Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Aug 15.
Published in final edited form as: Proc W Va Acad Sci. 2025 May 1;97(1):58–69.

Generation and comparison of broad-host range inducible expression vectors for use in Gram-negative bacteria including ESKAPE pathogens

Raj K Ginde 1,2, Nicholas A Stella 1, Rachel C Calvario 1, Kara M Lehner 1, Jake D Callaghan 1, Daniel R Komlosi 1, Joseph Horzempa 3, Robert M Q Shanks 1,*
PMCID: PMC12352128  NIHMSID: NIHMS2079237  PMID: 40822576

Abstract

The objective of this study is a controlled comparison of several carbohydrate inducible promoter in important bacterial species. Inducible promoter systems are invaluable for biotechnology and basic science applications. However, few inducible promoters are available on plasmids that replicate in Saccharomyces cerevisiae, which enables gap-repair recombination, or on broad host-range vectors, which allows replication in many Gram-negative genera. In this study we generated shuttle vectors with S. cerevisiae and the broad host range pBBR1 bacterial replicon. These contained a variety of inducible promoters and used a highly sensitive luxCDABE reporter in Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Pseudomonas fluorescens, and Serratia marcescens. Tested carbohydrate-inducible promoters were PBAD, PrhaB, PT5, and Pxut, isolated from A. baumannii. In the Enterobacterales the PBAD and PrhaB promoters demonstrated the highest levels of inducibility at 100- and 5,600-fold, respectively. For P. aeruginosa PrhaB and Pxut were the most inducible at 40- and 10-fold, respectively. For P. fluorescens all of the carbohydrate-inducible promoters had similar inducibility, under 10-fold. None of the carbohydrate-inducible promoters were effective for A. baumannii; however, they could be used as constitutive promoters. Data indicated that the rhamnose-inducible promoter excelled among the carbohydrate-inducible promoters for most tested organisms, and this study highlights the need for better inducible promoters for A. baumannii.

Keywords: inducible promoter, expression vector, Acinetobacter baumannii, Pseudomonas, Klebsiella pneumoniae, Serratia marcescens

Introduction

Inducible promoters are particularly valuable for applications to generate proteins and other biological molecules, molecular biology, and synthetic biology. In basic science, inducible promoters are used for complementation purposes, phenotypic analysis following overexpression of a gene, expression of antisense or regulatory RNAs, and for protein purification schemes. Understanding inducible promoter strength and leakiness, that is, the transcription of a gene without the presence of a corresponding inducer, are important factors in choosing the appropriate promoter.

Yeast in vivo cloning, based on gap repair (Szostak et al., 1983), has been a powerful tool to manipulate DNA and clone complex constructs (Goto & Nagano, 2013; Hokanson et al., 2003; Iizasa & Nagano, 2006; Ip et al., 2020; Nickerson et al., 2021; Raymond et al., 1999; Shashikant et al., 1998; Wang et al., 2012). This allows for simultaneous cloning of multiple pieces of DNA (Iizasa & Nagano, 2006; Ip et al., 2020; Shanks et al., 2006) and single oligomer mediated deletions and amino acid changes (Shanks et al., 2009). Our group has previously adapted this technology for use in gene expression and genome manipulation in bacteria (Callaghan et al., 2020; Kalivoda et al., 2011; Lehner et al., 2020; Shanks et al., 2006; Shanks et al., 2009). In this study, we generated S. cerevisiae shuttle vectors that expand on the number of inducible promoters and tested them in multiple genera of bacteria. These plasmids can also be used with in vivo cloning methods such as Gibson assembly (Gibson et al., 2009).

Many commercial expression vectors for Gram-negative bacteria have either ColE1 or p15a-based replicons that have limited host ranges. In this study, we used the broad host range pBBR1 replicon so that the resulting vectors could be used in a wide range of bacterial genera (Lynch & Gill, 2006).

We have previously evaluated the PBAD and Pxut promoters in Escherichia coli, Pseudomonas aeruginosa, and P. fluorescens, and used GFP as a reporter for promoter strength (Callaghan et al., 2020). GFP is a convenient reporter measurable by fluorescence, but has limited dynamic range. By contrast, luminescent reporters offer much higher signal to noise ratio and are better for detecting low levels of expression making them especially valuable for determining leakiness (Greer & Szalay, 2002). In this study, the luxCDABE reporter (Meighen, 1994) was used to evaluate promoter leakiness and strength of several plasmid-based inducible promoter systems in additional bacterial genera using vectors capable of being used for yeast in vivo cloning.

