the colony-forming units (CFUs) were counted, facilitating the development of a time-kill curve to measure antimicrobial activity (CFU/mL).³⁶

2.8. Screening of biofilm formation in the CRAB isolates

The screening process incorporated qualitative methods, including the use of Congo red agar, as well as semiquantitative approaches such as the microtiter plate assay.

2.8.1. Congo red agar (CRA)

A study was conducted to examine the biofilm development of A. baumannii isolates using Congo red agar (CRA). The CRA medium was prepared with the following ingredients per liter: 37.0 g of brain heart infusion (Difco, Tucker, Georgia, USA), 50.0 g of sucrose, 10.0 g of agar, and 0.8 g of Congo red (Sigma-Aldrich, Germany). The bacterial isolates were inoculated onto the CRA plates and incubated for 24 h at 37 °C. Upon completion of the incubation, A. baumannii isolates that successfully formed biofilms were indicated by black colonies, while those that did not form biofilms were represented by red colonies.³¹

2.8.2. Microtiter plate assay (MPA)

The semi-quantitative evaluation of biofilm formation was performed utilizing 96-well microplates. Each bacterial isolate was incubated in Trypticase Soy Broth (TSB) (Oxoid Company, Basingstoke, Hampshire, England) enriched with 1 % glucose for a duration of 24 h at 37 °C in the microplate wells. Upon completion of the incubation, the culture media and plates were washed with phosphate-buffered saline (PBS) at pH 7.2 to remove any non-adherent bacteria. The biofilms that adhered to the wells were then fixed, dried, and stained with crystal violet (Oxoid Company, Basingstoke, Hampshire, England). The stained biofilms were solubilized using 95 % ethanol, and their optical density (OD) was evaluated at a wavelength of 492 nm with a plate reader, ensuring that each measurement was conducted in triplicate.^17,31,32 The grouping of the bacteria that generated biofilms according to the information provided (Table 1). The experiment was performed in three replicates.

Table 1.

Classification of bacteria based on biofilm formation capacity.

Biofilm Class	Results
OD > 4 × ODc	Strong biofilm
2 × ODc < OD ≤ 4 × ODc	Medium biofilm
ODc < OD ≤ 2 × ODc	Poor biofilm
OD ≤ ODc	Negative biofilm

OD: optical density, ODc: cutoff optical density.

2.8.3. Investigate Bap and OmpA genes associated with biofilm formation

In order to assess the gene expression linked to biofilm formation in the isolates under study, overnight cultures of CRAB were collected. Following the manufacturer's guidelines (Yekta Tajhiz Azma, Tehran, Iran), cell harvesting, total RNA extraction, and cDNA synthesis were performed. The analysis of biofilm gene expression, focusing on Bap and OmpA, was executed using quantitative real-time PCR (qRT-PCR) with Power SYBR@Green PCR Master Mix (Applied Biosystems, USA), as specified in Table 2. The comparative critical threshold value method (2−^ΔΔCT) was applied to evaluate the differences in expression levels of biofilm genes post-treatment of the bacteria.³³

Table 2.

Oligonucleotides sequences used in this study, Bap and, OmpA.

Genes	Primer sequences 5′- … … … … …. -3′	Amplification condition	Product size (bp)	Ref
Bap	F: GCCAGCGATGTATTGGTAGT	94 °C (30 s) 52 °C (30 s) 72 °C (1 min)	107	34.
	R: GGCTCAGCTGTTCCACTAAA
OmpA	F: TCTTGGTGGTCACTTGAAGC	94 °C (30 s) 57 °C (30 s) 72 °C (1 min)	86	35.
	R: ACTCTTGTGGTTGTGGAGCA

2.9. Antibiofilm assessment

An assessment of antibiofilm properties for the combination of imipenem and Ag-NPs at a concentration of ½ MIC was executed against CRPA isolates, following the previously outlined procedures for Congo red and crystal violet staining. The analysis of biofilm-related genes post-treatment with Ag-NPs, imipenem, and the imipenem-Ag-NPs combination was performed as previously indicated. Control wells consisted of Ag-NPs-free culture medium, the imipenem and Ag-NPs combination, and culture medium inoculated only with the tested bacterial strains. The experiment was conducted in triplicate.

2.10. In vitro cytotoxicity assessment

The cytotoxic properties of Ag-NPs and their combination with IMP were investigated in vitro using HFB-4 (normal human melanocytes) and HepG-2 (hepatocellular carcinoma) cell lines obtained from ATCC, Rockville. The cultures were sustained in a medium containing 10 % fetal bovine serum and 1 % penicillin-streptomycin (10000 U/mL) at 37 °C in a 5 % CO₂ environment. When the cells reached 80 % confluence, they were treated with Ag-NPs and a combination of Ag-NPs with imipenem at concentrations of 0, 5, 10, 15, 20, 25, and 30 μg/mL. The cultures were maintained under humidified conditions for 24 h at 37 °C with 5 % CO₂. The MTT assay (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) from Sigma-Aldrich, Germany, was used to determine the 50 % inhibitory concentration at wavelengths ranging from 570 to 630 nm.³⁶

2.11. Evaluation of hemolytic activity

The investigation of the hemolytic potential of Ag-NPs and their combination with IMP was conducted to assess cytocompatibility with healthy, freshly isolated human red blood cells (RBCs). In this study, RBCs were treated with Ag-NPs and their combination with IMP at a 1:1 ratio. For control comparisons, 1 % Triton X-100 served as the positive control, while phosphate-buffered saline (PBS) was used as the negative control. After a 12- and 24-h incubation period at 37 °C, the cells were centrifuged at 3000×g for 10 min, and the absorbance of hemoglobin released into the supernatants was quantified at 570 nm using an Epoch spectrophotometer (BioTek Instruments, Winooski, USA). The relative hemolysis was calculated using the formula: Hemolysis = [A Sample – A Blank/A Positive Control – A Blank] x 100.³⁷ The experiment was performed in three replicates.

