Abstract
Mutations in the forkhead transcription–factor gene (FOXC1), have been shown to cause defects of the anterior chamber of the eye that are associated with developmental forms of glaucoma. Discovery of these mutations was greatly facilitated by the cloning and characterization of the 6p25 breakpoint in a patient with both congenital glaucoma and a balanced-translocation event involving chromosomes 6 and 13. Here we describe the identification of novel mutations in the FOXC1 gene in patients with anterior-chamber defects of the eye. We have detected nine new mutations (eight of which are novel) in the FOXC1 gene in patients with anterior-chamber eye defects. Of these mutations, five frameshift mutations predict loss of the forkhead domain, as a result of premature termination of translation. Of particular interest is the fact that two families have a duplication of 6p25, involving the FOXC1 gene. These data suggest that both FOXC1 haploinsufficiency and increased gene dosage can cause anterior-chamber defects of the eye.
Introduction
Glaucoma is the second leading cause of vision loss worldwide, with an estimated 6.7 million people blinded by this disorder (Quigley 1996). Much progress has been made during the past few years in the identification of the genes and loci responsible for this heterogeneous group of disorders. This recent progress includes the discovery that mutations in the MYOC (MIM 601652) gene are responsible for many cases of the relatively rare juvenile-onset form of primary open-angle glaucoma, as well as for a small subset of the more common, adult-onset form of the disease (Stone et al. 1997; Fingert et al. 1999; Alward 2000). In addition, the cytochrome P450, subfamily I, polypeptide 1 gene (CYP1B1 [MIM 601771]) has been shown to be one of the genes involved in primary congenital glaucoma (Stoilov et al. 1997). Progress has also been made in the identification of genes responsible for developmental forms of glaucoma. To date, the genes responsible for developmental forms of glaucoma have proved to be transcription factors.
One developmental anomaly associated with congenital glaucoma is the Axenfeld-Rieger anomaly (ARA). ARA consists of a spectrum of developmental defects of the anterior chamber of the eye, with wide variability in expression. When these defects are associated with extraocular findings of maxillary hypoplasia, hypodontia, microdontia, and umbilical abnormalities, the disorder is known as “Axenfeld-Rieger syndrome” (ARS). The PITX2 (MIM 601542) gene at 4q25 has been identified as the gene involved in the development of Rieger syndrome, type 1 (MIM 180500) (Semina et al. 1996). A number of phenotypically similar disorders associated with glaucoma and involving development of the anterior chamber of the eye have also been localized to the distal short arm of chromosome 6 (Mears et al. 1996; Gould et al. 1997; Graff et al. 1997; Jordan et al. 1997). Mutations in the forkhead/winged-helix transcription-factor gene FOXC1 (previously referred to as “FKHL7” [MIM 601090]) have been identified in numerous families with ARA (Mears et al. 1998; Nishimura et al. 1998). However, mutations in FOXC1 were not found in all families with goniodysgenesis or with ARA linked to 6p; this has prompted speculation that a second locus involved in the development of the anterior chamber of the eye may exist within 6p25 (Mears et al. 1998). Another locus for ARS, RIEG2 (MIM 601499), has been mapped genetically to 13q14 in a single large family (Phillips et al. 1996). In addition, there is evidence, from the FOXC2-knockout mouse (Smith et al. 2000), that defects in the FOXC2 gene (MIM 602402) at 16q24 may also be responsible for a subset of ARA. However, screening of a cohort of patients with ARA did not demonstrate any mutations in this gene (Smith et al. 2000).
In this study we have screened for FOXC1 mutations in a cohort of patients who exhibit abnormalities of the anterior chamber of the eye. Nine mutations were detected, eight of which had been unreported previously. Among these mutations are two partial 6p25 duplications, both of which include the FOXC1 gene, found in two families. The spectrum of mutations detected in FOXC1 suggests that precise regulation of expression of this gene is needed for normal eye development.