A rhamnose inducible promoter, PrhaB (Egan & Schleif, 1983), an isopropyl β-D-1-thiogalactopyranoside (IPTG) inducible hybrid promoter, PT5-lac (PT5) (Bujard et al., 1987; Kitagawa et al., 2005), and a tetracycline-inducible promoter were included in this study. Data presented here demonstrate different levels of promoter inducibility, background expression, and species-specific effects that can help researchers make more informed choices for controlled gene expression. We used strains of three genera of Enterobacterales: E. coli, Klebsiella pneumoniae, and Serratia marcescens. In addition, Acinetobacter baumannii and two Pseudomonas species were tested. Together, these represent some of the most important bacterial species in molecular biology, basic microbiology research, and human infections.

Materials and Methods

Strain and culture conditions

Bacteria used in this study were ATCC 17978 (Piechaud & Second, 1951) and B5, a multidrug-resistant clinical isolate for A. baumannii, S17-1 λ pir for Escherichia coli (Miller & Mekalanos, 1988), Kp2 (ATCC43816) for Klebsiella pneumoniae (Lee et al., 2014), Pf0-1 for Pseudomonas fluorescens (Deflaun et al., 1990), UCBPP-PA14 (PA14) for P. aeruginosa (Rahme et al., 1995), and Db11 (Flyg et al., 1980), K904 (Kalivoda et al., 2010), and K1496 (Shanks et al., 2015) for Serratia marcescens. Bacteria were grown in lysogeny broth (LB) (Bertani, 1951) at 30°C with aeration. Gentamicin was used at 10 μg/ml for E. coli and P. fluorescens and 30 μg/ml for P. aeruginosa.

E. coli EC100D (Lucigen Co) was transformed by electroporation using standard techniques (Dower et al., 1988), and into other organisms by conjugation. Ampicillin (150 μg/ml), chloramphenicol (30 μg/ml), nalidixic acid (20 μg/ml), or tetracycline (10 μg/ml) were used to inhibit donor E. coli growth following conjugation. E. coli strain HB101 (Kessler et al., 1992) was used as a helper strain in triparental mating.

Bacteria were grown at 30 or 37°C under shaking conditions.

Relative light unit (RLU) determination

Bacteria were transferred from frozen stocks to LB agar plates with gentamicin. Single colonies were used to inoculate 4.5 ml of LB broth with gentamicin and inducer at the noted concentration and/or water up to 500 μl. During and after growth for either 5 h or 18–20 h with indicated concentrations of inducer added at inoculation, 0.15 ml aliquots were taken and placed in clear bottomed, black sided plates (Nunc Optical Polystyrene polymer bottom). Luminescence was read with a Spectramax L luminometer, and optical density at 600 nm (OD600) was measured using a plate reader (BioTek Synergy 2 or Spectramax M3). The ratio of luminescence to optical density was used as RLU.

Molecular Biology

Several plasmids, listed in Table 1, were made for this study using yeast in vivo recombineering techniques as previously described (Shanks et al., 2006; Shanks et al., 2009). All primers are listed in Table 2. The linearized plasmid and amplicon were both introduced into Saccharomyces cerevisiae strain InvSc1 (Invitrogen), transformants were pooled, the plasmid DNA was obtained, and was used to transform electrocompetent E. coli S17-1. Transformants were screened by luminescence and colony PCR. The insert junctions of the resulting plasmids were verified by sequencing (University of Pittsburgh, Genomic Core) or by whole plasmid sequencing using Oxford Nanopore technology (PlasmidSaurus, Inc).

Table 1.

Plasmids made in this study.

Plasmid Descriptiona Inducer
pMQ670 Pxut - luxCDABE D-xylose
pMQ688 PrhaB – luxCDABE L-rhamnose
pMQ700 PBAD – luxCDABE L- arabinose
pMQ725 PT5-lac – luxCDABE IPTG
pMQ782 PrhaB – MCSb L-rhamnose
pMQ807 pMQ782 with yeast replicon removed L-rhamnose
Open in a new tab
a

all have oripBBR1 as a bacterial replicon; all have a gentamicin resistance marker, aacC1; plasmids have a RP4 origin of transfer.

b

MCS, multicloning site

Table 2.

Oligonucleotide primers used in this study.