2.12. Statistica analysis

Experiments were carried out in triplicate, with results expressed as mean ± standard deviation. The comparison between experimental and control groups was performed using two-way ANOVA, followed by Tukey's post hoc and Sidak's multiple comparisons tests. Statistical analyses were executed with GraphPad Prism Software version 8.0 (GraphPad Software, Inc., La Jolla, CA, USA) to determine statistically significant differences (p-value ≤0.05).

3. Results and discussion

3.1. Biosynthesis and characterization of Ag-NPs

The current study demonstrates the successful biosynthesis of Ag-NPs using cell-free filtrate derived from Streptomyces species. The process is rapid, simple, ecofriendly, and cost-effective. Upon mixing the cell-free filter derived from Streptomyces species with metal precursors, a noticeable color change from yellow to deep brown occurred, indicating the formation of the Ag-NPs. This transformation is attributed to the activation of surface plasmon resonance, signifying the reduction and stabilization of metal ions by the metabolites present in the cell-free filter.⁷ The use of cell-free filtrate derived from Streptomyces species effectively minimized the negative impacts of conventional chemical and physical synthesis methods by acting as reducing, capping, and stabilizing agents.⁸ Streptomyces species have shown their ability to act as biological factories for the effective synthesis of silver nanoparticles.⁷ In earlier research, Nainangu et al.³⁸ utilized a cell-free filtrate derived from Streptomyces rochei SSCM102 to promote the biosynthesis of silver nanoparticles. Likewise, Mohanta et al.³⁹ used a cell-free filtrate from Streptomyces sp. for the synthesis of silver nanoparticles. The initial indication of Ag-NP synthesis was marked by a distinct color change in the medium, transitioning to a deep brown as silver nitrate (AgNO₃) was reduced to elemental silver (Ag⁰). The optical absorption behavior of the Ag-NPs was evaluated using a UV–vis diffuse reflectance spectrophotometer. The absorbance of the nanoparticles was measured across the spectrum of 200–700 nm to determine their highest SPR. As depicted in Fig. 1A, the biosynthesized Ag-NPs greatest SPR was seen at 420 nm. These findings are consistent with previous studies by Mohanta and colleagues, which highlighted the UV absorption characteristics of silver nanoparticles at 420 nm.³⁹ The notable peak at 420 nm indicates the presence of silver nanoparticles, aligning with the results documented by Mohammad et al.¹⁴ and those reported by Paterlini et al.⁴⁰

Fig. 1.

Biosynthesized and characterization of Ag-NPs, (A) UV–visible, (B) XRD, (C) DSL, (D) (TEM) and (E) FTIR spectrum.

The X-ray diffraction (XRD) patterns of Ag-NPs are observed in Fig. 1B. It showed broad diffraction peaks at diffraction locations at 2θ values of 36.45°, 46.45°, 56.75°, 64.45°, and 76.05° associated with the (111), (200), (220), (240), and (311) crystallographic planes. These findings are in agreement with the previous study by Sivasankar et al.,⁴¹ which found that the XRD pattern of Ag-NPs synthesized from Streptomyces olivaceus (MSU3) showed four notable peaks at 2θ values of around 38.12°, 44.30°, 64.45°, and 77.41°, corresponding to the lattice planes (111), (200), (220), and (311). Likewise, Dayma et al.⁴² identified five unique diffraction peaks associated with the lattice planes (111), (200), (231), (222), and (220). Furthermore, Składanowski et al. recorded peaks at 2θ values of 38.1°, 44.6°, 64.6°, 77.5°, 81.5°, and 115.0° for crystalline Ag-NPs.⁴³

The average hydrodynamic diameter, measured through dynamic light scattering (DLS), was determined to be 36.78 nm, accompanied by a significant standard deviation of 21.16 nm, indicating the presence of polydisperse Ag-NPs, as illustrated in Fig. 1C. These findings were contrasted with those reported by Abushiba et al.,⁷ who demonstrated the biosynthesis of spherical silver nanoparticles that are monodisperse in nature and are in the range of 14.2 ± 1.6 nm. It was possible to investigate the morphology, shape, and size of the Ag-NPs by using transmission electron microscopy (TEM). As illustrated in Fig. 1D. TEM images of Ag-NPs biosynthesized under optimal circumstances were obtained, and the synthesized Ag-NPs were revealed to be predominantly spherical in shape, with sizes around 50 nm. These findings are consistent with previous results reported by Nayka and their team, who reported that Streptomyces sp. NS-33 produced spherical, polydisperse silver nanoparticles measuring 32.40 nm.⁴⁴ Furthermore, Nejad⁴⁵ and colleagues documented the formation of silver nanoparticles from Streptomyces sp. in various shapes, including hexagonal, pentagonal, spherical, and triangular. These findings were contrasted with those reported by Elumalai et al.,⁴⁶ who demonstrated the synthesis of crystalline, spherical nanoparticles with a width of 98.4 nm using the cell-free filtrate from Streptomyces coelicoflavus MTK30.