Patients/Families and Methods
Patients and Families
Patients were identified either through the Department of Ophthalmology at the University of Iowa or by investigators collaborating at other institutions. A signed informed-consent form was obtained from each patient prior to the collection of a sample of whole blood (5–10 ml) by protocols approved by the Institutional Review Board at the University of Iowa. Genomic DNA was isolated through use of methods that have been published elsewhere (Nishimura et al. 1998).
Mutation Screening
Screening of the FOXC1 gene was performed by a combination of sequencing and SSCP analysis. Direct sequencing of the coding region was carried out both for the 5′ portion of the gene, including the forkhead DNA-binding domain, and for the 3′ region of the gene. Mutation detection in the remainder of the gene proved to be difficult to accomplish by sequence analysis, because of the presence of two polymorphic polyglycine tracts. Thus, this region was screened by SSCP analysis. Mutation screening for the PITX2 gene was performed by sequence analysis with previously published primers, as well as with some new primers designed to cover the proximal and distal portions of the gene. These new primer pairs are RG3-forward (CCTGTCATCACAAGAGCATG) and reverse (CTGGCCAGGCTCGAGTTACA); and RG4-forward (GCCGCCGACTCCTCCGTATG) and reverse (GGTCCTAGGATCCCGGCGCT). Sequence analysis was carried out by the direct sequencing of PCR products, by previously published protocols, on ABI 373 and 377 sequencers. Variants detected by the SSCP analysis were also characterized by direct sequencing.
Marker Development and Genotyping
Sequence data for selected plasmid artificial chromosomes (PACs) in the 6p25 region were downloaded from The Sanger Centre Web site and, for analysis, were imported into SEQUENCHER, version 3.1.1 (GeneCodes). Each sequence was analyzed manually for the presence of short tandem repeats (STRs), with a requirement that there be ⩾28 consecutive base pairs of repetitive DNA. A variety of such repetitive sequences was detected with 2-, 3-, and 4-bp repeat units. Primers were selected manually to PCR-amplify these repeats such that each amplified fragment was <250 bp. The primers were synthesized commercially (Research Genetics) and were tested both for PCR amplification and for polymorphic content. The PCR conditions have been published elsewhere (Nishimura et al. 1998). The heterozygosity of each STRP was determined by the genotyping of 14 unrelated white individuals. A subset of these STRPs was used for the analysis of samples of DNA from the patients.
Physical Mapping
Construction of the physical map through use of YACs has been described elsewhere (Nishimura et al. 1998). PACs were identified by BLASTN analysis, with sequences that were derived from a variety of sequence-tagged sites (STSs) within the 6p25 region surrounding the FOXC1 gene and that were compared against the high throughput genomic sequence database. Other physical-mapping information (FISH analysis by The Sanger Centre) was also used to confirm the localization of the PACs to the distal region of 6p. STSs from this region were tested for amplification from the PACs, to confirm the results of the BLASTN analysis.
Duplication Analysis
Genomic DNA samples from families RG-5 and RG-253 were amplified under conditions that have been described elsewhere (Nishimura et al. 1998). Results of genotyping were examined visually for either the presence of three alleles or for intensity differences between alleles, for each genotyping reaction. The difference in allele intensity was confirmed by densitometry for two polymorphisms that are located within the FOXC1 gene. Charge-coupled–device images of the silver-stained gels were analyzed with the NIH Image, version 1.62 software package, which is available from the NIH Image Web site. Visual inspection and densitometry of PCR products also confirmed linear amplification of the PCR reactions for the FOXC1 polymorphisms. A range of amplification cycles (25, 30, 35, 40, and 45) was used to demonstrate that the PCR conditions used for amplification of the FOXC1 polymorphisms was within the linear portion of the amplification profile.