Primer no. Sequence (5’ to 3’)a
923 CAGACCGCTTCTGCGTTCTG
4280 ccgccaattattctatttaccaagcttgcatgcgactagtTCAACTATCAAACGCTTCGG
4281 caagaacaacaaccaagaacaacaaggaggatttttgaATGACTAAAAAAATTTCATTCA
4362 gccctatcggctggatcgcttttgagtggccggctaTTAATCTTTCTGCGAATTGAGATG
4363 acctggccgttaataatgaatgaaatttttttagtcattcaaaaatcctcctttaattaaTCCTGCTGAATTTCATTACG
4283 ccgccaattattctatttaccaagcttgcatgcgactagtTCAACTATCAAACGCTTCGG
4284 caagaacaacaaccaagaacaacaaggaggatttttgaATGACTAAAAAAATTTCATTCA
4647 cattcaaaaatcctcctttaattaatcctgctgaaAATGAATTAATTCTGTGTGAAATTG
4648 agcccggagagcaagcccgtagggcgcattaatgcagGACACCATCGAATGGTGCAAAAC
5635 taccactccctatcagtgatagagaaaagtgaatcggtaaggaGGTCGACCCAAGGATCC
Open in a new tab
a

Upper case letters are for PCR amplification, lower case letters dictate recombination, and Italic letters indicate both.

To make pMQ670, the luxCDABE operon was amplified from pMQ713 (Romanowski et al., 2019) using primers 4280 and 4281 (Table 2) and the resulting amplicon was used to replace the gfp gene of pMQ650. The pMQ650 plasmid was cut with EcoR1 and BamH1 and used to co-transform S. cerevisiae along with the luxCDABE operon. To make pMQ688, the rhaRS-PrhaB region of E. coli strain W3110 (Bachmann, 1972) was cloned using primers 4362–3 and the amplicon was added to S. cerevisiae along with pMQ670 that had been digested with SfoI and SmaI. The pMQ700 plasmid was derived from pMQ457 by replacing lacZα with the luxCDABE operon from pMQ713. The operon was amplified using primers 4283 and 4284. The pMQ457 plasmid was cut with SmaI and combined with the luxCDABE amplicon to transform S. cerevisiae. To make pMQ725, the PT5-lac and lacI region from pIM1440 (Murin et al., 2012) was amplified with primers 4647–8 and was co-transformed with pMQ688 that had been digested with PacI and PvuI.

To make pMQ782, the luxCDABE operon was replaced in pMQ688 with an artificial multicloning site (MCS). The pMQ688 plasmid was digested with MfeI and SpeI and the digested plasmid was mixed with an artificial double stranded DNA fragment (Integrated DNA Technology). The sequence was (5’ to 3’) gaccaccgcgctactgccgccaggcaaattctgttttatcagaccgcttctgcgttctgatttaatctgtatcaggctgaaaatcttctctcatccgccaaTTATTCTATTTACCAAGCTTGCATGCGACTAGTTGGATCCTTGGGTCGACCtcctgctgaatttcattacgaccagtctaaaaagcgcctgaattcgcgaccttctcgttactgacaggaaaatgggccattggcaaccagggaaagat; the lowercase DNA to direct recombination with the plasmid and uppercase DNA that includes three translational stop sites in different frames, restriction sites, and a ribosome binding site. The resulting plasmid was screened by PCR and the entire plasmid was sequenced by PlasmidSaurus. The pMQ782 sequence was submitted to GenBank (ID: PP526039.1). A smaller variant was made by removing much of the yeast replicon by digesting pMQ782 with StuI which cuts in two places, and performing a unimolecular ligation with T4 ligase (New England Biolabs). The resulting plasmid, pMQ807, was verified by sequencing by PlasmidSaurus.

Carbohydrate inducible promoters evaluated in this study

Four carbohydrate inducible promoters (Figure 1) were cloned upstream of the luxCDABE reporter operon in a broad host-range vector with a pBBR1 replicon. Of the inducible promoters including regulatory transcription factor genes, PBAD was the shortest (under 1,200 bp) and PrhaB was the longest at over 2,000 bp. All of the regulatory genes originated from E. coli except xutR, which was isolated from P. fluorescens. The PT5-lac promoter, noted as PT5 throughout, is a hybrid bacteriophage and E. coli promoter. The plasmids were introduced into six different species and tested for induction over a 1,000-fold range of inducer and luminescence was measured at 18–20 hours and normalized by culture turbidity to generate relative luminescence units (RLU). In all cases RLU values for bacteria without the luxCDABE reporter were less than 103. This time point was chosen, because it is typical for many of the stationary phase-harvest studies done in our laboratory.

Figure 1. Schematic maps for the carbohydrate-inducible promoters used in this stud.

Figure 1.

Open in a new tab

Regulatory regions for the inducible promoter system cloned upstream of the luxCDABE reporter shown to scale.