The data obtaied of the FTIR analysis indicated the presence of various functional groups related to the green synthesis method and the stabilization of silver nanoparticles. The FTIR spectra displayed peaks at 3500 cm⁻¹, 3150 cm⁻¹, 2750 cm⁻¹, 2150 cm⁻¹, 1940 cm⁻¹, 1145 cm⁻¹, 1024 cm⁻¹, and 640 cm⁻¹, as illustrated in Fig. 1E. It is essential to highlight that the FTIR patterns observed in this study are closely aligned with those reported by Iván et al.⁴⁷ The peaks within the range of 3500–3150 cm⁻¹ are likely attributed to the –OH groups of hydroxy functional groups⁴⁸ and the –NH groups of amine functional groups.⁴⁹ On the other hand, the peaks identified between 1300 and 1200 cm⁻¹, in addition to the peak at 1036 cm⁻¹, are indicative of the presence of aromatic and aliphatic amines.⁵⁰ Research indicates that the peak at 1078 cm⁻¹ is likely associated with a C–O stretching vibration, while the peak at 1038 cm⁻¹ corresponds to C–N stretching and the vibrations of aliphatic amines.⁵¹ Finally, the appearance of a peak at 640 cm⁻¹ refers to the presence of metal (Ag) in the tested sample. The presence of these functional groups in the synthesized Ag-NPs suggests the involvement of proteins, enzymes, peptides, polysaccharides, and organic acids, which are vital for the reduction and stabilization of metallic ions in the nanoparticles.^49,52 The stabilization and capping of the produced nanoparticles are achieved through the cell-free filtrate of Streptomyces, which helps to prevent aggregation. The capped protein molecules may comprise amino acid residues containing hydroxy groups, along with water molecules linked to the protein structure. These interactions enhance the stability of the nanoparticles and contribute to their biocompatibility. As a result, the functionalized nanoparticles can be effectively utilized in various biomedical applications, including drug delivery. Imaging, where their unique properties can improve the accuracy and efficacy of diagnostic techniques. Furthermore, ongoing research is exploring additional applications in targeted therapy and biosensing, highlighting the versatility and potential of these functionalized nanoparticles in advancing medical science.⁵²

3.2. Isolation, identification, and antibiotic susceptibility of clinical bacterial isolate

The identification of clinical bacterial isolates as A. baumannii was achieved with a high probability of 96 %–98 % through the Vitek-2 automated system, as presented in Table 3. The susceptibility of these isolates was tested against fifteen different antibiotics from various classes. The antimicrobial susceptibility analysis of eight isolates (AB-1 to AB-8) indicated a broad pattern of drug resistance. All isolates showed high resistance to several antibiotic classes, including fluoroquinolones (ciprofloxacin, levofloxacin), aminoglycosides (gentamicin, tobramycin), penicillins (ampicillin), β-lactam/β-lactamase inhibitor combinations (ampicillin/sulbactam, piperacillin/tazobactam), cephalosporins (ceftazidime, cefepime), and carbapenems (imipenem, meropenem). Susceptibility was maintained only to aztreonam, amikacin, and polymyxins (polymyxin B, colistin). So, this study classified eight of the A. baumannii isolates as carbapenem-resistant A. baumannii (CRAB), as shown in Table 4. These findings are consistent with previous reports by Derakhshan et al.³ Furthermore, the screening process reviewed 188 patient records, resulting in the selection of 111 patients diagnosed with A. baumannii infections.⁵³ Almost all isolates showed resistance to carbapenem, with 43 % classified as extensively drug-resistant. A. baumannii is recognized as one of the multidrug-resistant (MDR) ESKAPE pathogens, which also encompass Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Enterobacter species.⁵⁴ A prior study in Egypt revealed that two A. baumannii isolates were resistant to all tested antibiotics, including carbapenems, third-generation cephalosporins, aminoglycosides, fluoroquinolones, and trimethoprim/sulfamethoxazole, with the exceptions of tigecycline and colistin 55. Approximately 2 % of all healthcare-associated infections in the United States and Europe are attributed to A. baumannii. However, this rate is considerably higher in Asia and the Middle East, where it can be observed at twice the level. Despite the lower frequency of these infections compared to other Gram-negative pathogens, around 45 % of global isolates are deemed multidrug-resistant (MDR), with certain regions, notably Latin America and the Middle East, reporting MDR rates that can soar to 70 %.² MDR strains are defined as bacteria that resist at least one antibiotic from three or more distinct classes. XDR (extensively drug-resistant) strains, however, are resistant to all but one or two classes of antimicrobials, which severely limits treatment alternatives. PDR (pan-drug-resistant) strains demonstrate resistance to all available antimicrobial agents, making the treatment of infections extremely challenging. The emergence of PDR strains highlights the urgent need for new antimicrobial therapies and strategies to combat these resistant infections. Public health initiatives must focus on surveillance, prevention, and the responsible use of antibiotics to mitigate the spread of these formidable pathogens. Increasing evidence points to the widespread occurrence of XDR and PDR isolates of A. baumannii in numerous countries.⁵⁶

Table 3.

Identification of the carbapenem-resistant isolates by Vitek2 system.