Results
Mutations in Patients with Anterior-Chamber Defects
A total of 70 probands with congenital anterior-chamber defects of the eye were screened for mutations within the coding region of FOXC1, through use of a combination of SSCP and sequence-based screening assays. These patients had been screened previously for mutations in the PITX2 gene and had not been found to harbor any pathological PITX2 variants. Nine FOXC1 mutations were detected, eight of which were novel. Five of these mutations cause a translational-reading-frame alteration that results in premature termination of the FOXC1 transcript. Table 1 presents a summary of all FOXC1 mutations described to date. The location of each mutation within the FOXC1 gene is illustrated in figure 1.
Table 1.
Summary of All Published FOXC1 Mutations.
| Diagnosis | Positiona | Mutation | Reference |
| Axenfeld anomaly | 26–47 | 22-bp insertion | Present study |
| ARS | 67 | Gln23Stop | Mears et al. (1998) |
| ARA | 93–102 | 10-bp deletion | Mears et al. (1998) |
| Axenfeld anomaly | 99–108 | 10-bp deletion | Present study |
| Rieger anomaly | 116–122 | 8-bp deletion | Present study |
| Axenfeld anomaly | 153–162 | 11-bp deletion | Nishimura et al. (1998) |
| Rieger anomaly | 210 | 1-bp deletion | Swiderski et al. (1999) |
| Rieger anomaly | 236 | Pro79Leu | Present study |
| IRID1 | 245 | Ser82Thr | Mears et al. (1998) |
| ARA | 261 | Ile87Met | Mears et al. (1998) |
| ARA | 262–265 | 1-bp insertion | Present study |
| Rieger anomaly | 335 | Phe112Ser | Nishimura et al. (1998) |
| Axenfeld anomaly | 378 | Ile126Met | Nishimura et al. (1998) |
| Axenfeld anomaly | 392 | Ser131Leu | Nishimura et al. (1998) |
| Rieger anomaly | 392 | Ser131Leu | Present study |
| Axenfeld anomaly | 1512 | 1-bp deletion | Present study |
| Iris hypoplasia | NA | 6p25 duplication | Present study |
| Peter anomaly | NA | 6p25 duplication | Present study |
| Peter anomaly | NA | 2;6 unbal trans | Nishimura et al. (1998) |
| Congenital glaucoma | NA | 6;13 bal trans | Nishimura et al. (1998) |
NA = not applicable.
Figure 1.
Summary of the mutations detected in this study and of those that have been published elsewhere (Mears et al. 1998; Nishimura et al. 1998; Swiderski et al. 1999; Mirzayans et al. 2000). The hatched boxes indicate the location of the forkhead domain within the FOXC1 coding sequence. The two white boxes represent the locations of two polymorphic poly-glycine tracts (Mears et al. 1998) that are labeled “Fkh8” and “Fkh10” in figure 4. The distribution of missense, nonsense (indicated by *), and frameshift mutations are illustrated. The predicted protein translations are shown below the gene diagram for the frameshift mutations. The blackened boxes represent those areas of the protein that, because of the frameshift mutations, are translated differently than the normal FOXC1 protein.
Three frameshift mutations were detected upstream of the forkhead domain: a 22-bp insertion (position 26–47) and a 10-bp deletion (position 99–108) were each found in a single proband diagnosed with Axenfeld anomaly, and an 8-bp deletion (position 116–123) was detected in a proband diagnosed with Rieger anomaly. This mutation was also detected in the similarly affected sibling of the proband. All three of these mutations predict premature termination of translation and production of proteins (comprising 88, 40, and 78 amino acids, respectively) that lack a forkhead domain.
A single-base insertion (C at a location between positions 262 and 265) was detected within the forkhead domain in a single proband diagnosed with ARA. This mutation results in a truncated FOXC1 protein of 304 amino acids that contains the first 16 amino acids of the forkhead domain. In one proband with Rieger anomaly, a novel C236T mutation was detected that results in a proline-to-leucine change at the seventh amino acid of the forkhead domain. In addition, the Ser131Leu mutation that had been seen previously in a family with Axenfeld anomaly was again detected in a single proband diagnosed with Rieger anomaly. This is the first reported instance of a FOXC1 mutation being found in apparently unrelated patients.