Results

Evaluation of carbohydrate inducible promoters in E. coli

In this study, E. coli was used as a control to validate the plasmids and our system, as these promoters have been characterized previously in this species using plasmids with different replicons and copy numbers. Our series of plasmids with the same pBBR1-replicon and diverse promoters were introduced into E. coli strain S17-1 and tested for induction over a 1,000-fold range of inducer and luminescence was measured at 18–20 hours and normalized by culture turbidity to generate relative luminescence units (RLU). Pxut was not induced in E. coli, whereas PT5, PBAD, and PrhaB had dose dependent inducible profiles (Figure 2A). Plasmid leakiness (expression without inducer) was lowest in PBAD (3.7×104 RLU) and PrhaB (3.4×104 RLU) and higher in PT5 (7.3×104 RLU) and Pxut (7.5×104 RLU). PrhaB had the highest promoter strength at all tested inducer concentrations and highest overall inducibility when 10 mM of inducer was compared to the absence of inducer (672-fold) (Figure 2A). By contrast the fold-induction for the other promoters were 99.4 for PBAD, 7.7 for PT5 and 0.8 for Pxut.

Figure 2. Analysis of inducible promoter activity with variable inducer concentrations for three Enterobacterales bacteria.

Figure 2.

Open in a new tab

The average and standard deviation are shown, n≥4 independent replicates for each data point. PT5 refers to the PT5-lac promoter. A. E. coli strain S17-1. B. K. pneumoniae strain KP2. C. S. marcescens strain Db11. Left column shows relative luminescence units (RLU) and right column depicts fold change between RLU from higher inducer to no inducer. Means and SD are shown. Bacteria were grown at 30°C. Asterisks indicate significant differences by ANOVA with Tukey’s post-test. **, p<0.01; ***, p<0.001; ****, p<0.0001. For S. marcescens the asterisks over PT5 and Pxut show differences from PBAD.

Evaluation of sugar inducible promoters in K. pneumoniae

Pxut was poorly induced in K. pneumoniae strain KP2, up to 3-fold with maximal inducer, whereas PT5, PBAD, and PrhaB had pronounced dose dependent inducible profiles (Figure 2B). The PBAD and PrhaB promoters were largely indistinguishable. Plasmid leakiness (expression without inducer) was highest in PBAD (911 RLU) and PT5 (758 RLU) and lowest with PrhaB (345 RLU) and Pxut (401 RLU). PBAD and PrhaB had the highest promoter strength at all tested inducer concentrations, whereas PrhaB had the highest overall inducibility when 10 mM of inducer was compared to the absence of inducer (2,174-fold) (Figure 2A). This was followed by PBAD with 1,184-fold and PT5 with 120-fold induction (Figure 2B).

Evaluation of carbohydrate inducible promoters in S. marcescens strain Db11

E. coli and K. pneumoniae are Enterobacteriaceae; to test another family member of the order Enterobacterales, we used S. marcescens, which is in the Yersiniaceae family.

In S. marcescens strain Db11, expression of PBAD and PrhaB was similar (Figure 2C). PT5 and Pxut were poorly induced with only 8 and 3-fold higher expression when comparing the maximum inducer concentration compared to no inducer. Plasmid leakiness was low in all plasmids with a maximum of 685 RLU for PBAD. PrhaB had highest expression at all inducer concentrations and the highest overall inducibility when 10 mM of inducer was compared to the absence of inducer (5,612-fold); inducibility of PBAD was also high at 4,927-fold. (Figure 2C).

Unlike the other Enterobacterales bacteria tested, the PT5 was not strongly inducible in S. marcescens Db11. S. marcescens strains are generally unable to ferment lactose, although some biotypes such as A8c are lactose fermenters (Grimont & Grimont, 1978). The PT5 promoter was also not inducible in strain K904 that cannot use lactose as a sole carbon source (Figure 3). We tested whether the PT5 construct would be useful in a lactose fermenting S. marcescens isolate, strain K1496. Notably, the PT5 reporter plasmid showed a 358-fold induction with IPTG at 10 mM compared to 0 mM, whereas there was a less than 10-fold induction in strains unable to utilize lactose as a sole carbon source at the highest concentration (Figure 3).

Figure 3. Analysis of PT5-lac in additional S. marcescens strains.

Figure 3.

Open in a new tab

Strain K1496 can utilize lactose, and strain K904 does not utilize lactose. The average and standard deviation are shown, n≥6 independent replicates for each data point. A. Fluorescence across a range of inducer concentration. B. Fold induction of RFU for 10 mM / 0 mM. C. Background fluorescence with 0 mM inducer. Asterisks indicate significant differences by Student’s T-test. **, p<0.01; ***, p<0.001. Bacteria were grown at 30°C.