Isolate code	Name of Bacteria	Confidence level	% Probability
AB-1	Acinetobacter baumannii	Excellent	98 %
AB-2	Acinetobacter baumannii	Excellent	98 %
AB-3	Acinetobacter baumannii	Excellent	98 %
AB-4	Acinetobacter baumannii	Excellent	98 %
AB-5	Acinetobacter baumannii	Excellent	96 %
AB-6	Acinetobacter baumannii	Excellent	96 %
AB-7	Acinetobacter baumannii	Excellent	98 %
AB-8	Acinetobacter baumannii	Excellent	98 %

Table 4.

Antibiotics susceptibility tested of carbapenem-resistant A. baumannii.

Antibiotics	AB-1		AB-2		AB-3		AB-4		AB-5		AB-6		AB -7		AB -8
	MIC	profile	MIC	profile	MIC	Profile	MIC	profile	MIC	profile	MIC	profile	MIC	Profile	MIC	profile
Ciprofloxacin	≥2	R	≥2	R	≥2	R	≥2	R	≥2	R	≥2	R	≥2	R	≥2	R
Levofloxacin	≥4	R	≥4	R	≥4	R	≥4	R	≥4	R	≥4	R	≥4	R	≥4	R
Aztreonam	<32	S	<32	S	<32	S	<32	S	<32	S	<32	S	<32	S	<32	S
Gentamicin	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R
Ampicillin	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R
Ampicillin/Sulbactam	≥32	R	≥32	R	≥32	R	≥32	R	≥32	R	≥32	R	≥32	R	≥32	R
Amikacin	<64	S	<64	S	<64	S	<64	S	<64	S	<64	S	<64	S	<64	S
Ceftazidime	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R
Cefepime	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R	>32	R
Tobramycin	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R	≥16	R
Piperacillin/Tazobactam	>4	R	>4	R	>4	R	>4	R	>4	R	>4	R	>4	R	>4	R
Imipenem	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R
Meropenem	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R	>8	R
Polymyxin B	<2	S	<2	S	>2	<2	S	<2	S	<2	S	<2	<2	S	S	<2
Colistin	<2	S	<2	S	>2	<2	S	<2	S	<2	S	<2	<2	S	S	<2

3.3. Antibacterial activity of bio-synthesized Ag-NPs

The increasing prevalence of antibiotic resistance has led researchers to explore nanotechnology-driven approaches for antimicrobial therapy. There is a growing interest in the revitalization of metal-based materials as viable solutions to address the challenge of antibacterial resistance. Silver ions (Ag⁺) and silver nanoparticles have served as antimicrobial agents since ancient times and remain extensively used in both the food industry and healthcare settings.⁵⁷ In this study, the antibacterial effectiveness of biosynthesized Ag-NPs (suspended in distilled water) against carbapenem-resistant A. baumannii isolates AB-1 through AB-8 was evaluated using the agar disc diffusion method. The findings revealed that Ag-NPs have notable antibacterial activity against CRAB isolates, with inhibition zones between 24 ± 0.10 mm and 27 ± 0.08 mm. The MICs of biosynthesized Ag-NPs were determined to be between 4 and 5 μg/mL, compersion with positive control, IMP, showed MICs ranging from 13 to 15 μg/mL, as presented in Table 5, Table 6 and Fig. 2. These findings agree with a previous study by Abushiba et al.,⁷ and El-Sherbiny et al.⁵⁸ established the antibacterial effectiveness of biosynthesized Ag-NPs against MDR bacteria. In this context, the MIC of biosynthesized Ag-NPs obtained in the current study is consistent with the values reported by Hetta et al.,⁵⁹ which ranged from 4 to 25 μg/mL against A. baumannii. Furthermore, Ag-NPs showed significant antimicrobial efficacy against A. baumannii, with a MIC of approximately 2.5 μg/mL.^60,61 Additionally, Wan and his research team found that Ag-NPs completely inhibited the growth of carbapenem-resistant A. baumannii at a concentration of 2.5 μg/mL.⁶² Also, biogenic synthesis of Ag-NPs exhibited antibacterial activity with MIC and MBC values ranging from 0.460 to 1.870 μg/mL.¹⁹ On the other hand, Ramalingam et al.⁶³ illustrate that silver nanoparticles are more effective against Gram-negative bacteria than their Gram-positive counterparts. This discrepancy in effectiveness can be explained by the peptidoglycan layer found in the cell walls of Gram-positive bacteria, which consists of glycan strands linked by short peptides and anionic glycopolymers called teichoic acid, acting as a natural barrier that hinders nanoparticle entry. Conversely, Gram-negative bacteria have a thinner cell wall with a lower peptidoglycan content.⁶⁴ Lipopolysaccharides (LPS) are essential components of the cell wall in Gram-negative bacteria, significantly contributing to the membrane's strength and integrity. Their negative charge also promotes the adhesion of nanoparticles.⁶⁵ Additionally, previous studies have

Table 5.

Antibacterial activity of biosynthesized Ag-NPs against CRAB isolates.

Bacterial strains	The mean of inhibition zone diameter (mm) (mean ± SD)
	Ag-NPs	Imipenem 10 μg
AB-1	26 ± 0.15	0.0
AB-2	25 ± 0.07	0.0
AB-3	26 ± 0.10	0.0
AB-4	24 ± 0.10	0.0
AB-5	25 ± 0.09	0.0
AB-6	26 ± 0.10	0.0
AB-7	25 ± 0.14	0.0
AB-8	27 ± 08	0.0

Table 6.

MICs of biosynthesized Ag-NPs and imipenem against CRAB isolates.