Finally, a single mutation was found downstream of the forkhead domain. This mutation involves a single-nucleotide deletion that was found in two siblings who were diagnosed with Axenfeld anomaly. The deletion occurred at position 1512 and is predicted to produce a truncated protein product of 517 amino acids. This mutant protein contains the entire forkhead domain but is missing the last 49 amino acids of the normal FOXC1 protein. None of the changes reported in this study have been detected in 96 control individuals from an ethnically similar population.
Physical Map of 6p25
Physical mapping information, along with sequence data from The Sanger Centre, was used to identify PACs that were likely to map to 6p25. DNA sequences from the PAC inserts were screened by BLASTN analysis, with STSs that had previously been placed on a YAC-based physical map (Nishimura et al. 1998). The locations of the PACs are shown in figure 2. The sequences of these PACs were then screened for the presence of STRs of ⩾30 consecutive base pairs. A total of 30 STRPs were developed that were good candidates for having a high level of polymorphism in the human population (table 2). Two additional forkhead genes, FOXF2 [MIM 603250] and HFH1, were also placed within this physical map.
Figure 2.
Physical map of the 6p25 region that surrounds the FOXC1 gene. The approximate location of the proposed IRID1B locus (Mears et al. 1998) is shown. The approximate location of PACs sequenced by The Sanger Centre is shown at the bottom of the figure. Genetic markers derived from these sequences are listed in table 2.
Table 2.
Genetic Markers Developed from the 6p25 Region
|
Sequence |
||||||||
| Marker Name | Repeat Class | Repeat Number | Expected Size(bp) | Temperature(°C) | Status of Polymorphism | Heterozygosity(%) | Forward | Reverse |
| 20B11-GT | GT | 14 | 143 | 53 | Present | 50.00 | TAGAGGTTTGAAAAGTATATG | CACTGCAGTGGATCAGTAGCT |
| 20B11-AC | AC | 13 | 141 | 51 | Present | 71.43 | TTTGAGCACAGCCTCAAATAG | TCTCCTTAAATACATGTATAC |
| 856G1-GT | GT | 16 | 147 | 55 | Present | 15.38 | AAAACGTAGGTTGGTGACATG | ACTTACTGCAAATGAGCCAGT |
| 856G1-TG | TG | 15 | 121 | 65 | Present | 38.46 | GACTCCAGCCTTCTAAGGCGA | CCTCCAGCACTGTGCCAGGCA |
| 668J24-GT | GT | 17 | 168 | 55 | Present | 85.71 | ATCTTAAAGGAGCTCTACTGA | CTGAATGTTTCCAAAGCCCGT |
| 668J24-GATA | GATA | 12 | 144 | 52 | Present | 71.43 | GGATAGATGGATGGACAGATG | CATCCATGTATCTATCATCTA |
| 668J24-CA1 | AC | 12 | 150 | 57 | Present | 35.71 | CCAGCCTGAGCAACAAAGCGA | CCTAACCGTCTCTTCTGTGCT |
| 668J24-CA2 | CA | 21 | 182 | 42 | Present | 85.71 | ATTTCAACAAGTAACCAATAC | GGGAGGGCAGCTGGCAGGCTG |
| 668J24 -GCC | GCC | 9 | 149 | CGCCGCGCGTGCAGCCCGGTC | GAGGACGAGGACGAGGCGCAG | |||
| 118B18-GT | GT | 24 | 134 | 55 | Present | 85.71 | AAGCAAGATCCATGTTGCTGA | CTCAACATCTACAGTCCTAC |