Evaluation of carbohydrate inducible promoters in P. fluorescens

RLU measurements from P. fluorescens strain Pf0-1 with the inducible plasmid is shown in Figure 4A. All of the plasmids were inducible, although none were above 10-fold (Figure 4A). The least leaky carbohydrate-inducible promoter was PBAD (1.7×105 RLU). The other promoters had higher levels of expression in the absence of inducer: 9.9×105 RLU for PrhaB, 4.9×105 RLU for PT5, and 1.8×106 RLU for Pxut. Fold induction of 10 mM compared to 0 mM was highest for PBAD and PrhaB at 6.1 and 6.4-fold induction, and lower for Pxut and PT5 at 4.3 and 2.6-fold, respectively (Figure 4A).

Figure 4. Analysis of inducible promoter activity with variable inducer concentration for two Pseudomonas species and A. baumannii.

Figure 4.

Open in a new tab

The average and standard deviation are shown, n≥6 independent replicates for each data point. A. P. fluorescens strain Pf0-1. B. P. aeruginosa strain PA14. C. A. baumannii ATCC 17978. Left column shows relative luminescence units (RLU) and right column depicts fold change between RLU from higher inducer to no inducer. Means and SD are shown. Asterisks indicate significant differences by ANOVA with Tukey’s post-test. *, p<0.05; ****, p<0.0001. Bacteria were grown at 30°C.

Evaluation of carbohydrate inducible promoters in P. aeruginosa

All tested promoters were inducible in P. aeruginosa strain PA14, with PBAD, Pxut and PrhaB all demonstrating similar high promoter strength at the highest level of inducer (Figure 4B). All of the promoters were leaky in the absence of the inducer. PBAD and Pxut promoters were the highly leaky (3.2×106 RLU and 8.2×105 RLU respectively), whereas the PT5 (2.9×105 RLU) and PrhaB (1.8×105 RLU) had relatively lower levels of expression in the absence of inducer. The PrhaB promoter had the highest inducibility at 10 mM of inducer compared to 0 mM of inducer, which was 44-fold (Figure 4B). The maximum induction level dropped to 11-fold for Pxut and 4-fold for both PBAD and PT5.

Evaluation of carbohydrate inducible promoters in A. baumannii

No significant differences were measured between the promoters in A. baumannii strain ATCC 17978 with respect to the fold difference between 0 and 10 mM inducer (Figure 4C). The magnitude of inducibility between 0 and 10 mM inducer was minimal: highest with PBAD (3.3-fold) and lowest for PT5 (1.0-fold). Overall promoter strength at maximum inducer (3.7×104 RLU) and background (1.1×104 RLU) were highest for Pxut, intermediate for PBAD (6.3×103 RLU at 10 mM and 2.4×103 RLU at 0 mM L-arabinose), and negligible for PrhaB and PT5 (<103 RLU).

Evaluation of background expression of each carbohydrate inducible promoter

Background expression of promoters without inducer is often undesirable. The RLU for each promoter under each condition was evaluated in the absence of inducer (Figure 5). In general, these were highest in Pseudomonas species and lowest in A. baumannii, K. pneumoniae, and S. marcescens.

Figure 5. Background luminescence with no inducer.

Figure 5.

Open in a new tab

Mean and SD are shown, n≥4. Asterisks indicate significant differences by ANOVA with Tukey’s post-test. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

Evaluation of PrhaB over time at 37°C

Prior experiments evaluated various promoters at a single time point after overnight growth at 30°C. To expand on this, experiments were performed to evaluate earlier time with a subset of organisms when grown at 37°C. Bacteria were grown overnight without induction and subcultured with inducer at 0.1 mM for rhamnose added at time 0 h. Luminescence and optical density were read over time 5h and the next day (Figure 6). For S. marcescens strain Db11 with PrhaB, luminescence increased starting at 3h (190-fold) and continued to increase through 5h where it was over 25,000-fold higher than at 0h (Figure 6). In the absence of inducer, luminescence increased 9.2-fold by 5h, which was remarkably lower than with 0.1 mM rhamnose. Rhamnose did not change growth of S. marcescens in these experiments (Figure 6).

Figure 6. Induction of PrhaB promoter over time at 37°C in S. marcescens Db11.

Figure 6.

Open in a new tab

PrhaB-dependent luminescence and growth of S. marcescens strain Db11 (Sm) over time. Inducer and vehicle negative control were added at time = 0. Mean and SD are shown, n=4–6.

Generation of a PrhaB vector with a multicloning site

The plasmids in this study have limited restriction sites for standard cloning approaches. While we have previously generated plasmids with PBAD and Pxut promoters that contain multicloning sites (Callaghan et al., 2020; Shanks et al., 2009), we have not made one for PrhaB. To address this, the luxCDABE operon was replaced with an artificial multicloning site with unique restriction sites for BamHI, HinDIII, SalI, SpeI, and SphI, a ribosome binding site, and stop codons in three frames to make pMQ782. The resulting plasmid was further altered by removal of the URA3 and CEN6/ARSH4 region to reduce its size by digestion with StuI followed by unimolecular ligation to generate pMQ807.