Bacterial strains	Mean of MIC μg/mL (mean ± SD)
	Ag-NPs	Imipenem
AB-1	4	15.0
AB-2	4	14.0
AB-3	4	14.0
AB-4	5	14.0
AB-5	4	13.0
AB-6	4	14.0
AB-7	4	14.0
AB-8	4	13.0

Fig. 2.

Antibacterial activity of biosynthesized Ag-NPs (1) combination with imipenem, (2) Ag-NPs and (3) imipenem against some CRAB isolates.

indicated that reactive oxygen species (ROS) play a vital role in the antibacterial effects of biosynthesized silver nanoparticles. This assertion was validated through the evaluation of the antibacterial activity of Ag-NPs against multidrug-resistant E. coli and S. aureus, mediated by ROS. The increased production of ROS resulted in the disruption of bacterial membranes by enhancing their permeability, which ultimately affected the electron transport chain, causing the leakage of cellular contents and leading to bacterial cell death.64, 66^,64, 66

3.4. Checkerboard assay

The traditional checkerboard technique is a well-established method for assessing drug synergy, which involves testing two drugs at varying concentrations to determine the levels that yield the least synergistic effect on one another. The fractional inhibitory concentrations index (FICi) serves as a mathematical tool for measuring this interaction.⁷ The FICi reflects the extent of interaction between imipenem and Ag-NPs in combating CRAB isolates. In this investigation, the combinations of imipenem and Ag-NPs tested against CRAB isolate AB-4, resulted in 28 unique treatments, each demonstrating different levels of interaction. Of these, fifteen displayed indifferent interactions, ten exhibited additive interactions, and only three showed synergistic concentrations (3.5 + 1.25, 3.5 + 0.625, and 1.75 + 1.25) for both imipenem and Ag-NPs, with corresponding FICi values of 0.5 and 0.375, respectively, as outlined in Table 7. A notable reduction was observed in the concentrations necessary for the effective treatment of CRAB with imipenem and Ag-NPs, decreasing from 14 and 5 μg/mL to 1.75 + 1.25 μg/mL, respectively. The biosynthesized Ag-NPs have been shown to lower the MIC of imipenem. Antimicrobial resistance is increasingly recognized as a significant challenge in the healthcare sector, highlighting the need for the creation of new classes of drugs through innovative approaches. A. baumannii, a common pathogen linked to hospital-acquired infections, poses substantial treatment difficulties, even with the use of the most advanced frontline therapies, such as carbapenems. The pathogen's capacity to develop resistance to newly introduced small-molecule antibiotics underscores the urgent requirement for a novel biological approach, which includes the use of nanoparticles alongside carbapenems and β-lactams as an additional treatment strategy to address this critical issue effectively.⁶⁷ The use of biosynthesized Ag-NPs in conjunction with meropenem demonstrated both synergistic and additive effects against carbapenem-resistant A. baumannii strains, effectively lowering the MIC of meropenem by 4–8 times.²⁰ Furthermore, the combination of polymyxin B and biosynthesized Ag-NPs exhibited a synergistic effect against four of the five tested strains of carbapenem-resistant A. baumannii, while showing an additive effect against one strain in the checkerboard assay, which resulted in a reduction of polymyxin B MIC by approximately 16-fold.¹⁹ Additionally, Haji et al.,⁶⁶ demonstrated that the combination of silver nanoparticles with antibiotics produced both synergistic and partially synergistic effects, as reflected in fractional inhibitory concentrations ranging from 0.13 to 0.56 against carbapenem-resistant Gram-negative bacteria.

Table 7.

Checkerboard assay of imipenem and Ag-NPs synergistic combinations against A. baumannii AB-4.

No	MIC Imipenem +MIC Ag-NPs	Imipenem +Ag-NPs (μg/mL)	FIC Imipenem +FIC Ag-NPs	FICI	interpretation
1	1/4MIC+1/4MIC	3.5 + 1.25	0.25 + 0.25	0.5	synergy
2	1/4MIC+1/8MIC	3.5 + 0.625	0.25 + 0.125	0.375	synergy
3	1/8MIC+1/4MIC	1.75 + 1.25	0.125 + 0.25	0.375	synergy

3.5. Time-kill assay

The killing kinetic technique was utilized to determine the minimum duration necessary for the combinations of imipenem and Ag-NPs to achieve either a bactericidal or bacteriostatic effect on bacterial cell viability following treatment.⁵⁴ In this study, the CRAB isolate AB-4 was subjected to treatment with various concentrations: ¼ MIC (0.43 + 0.31), ½ MIC (0.87 + 0.62), ¾ MIC (1.31 and 0.93), 1 MIC (1.75 and 1.25), and 2 MIC (3.5 and 2.5) μg/μg/mL for both imipenem and Ag-NPs, respectivly. These concentrations were derived from the lowest combination MIC value obtained through the checkerboard assay, as detailed in the accompanying Table 7, and the treatments were analyzed at various time intervals (0–12 h), as depicted in Fig. 3. The time-kill assay revealed the potency of imipenem-Ag-NPs in inhibiting and eliminating bacterial strains in a manner that is influenced by both dosage and time. The bactericidal properties of imipenem-Ag-NPs against bacterial isolate was confirmed by a substantial decrease in CFU/mL relative to the control (untreated, which exhibited growth), which showed a steady growth curve throughout the experiment. The bactericidal endpoint for imipenem-Ag-NPs against carbapenem-resistant A. baumannii isolate was attained after 2 and 4 h of incubation at 2 and 1 MIC values, respectively. On the other hand, all tested concentrations exhibited bacteriostatic effects while they inhibited the bacterial growth at levels below the initial inoculum but did not achieve complete eradication of the bacterial growth. The use of combination therapies significantly diminished the development of highly resistant bacterial strains. The minimum bactericidal concentration (MBC) was identified as the lowest concentration of active compounds capable of eliminating 99.9 % of the initial bacterial population.¹¹ For the timing of cell death, biosynthesized Ag-NPs were able to kill all CRAB and ATCC® 19606™ within 1 h. When combined Ag-NPs with polymyxin B resulted in a 16-fold decrease in the MIC of polymyxin B and contributed to a reduction in viable A. baumannii cells after 4 h of treatment, showcasing both synergistic and additive effects.¹⁹ Considering the duration needed for cell death, the combination of meropenem and biosynthesized Ag-NP was able to reduce bacterial levels to undetectable thresholds within a span of 10 min–24 h from inoculation.²⁰