| 118B18-AC | AC | 15 | 116 | 55 | Present | 64.29 | AGAATATGGGTCAGAGCTGCA | TAAAGAGCTATAGCACTTGAT |
| 279I9-GT | GT | 16 | 132 | 55 | Present | 85.71 | AGCCTACAGACTCGGGTCTCA | GGATGGGTGCTCTATCAACTG |
| 279I9-TG | TG | 23 | 225 | 53 | Present | 85.71 | ATATGAAAATCATACCACAGT | GCACTCATTCCAAAGTTCTAG |
| 136B1-GAAA | GAAA | 12 | 187 | 55 | Present | 78.57 | CCACCATTCCCAGCCAGATGC | AGTAGGCTTTCCTCTGCTCAG |
| 136B1-CA | CA | 14 | 163 | 55 | Present | 64.29 | AAAGGTGGAAACAACTCACGT | CCATGTTGTAGCATGTGTCAG |
| 136B1-DG | DG | Many | 182 | 55 | Present | 57.14 | CTGTGATTGCACCACTCCACT | GTGTGCCACCATGCCCAGCTA |
| 40E16-TTA | TTA | 13 | 208 | 53 | Present | 64.29 | TATTTTGCCCAGATCCACCAG | GGGAGGCGGACGTTGCAGTGA |
| 40E16-AT1 | AT | 10 | 182 | TCTGCGGCATTAATTTATGCT | ATGCACTTTGCAAAGGAGTAC | |||
| 40E16-AT2 | AT | 13 | 196 | CTGGTTGCATTCTGAAGCTCA | CCACTGCACTCCAGCCTGACT | |||
| 40E16-CATA | CATA | 7 | 212 | GAGCTTGCAGTGAGCTGAGAT | GCAAGGTGAAGGCAGTGTGAC | |||
| 40E16-CA | CA | 18 | 172 | 60 | Present | 50.00 | AGGGCCATCAGCTGACACATC | GGGCTGGATTTGTCACATGTC |
| 223B1-CA1 | CA | 18 | 129 | 55 | Present | 84.62 | TCTCTGCATCATGCACCATGC | GGAACAGGTTAACAGGTTTAG |
| 223B1-CA2 | AC | 18 | 154 | 55 | Present | 78.57 | GAAGTAGGCTAATAATTAGAT | ACCCTATGTGCTAAACGGTGA |
| 223B1-AC | AC | 20 | 139 | 51 | Present | 92.86 | CTACACAACTATAACTTTGCA | ACCCAGAAAATTCACCTACAT |
| 223B1-CATA | CATA | 8 | 137 | 51 | Present | 57.14 | ACTGCACTCCAGCCTGGCGAC | AAAGTGTCATTATCGAAGATG |
| 223B1-DG | CT,CA | 20,15 | 141 | 53 | Present | 71.43 | TCAAGATGAGCCTCAATCTCA | AGCCCTGTGTTTCCTAACTGC |
| 1013A10-TG | TG | 22 | 152 | Present | 71.43 | ATTTATAGGTTGGTGTTCCTA | GGCCTTCATAAGAGGAGGTAG | |
| 232P20-GA | GA | 19 | 142 | Present | 78.57 | AACATTTTCTGTCCTTGTGAC | TCACTGCATTCCCTCTTCTAG | |
| 529N6-GT | GT | 17 | 160 | Present | 85.71 | CTTCTAACAATCGCAGTCTGC | CCCACTGCCAGACTGGGTCAT | |
| 72E17-GT | GT | 23 | 176 | Present | 38.46 | GGTGGTGTGGGTTATGAGATC | ACCAGGAGTGGGGCTCCTGAT | |
Partial Duplication of 6p25 as a Cause of Disease
Cytogenetic studies demonstrated a de novo abnormal chromosome 6 that contained additional material of unknown origin at 6p25.1 in all studied cells from the proband from family RG-5. A whole-chromosome stain of chromosome 6 showed that the additional material originated in chromosome 6. A partial duplication of 6p25 was discovered by the genotyping of DNA, from the proband and parents, with highly polymorphic STRP markers from the 6p25 region. The molecular-analysis results also suggested that the duplication event was maternally derived. The genotyping of marker 668J24-GATA is presented in figure 3, illustrating the presence of three alleles in some samples, and, in other samples, intensity differences between alleles in the heterozygous state. The extent of the partial 6p25 duplication is shown in figure 4.