Discussion

Carbohydrate inducible promoters are widely used and helpful for numerous applications; however, they can have limitations (Brautaset et al., 2009). These include potential alteration of the catabolite repression system of the host bacterium which can result in pleiotropic effects (McMackin et al., 2021), the utilization of the inducer for energy which reduces the concentration of this molecule, and induced expression in only a subset of bacteria in a given population (Callaghan et al., 2020; Khlebnikov et al., 2000). These limitations were not evaluated in this study due to the use of a luminescent reporter, and will have to be evaluated using fluorescent reporters in the future. Luminescent reporters provide exceptional sensitivity and dynamic range, but like all reporters are indirect readouts for transcription and do not take into consideration the half-life of a given transcript. Expression of individual genes will have to be determined in a case-by-case manner.

The results reported here demonstrate that for Enterobacterales, PBAD and PrhaB are useful inducible promoters that can be highly tuned based on inducer concentration. The PT5 promoter worked well with K. pneumoniae, but was moderately effective in E. coli and strain-dependent in S. marcescens. The copy number of the plasmid likely differs between species, so no quantitative comparisons were made between species.

For P. aeruginosa, the PrhaB promoter was more inducible than the widely used PBAD and conferred very strong expression at 0.1 and 1.0 mM inducer concentration. PBAD and Pxut were also strong promoters in P. aeruginosa, but the PrhaB promoter had better sensitivity and the lowest leakiness. None of the inducible promoters were particularly strong for P. fluorescens. While Pxut was the strongest, it was poorly inducible. PrhaB and PBAD had the highest inducibility and PBAD had the lowest leakiness.

For A. baumannii, none of the promoters were highly inducible. This highlights the need for better inducible systems for this important opportunistic pathogen.

Among the tested carbohydrate-inducible promoters, the PrhaB promoter arguably performed the best in the assays based on maximum induction and low leakiness for most tested bacteria. Induction levels between no inducer and the lowest inducer concentration were generally greatest for PrhaB. In addition, rhamnose and xylose are relatively inexpensive compared to arabinose and IPTG. One minor negative of PrhaB is the larger size of the promoter and regulator genes; this yields larger vectors that may have lower transformation efficiency.

In all cases, easily measurable levels of transcript were detected in the absence of inducer. This background could be reduced by using lower copy replicons such as RK2 or integration of the promoter/regulator genes into the bacterial chromosome. Another issue not tested was whether the promoter is expressed in every cell or just a subset of cells as has been demonstrated for PBAD (Siegele & Hu, 1997) and Pxut (Callaghan et al., 2020); as these assays are easier with fluorescent reporters. The use of carbohydrates as inducers also has limitations. Carbohydrates can be catabolized by wild-type organism changing inducer concentration over time and affecting carbon regulation systems that could have unintended effects. This study was also limited by the chosen inducer concentrations, time of inducer addition, and temperatures. Nevertheless, we have generated broad host-range vectors with convenient restriction sites that should be effective for controlled gene expression in a number of microbes, they were effective in evaluating the different promoters in a number of genera.

Acknowledgements

We thank Janet Lee and George O’Toole for the kind gift of strains and plasmids. This study was funded by National Institutes of Health grants R01EY032517, R01EY036686 (RS), R01AI104895 (YD), R15HL147135 (JH), and CORE Grant P30 EY08098 to the Department of Ophthalmology. Additional departmental funding was provided by the Eye and Ear Foundation of Pittsburgh and from an unrestricted grant from Research to Prevent Blindness, New York, NY.