Fig. 3.

Time-kill curve of combination imipenem and Ag-NPs at ¼ MIC. ½ MIC, ¾ MIC,1MIC and 2 MIC. ∗∗p < 0.001.

3.6. Detection of biofilm formation by CRAB isolates

The carbapenem-resistant Acinetobacter baumannii development of biofilm poses a major therapeutic challenge. The persistent nature of these infections, coupled with the organism's ability to form biofilms on medical devices and tissues, complicates treatment options. As a result, there is an urgent need for innovative therapeutic strategies and effective infection control measures to combat this growing public health threat.⁶⁸ In this study, the phenotypic assessment of biofilm-forming abilities was done through the use of Congo red agar and microtiter plate. It was found that all isolates formed biofilm by generating rough black colonies, and microtiter plate assays revealed that all isolates were classified as strong biofilm producers. Additionally, quantitative real-time PCR (qRT-PCR) analysis confirmed the presence of the OmpA and Bap genes in all CRAB isolates Table 8. The biofilm acts as an essential virulence factor in A. baumannii, governed by the quorum sensing (QS) system, which allows the bacteria to attach to host cell surfaces.³⁶ The capacity of bacteria to induce disease and their resilience against antimicrobial agents can be primarily attributed to their ability to form biofilms. These biofilms are structured communities that attach to surfaces and comprise one or more bacterial species, all surrounded by a protective and adhesive organic matrix referred to as extracellular polymeric substance (EPS). The occurrence of antibiotic resistance in biofilms is shaped by several factors, including the physical barrier created by the EPS matrix, which hinders diffusion, the spontaneous emergence of antibiotic-tolerant subpopulations known as persister cells, the rapid horizontal transfer of genetic material, and intercellular communication enabled by quorum sensing.⁶⁹ In our study, carbapenem-resistant A. baumannii isolates treated with a combination of imipenem and Ag-NPs at a half MIC value demonstrated completely inhibited biofilm formation, as depicted in Table 8 and Fig. 4A. The analysis of virulence gene OmpA and Bap expression after treating the CRPA isolate AB-4 with a combination of imipenem and Ag-NPs indicated a significant downregulation in the expression levels of Bap and OmpA genes 4.0-fold (p < 0.001) compared with the untreated control, which displayed high expression levels, as shown in Fig. 4B. These findings underscore the effective synergistic therapeutic potential of imipenem-Ag-NPs as an antibiofilm and antimicrobial agent in comparison to their components. Wintachai et al.⁷⁰ demonstrated that low concentration of biosynthesized Ag-NPs (0.09 μg/mL or 0.5 times the reported MIC) resulted in more than 90 % inhibition of viable multidrug-resistant A. baumannii (NPRCOE 160575), effectively hindering the attachment and subsequent biofilm formation of the bacteria in media suspension. Furthermore, the synergistic effect of meropenem and biosynthesized Ag-NP exhibits biofilm inhibition for the A. baumannii isolate and ATCC® 19606™, with inhibition rates of 21 % and 19 %, respectively. Additionally, this combination disrupts the biofilm by 22 %–50 %. Treatment with biosynthesized Ag-NP and meropenem results in a noticeable increase in nonviable cells in the biofilm of carbapenem-resistant A. baumannii strains.²⁰ In their study, Li and colleagues⁷¹ illustrated that the use of silver nanocomposite led to a notable reduction in the expression levels of the ompA gene, consequently preventing biofilm formation, as confirmed by real-time quantitative polymerase chain reaction (RT-qPCR).

Table 8.

Biofilm formation assessment before and after treatments.

Bacterial isolates	Biofilm formation
	Before treatment After treatment with IMP-Ag-NP
	CRA	MPA OD	Class	Biofilm genes		CR	CRA	MPA OD
				ompA	Bap
AB-1	+	0.197	Strong	+	+	+	-	0.012
AB-2	+	0.215	Strong	+	+	+	-	0.017
AB-3	+	0.205	Strong	+	+	+	-	0.009
AB-4	+	0.215	Strong	+	+	+	-	0.013
AB-5	+	0.196	Strong	+	+	+	-	0.010
AB-6	+	0. 267	Strong	+	+	+	-	0.010
AB-7	+	0.311	Strong	+	+	+	-	0.014
AB-8	+	0.246	Strong	+	+	+	-	0.016

CRA = Congo red agar, MPA = Microplate technique, ODc = Optical Density Control, OC= Optical Density, CR = carbapenem resistant grow.

Fig. 4.

Detectio biofilm from and associated genes, (A) Congo red agar detecting biofilm formation (A1) before and (A2) after treated with combination imipenem -Ag-NPs (A2), (B) relative expression of OmpA and of Bap genes by quantitative real-time PCR. ∗∗∗ p < 0.001.

3.7. In-vitro cytotoxicity of biosynthesized Ag-NPs and their combination with imipenem

To explore the clinical potential of Ag-NPs and their combination with imipenem as an antibacterial agent, it is crucial to assess their safety concerning normal cells. An in vitro study was conducted to investigate the cytotoxicity of Ag-NPs and their combination with imipenem against HFP-4 normal cell lines and HepG2 cancer cell lines at six specific concentrations 5, 10, 15, 20, 25, and 30 μg/mL. The findings indicates a pronounced concentration-dependent decrease in cell viability for both formulations within the concentration range of 5–30 μg/mL. Fig. 5A reveals Ag-NPs exhibit a cytotoxic effect, with cell viability decreasing approximately 15 % at 5 μg/mL and 54 % at 30 μg/mL for both cell lines. Statistical analysis indicated significant differences in viability across the concentration range (p < 0.0019). Fig. 5B demonstrated that imipenem-combination Ag-NPs displayed a somewhat reduced cytotoxicity profile in comparison to Ag-NPs alone. Cell viability diminished around 90 % at a concentration of 5 μg/mL to 62 % at 30 μg/mL across both cell lines. The statistical significance (p < 0.0019) supports the dose-dependent nature of the treatment effects. The IC50 values for Ag-NPs and their combination with imipenem were determined to be 26.13 ± 0.24 and 45.33 ± 0.21 μg/mL, respectively. These findings are consistent with results reported by Livhuwan et al.,⁷² who assessed cytotoxicity of biosynthesized Ag-NPs on human embryonic kidney cells (HEK293) and lung cancer cells (A549) using a 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide assay, revealing no significant cytotoxic effects. The IC₅₀ values were calculated to be 37.73 ± 0.34 μg/mL for HEK293 and 56.37 ± 0.73 μg/mL for A549, indicating a lack of significant adverse effects on these cell lines. The morphology of silver nanoparticles is likely to be a significant determinant in the cellular uptake mechanism, which ultimately affects their cytotoxic effects. Evidence suggests that the shape of nanoparticles considerably impacts several cytotoxicity parameters. For instance, spherical nanoparticles were found to have no negative impact on cytotoxicity in A549 cells, whereas wire-shaped nanoparticles resulted in harmful effects.⁷³ Furthermroe, a study was conducted using a range of cell lines, including macrophages (RAW 264.7, J774.1), A549, A498, HepG2, and neurons (Neuro 2 A), to assess cytotoxicity of synthesized Ag-NPs sized between 5 and 43 nm at a concentration of 2.0 mg/L. The results showed that the cell lines responded differently, with macrophages exhibiting the highest level of sensitivity. The internalization of Ag-NPs in macrophages was identified as occurring through the scavenger receptor pathway, which led to cytotoxic effects in the cytoplasm due to the release of Ag⁺. Both Ag-NPs and (AgNO₃) are highly effective agents, characterized by smaller average diameters (approximately 10 nm), and they exhibit cytotoxicity in human lung cells.⁷⁴ Additionally, the solubility of Ag-NPs is a significant factor influencing toxicity in lung epithelial cells; for example, Ag-NPs sized between 20 and 110 nm display toxicity in acidic phagolysosomes. Exposure of 20 nm Ag-NPs to HepG2 and Caco2 cells resulted in dose-dependent toxicity, DNA damage, mitochondrial impairment, and oxidative stress. In this context, two different sizes of Ag-NPs (10 and 100 nm) exposed to HepG2 cells led to cell proliferation, activation of mitogen-activated protein kinase (MAPK), and upregulation of c-Jun and c-Fos mRNA. Other cell lines, such as A2780, MCF-7, and MDA-MB 231, exhibited varying levels of toxicity when treated with 40 nm Ag-NPs at a concentration of 10 μg/mL.⁷³ The combination of biosynthesized Ag-NP and polymyxin B demonstrated a dose-dependent cytotoxicity towards mammalian VERO cells, with a notable decrease in cytotoxic effects when used together, leading to improved pharmacological safety.¹⁹

Fig. 5.

In vitro cytotoxicity study (A) Ag-NPs, (B) imipenem -Ag-NPs against HFP-4 and HepG-2 cells, ∗∗p < 0.0019.