Literature Cited

  1. Bachmann BJ (1972). Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol Rev, 36(4), 525–557. https://www.ncbi.nlm.nih.gov/pubmed/4568763 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bertani G (1951). Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J Bacteriol, 62(3), 293–300. 10.1128/jb.62.3.293-300.1951 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brautaset T, Lale R, & Valla S (2009). Positively regulated bacterial expression systems. Microb Biotechnol, 2(1), 15–30. 10.1111/j.1751-7915.2008.00048.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bujard H, Gentz R, Lanzer M, Stueber D, Mueller M, Ibrahimi I,…Dobberstein B (1987). A T5 promoter-based transcription-translation system for the analysis of proteins in vitro and in vivo. Methods Enzymol, 155, 416–433. https://www.ncbi.nlm.nih.gov/pubmed/2828874 [DOI] [PubMed] [Google Scholar]
  5. Callaghan JD, Stella NA, Lehner KM, Treat BR, Brothers KM, St Leger AJ, & Shanks RMQ (2020). Generation of Xylose-inducible promoter tools for Pseudomonas species and their use in implicating a role for the Type II secretion system protein XcpQ in inhibition of corneal epithelial wound closure. Appl Environ Microbiol. 10.1128/AEM.00250-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Deflaun MF, Tanzer AS, McAteer AL, Marshall B, & Levy SB (1990). Development of an Adhesion Assay and Characterization of an Adhesion-Deficient Mutant of Pseudomonas fluorescens. Appl Environ Microbiol, 56(1), 112–119. https://www.ncbi.nlm.nih.gov/pubmed/16348082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dower WJ, Miller JF, & Ragsdale CW (1988). High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res, 16(13), 6127–6145. 10.1093/nar/16.13.6127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Egan SM, & Schleif RF (1983). A regulatory cascade in the induction of rhaBAD. J Mol Biol, 234(1), 87–98. 10.1006/jmbi.1993.1565 [DOI] [PubMed] [Google Scholar]
  9. Flyg C, Kenne K, & Boman HG (1980). Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J Gen Microbiol, 120(1), 173–181. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=7012273 [DOI] [PubMed] [Google Scholar]
  10. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, & Smith HO (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods, 6(5), 343–345. 10.1038/nmeth.1318 [DOI] [PubMed] [Google Scholar]
  11. Goto K, & Nagano Y (2013). Ultra-low background DNA cloning system. PLoS One, 8(2), e56530. 10.1371/journal.pone.0056530 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Greer LF, & Szalay AA (2002). Imaging of light emission from the expression of luciferases in living cells and organisms: a review [Review]. Luminescence, 17(1), 43–74. 10.1002/bio.676 [DOI] [PubMed] [Google Scholar]
  13. Grimont PA, & Grimont F (1978). Biotyping of Serratia marcescens and its use in epidemiological studies. J Clin Microbiol, 8(1), 73–83. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=353073 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hokanson CA, Dora E, Donahue BA, Rivkin M, Finer M, & Mendez MJ (2003). Hybrid yeast-bacteria cloning system used to capture and modify adenoviral and nonviral genomes. Hum Gene Ther, 14(4), 329–339. 10.1089/104303403321208934 [DOI] [PubMed] [Google Scholar]
  15. Iizasa E, & Nagano Y (2006). Highly efficient yeast-based in vivo DNA cloning of multiple DNA fragments and the simultaneous construction of yeast/ Escherichia coli shuttle vectors. Biotechniques, 40(1), 79–83. 10.2144/000112041 [DOI] [PubMed] [Google Scholar]
  16. Ip K, Yadin R, & George KW (2020). High-Throughput DNA Assembly Using Yeast Homologous Recombination. Methods Mol Biol, 2205, 79–89. 10.1007/978-1-0716-0908-8_5 [DOI] [PubMed] [Google Scholar]
  17. Kalivoda EJ, Horzempa J, Stella NA, Sadaf A, Kowalski RP, Nau GJ, & Shanks RM (2011). New vector tools with a hygromycin resistance marker for use with opportunistic pathogens. Mol Biotechnol, 48(1), 7–14. 10.1007/s12033-010-9342-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kalivoda EJ, Stella NA, Aston MA, Fender JE, Thompson PP, Kowalski RP, & Shanks RM (2010). Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens. Res Microbiol, 161(2), 158–167. https://doi.org/S0923-2508(09)00256-3 [pii] 10.1016/j.resmic.2009.12.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kessler B, de Lorenzo V, & Timmis KN (1992). A general system to integrate lacZ fusions into the chromosomes of Gram-negative eubacteria: regulation of the Pm promoter of the TOL plasmid studied with all controlling elements in monocopy. Mol Gen Genet, 233, 293–301. 10.1007/BF00587591 [DOI] [PubMed] [Google Scholar]