3.8. Haemolylic activity of Ag-NPs and their combination with imipenem

Blood functions as the principal interface for nanoparticles introduced through intravenous routes while also providing the medium through which nanoparticles delivered by other means can reach their intended tissues or organs. The small size of these nanoparticles enables their extensive distribution throughout the body, which supports their ability to surmount biological barriers and enter systemic circulation, thereby allowing them to effectively penetrate cells.⁷⁵ Furthermore, the diminutive size of nanoparticles enhances their biological efficacy in comparison to larger particles, which can disrupt the typical biochemical environment within cells. As a result, the interactions between NPs and blood constituents are not only unavoidable but may also carry significant risks, highlighting the importance of hemocompatibility in the design and development of NPs intended for therapeutic use.⁷⁶ Fig. 6 represents hemolysis data that compares various treatments over two time intervals (12 and 24 h), with results quantified as a percentage of hemolysis. The positive control, Triton X-100, exhibited the highest level of hemolytic activity, measuring approximately 3.2 % at 12 h and 5.4 % at 24 h. In contrast, silver nanoparticles displayed lower hemolytic activity, with values of around 0.9 % at 12 h and 1.3 % at 24 h. The imipenem-conjugated silver nanoparticles showed even less hemolytic activity, recording approximately 0.7 % and 0.4 % at the respective time points. The negative control indicated minimal hemolysis, approximately 0.15 % at both time intervals, reflecting baseline levels. These findings reveal a significant disparity among the treatments, establishing a clear hierarchy of hemolytic activity: Triton X-100 > Ag-NPs > imipenem-Ag-NPs > negative control. Importantly, the conjugation of imipenem to silver nanoparticles seems to diminish their hemolytic potential, suggesting a more favorable safety profile for therapeutic use. The observed increase in hemolysis percentages from 12 to 24 h across all treatments, excluding the negative control, may imply a time-dependent stabilization of the hemolytic effect. This data underscores the potential biocompatibility of imipenem-conjugated silver nanoparticles for therapeutic applications, as they exhibit minimal hemolytic activity compared to both unconjugated nanoparticles and the positive control. The hemolytic activity of most nanoparticles is affected by factors such as concentration, structure, size, and shape.⁷⁵ The inquiry into the hemolytic properties of Ag-NPs revealed that neither Ag-NPs-SS nor Ag-NPs-Alb adversely affected blood samples obtained from healthy donors. The hemolysis coefficient for these samples was similar to the baseline level and did not exceed 1 %.⁷⁷ In contrast to our finding, Huang and his colleagues demonstrated that Ag-NPs have the potential to induce hemolysis and significantly affect the proliferation and viability of lymphocytes across all tested concentrations (10, 20, 40 μg/mL).⁷⁸

Fig. 6.

Hemolytic activity of Ag-NPs and their combination with imipenem. ∗p < 0.0161.

3.9. Limitations and prospects of the study

The authors recognize the limitations that are inherent in their study but convey optimism regarding the effectiveness of silver nanoparticles, whether used independently or in conjunction with imipenem formulations, in addressing the challenges presented by CRAB. However, several significant barriers must be addressed. The limited number of bacterial targets complicates the ongoing pursuit of entirely new compounds aimed at innovative targets. Furthermore, the risk of resistance development poses a substantial threat to these novel agents. Therefore, the combination of nanocarriers with established antibiotics may not only mitigate the rapid emergence of resistance and virulent bacterial factors but also enhance pharmacokinetics and targeting precision. A holistic approach that encompasses the creation of new compounds alongside the improvement of existing therapies through nanocarrier technologies is essential for ameliorating the current precarious situation. Nevertheless, achieving successful outcomes will necessitate collaborative efforts among policymakers, academic institutions, and the pharmaceutical industry.

4. Conclusion

In conclusion, the innovative green biosynthesis of silver nanoparticles from the cell-free filtrate of Streptomyces sp. signifies a major advancement in sustainable nanotechnology. This research not only verifies the successful creation of these nanoparticles but also underscores their beneficial biophysical attributes, ensuring stability within the 50 nm size range. The groundbreaking aspect of this study is that the biofabrication of silver nanoparticles does not involve any toxic substances. When compared to conventional techniques, this method is more economical, simpler to apply, and more eco-friendly, thus categorized as ‘green’. The biosynthesized Ag-NPs demonstrate considerable promise as biocompatible nanoparticles and in their effectiveness against carbapenem-resistant Acinetobacter baumannii. The development of biofilms associated with CRAB was successfully inhibited through the downregulation of genes associated with their formation. Furthermore, the combination of Ag-NPs with imipenem exhibits a synergistic effect, resulting in reduced MICs for both IMP and Ag-NPs from 14 to 5 μg/mL to 1.75 and 1.25 μg/mL, respectively. Additionally, these combinations show lower toxicity compared to Ag-NPs alone, with IC₅₀ values of 26.13 ± 0.24 and 45.33 ± 0.21 μg/mL, respectively. Moreover, the combinations of IMP and Ag-NPs display minimal hemolytic activity compared to Ag-NPs alone. These studies will provide essential insights into the potential therapeutic benefits of this combination, ultimately paving the way for more effective treatments against multidrug-resistant bacterial infections. Furthermore, understanding the pharmacokinetics and safety profile of this combination therapy will be vital for its successful clinical application. It is recommended that in vivo studies be conducted to evaluate the effectiveness of Ag-NPs in combination with imipenem.

CRediT authorship contribution statement

Mohamed Shawky: Writing – review & editing, Writing – original draft, Methodology, Investigation, Conceptualization. Mohamed H. Kalaba: Writing – review & editing, Writing – original draft, Supervision, Methodology, Investigation, Conceptualization. Gamal M. El-Sherbiny: Writing – review & editing, Supervision, Investigation, Formal analysis, Conceptualization.

Ethics approval and consent to participate

The Institutional Review Board of National Cancer Institute (NCI), Cairo University, Egypt, authorized all protocols and procedures (IRB number: IRB00004025; approval number: CB2309-302-071). Each participant signed their written informed consent form before enrolling in this study. All methods were performed following the relevant guidelines of ethical approval.

Funding

N/A.

Declaration of competing interest

We declare that we have no conflict of interest.

Data availability

All data generated or analyzed during this study are included in this published article.