  20. Khlebnikov A, Risa O, Skaug T, Carrier TA, & Keasling JD (2000). Regulatable arabinose-inducible gene expression system with consistent control in all cells of a culture. J Bacteriol, 182(24), 7029–7034. 10.1128/jb.182.24.7029-7034.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kitagawa M, Ara T, Arifuzzaman M, ILIoka-Nakamichi T, Inamoto E, Toyonaga H, & Mori H (2005). Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res, 12(5), 291–299. 10.1093/dnares/dsi012 [DOI] [PubMed] [Google Scholar]
  22. Lee C-S, Vasoo S, Hu F, Patel R, & Doi Y (2014). Klebsiella pneumoniae ST147 coproducing NDM-7 carbapenemase and RmtF 16S rRNA methyltransferase in Minnesota. J Clin Microbiol, 52(11), 4109–4110. 10.1128/JCM.01404-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lehner KM, Stella NA, Calvario RC, & Shanks RMQ (2020). mCloverBlaster: a tool to make markerless deletions and fusion using lambda red and I-SceI in Gram-negative bacterial genomes. J Microbiol Methods, 178. 10.1016/j.mimet.2020.106058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lynch MD, & Gill RT (2006). Broad host range vectors for stable genomic library construction. Biotechnol Bioeng, 94(1), 151–158. [DOI] [PubMed] [Google Scholar]
  25. McMackin EAW, Corley JM, Karash S, Marden J, Wolfgang MC, & Yahr TL (2021). Cautionary Notes on the Use of Arabinose- and Rhamnose-Inducible Expression Vectors in Pseudomonas aeruginosa. J Bacteriol, 203(16), e0022421. 10.1128/JB.00224-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Meighen EA (1994). Genetics of bacterial bioluminescence. Annu Rev Genet, 28, 117–139. 10.1146/annurev.ge.28.120194.001001. [DOI] [PubMed] [Google Scholar]
  27. Miller VL, & Mekalanos JJ (1988). A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol, 170, 2575. 10.1128/jb.170.6.2575-2583.1988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Murin CD, Segal K, Bryksin A, & Matsumura I (2012). Expression vectors for Acinetobacter baylyi ADP1. Appl Environ Microbiol, 78(1), 280–283. 10.1128/AEM.05597-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nickerson DP, Quinn MA, & Milnes JM (2021). Rapid conversion of replicating and integrating Saccharomyces cerevisiae plasmid vectors via Cre recombinase. G3 (Bethesda), 11(12). 10.1093/g3journal/jkab336 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Piechaud M, & Second L (1951). Studies of 26 strains of Moraxella lwoffi. Ann Inst Pasteur (Paris), 80(1), 97–99. [PubMed] [Google Scholar]
  31. Rahme LG, Stevens EJ, Wolfort SF, Shao J, Tompkins RG, & Ausubel FM (1995). Common virulence factors for bacterial pathogenicity in plants and animals. Science, 268(5219), 1899–1902. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=7604262 PA14 introduction [DOI] [PubMed] [Google Scholar]
  32. Raymond CK, Pownder TA, & Sexson SL (1999). General method for plasmid construction using homologous recombination. Biotechniques, 26(1), 134–138, 140–131. 10.2144/99261rr02 [DOI] [PubMed] [Google Scholar]
  33. Romanowski EG, Lehner KM, Martin NC, Patel KR, Callaghan JD, Stella NA, & Shanks RMQ (2019). Thermoregulation of prodigiosin biosynthesis by Serratia marcescens is controlled at the transcriptional level and requires HexS. Pol J Microbiol, 68(1), 43–50. 10.21307/pjm-2019-005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shanks RM, Caiazza NC, Hinsa SM, Toutain CM, & O’Toole GA (2006). Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl Environ Microbiol, 72(7), 5027–5036. 10.1128/AEM.00682-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Shanks RM, Kadouri DE, MacEachran DP, & O’Toole GA (2009). New yeast recombineering tools for bacteria. Plasmid, 62(2), 88–97. 10.1016/j.plasmid.2009.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shanks RM, Stella NA, Hunt KM, Brothers KM, Zhang L, & Thibodeau PH (2015). Identification of SlpB, a Cytotoxic Protease from Serratia marcescens. Infect Immun, 83(7), 2907–2916. 10.1128/IAI.03096-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shashikant CS, Carr JL, Bhargava J, Bentley KL, & Ruddle FH (1998). Recombinogenic targeting: a new approach to genomic analysis--a review. Gene, 223(1–2), 9–20. 10.1016/s0378-1119(98)00369-2 [DOI] [PubMed] [Google Scholar]
  38. Siegele DA, & Hu JC (1997). Gene expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represents mixed populations. Proc Natl Acad Sci U S A, 94(15), 8168–8172. 10.1073/pnas.94.15.8168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Szostak JW, Orr-Weaver TL, Rothstein RJ, & Stahl FW (1983). The double-strand-break repair model for recombination. Cell, 33(1), 25–35. 10.1016/0092-8674(83)90331-8 [DOI] [PubMed] [Google Scholar]
  40. Wang T, Ma X, Zhu H, Li A, Du G, & Chen J (2012). Available methods for assembling expression cassettes for synthetic biology. Appl Microbiol Biotechnol, 93(5), 1853–1863. 10.1007/s00253-012-3920-8 [DOI] [PubMed] [Google Scholar]

RESOURCES