Figure 3.
Genotyping results showing evidence for partial 6p25 duplication in families RG-5 and FG-253. A, Results for the marker 668J24-GATA. Sample identification is given at the top of the gel image. Families FG-253 (sample numbers 1–6) and RG-5 (sample numbers 7–9) have a partial duplication of 6p25. The “2/6” label denotes a sample with an unbalanced translocation involving chromosomes 2 and 6 (partial deletion of 6p25). The “6/13” label denotes a sample with a balanced translocation of chromosomes 6 and 13. The 01 and 02 samples are CEPH control samples (1331-01 and 1331-02). Samples 1 and 6 have three alleles, whereas samples 3, 5, and 7 demonstrate allele-intensity differences. B, Example of three alleles (sample 7) for the marker 118B18-GT in family RG-5.
Figure 4.
Genetic analysis of the two families with partial duplication (FG-253 and RG-5), as well as of the sample with partial deletion (2/6). The markers are listed in order, according to their placement on the physical map. Markers derived from the same PAC are listed in their correct order as derived from the sequence data, but the orientation of the cluster could not be determined accurately. The boxes indicate the proposed extent of each duplication or deletion.
The discovery of the patient with a partial 6p25 duplication prompted us to use a subset of the tightly linked genetic markers to genotype the entire cohort of probands with anterior chamber defect, to screen for the presence of small deletions or duplications. In another proband, three alleles were detected for the marker AFMb034ya5, suggesting a possible duplication of 6p25. This result was confirmed by additional markers in the region. This duplication was passed on to three of the four children of the proband. All four of the individuals who harbored the partial 6p25 duplication were diagnosed with iris hypoplasia (MIM 308500). Neither the unaffected spouse nor the sole unaffected offspring was found to have this duplication. The extent of the partial 6p25 duplication in this family is shown in figure 4.
Genetic markers flanking the FOXC1 gene were found to have three alleles in the proband from family RG-5. This result strongly suggests that the FOXC1 gene is duplicated in this patient. In family FG-253, markers that demonstrated three alleles could be detected only distal to the FOXC1 gene. Thus, the hypothesis of FOXC1 duplication in this family rests solely on the detection of intensity differences between alleles. Two FOXC1 intragenic polymorphisms were genotyped in family FG-253. Experiments were performed to determine the PCR cycling conditions that produced products that were within the linear range of amplification. Between the control samples and the affected individuals in family FG-253, visual evidence of consistent and reproducible differences in allele intensities of the FOXC1 polymorphism was found. This difference in the intensity of the alleles was confirmed by densitometry of PCR bands amplified from affected individuals in family FG-253 and from control samples. This result shows direct evidence for duplication of the FOXC1 gene in this family.
Discussion
This study extends the catalog of FOXC1-gene mutations that can disrupt the normal development of the anterior chamber of the eye. Glaucoma occurs in ∼50% of patients with such angle defects. Interestingly, the majority of the mutations can be grouped into two types. The first type represents missense mutations within the forkhead domain that presumably alter or abolish recognition of the target sequence of FOXC1. The precise delineation of the mechanistic effects of these mutations must await binding studies involving these types of mutations. The second type is composed of frameshift mutations that occur upstream of the forkhead domain. These mutations result in a mutant protein that is truncated prior to the forkhead domain. Such a protein would presumably lack the ability to recognize the FOXC1 target sequence, and it would not have any functionally important elements distal to the site of premature termination. These two groups constitute the majority (15/18) of mutations reported to date.
We have detected a single frameshift mutation that is located very near the end of the coding region. The protein produced by this mutant sequence should have a fully functional forkhead domain as well as any functionally important elements prior to the site of premature termination. The mutant protein lacks the last 49 amino acids present in the wild-type FOXC1 protein. The distal location of this change suggests that functionally important elements may be present at the end of the FOXC1 protein. Alternatively, the carboxy-terminus may play a role in proper protein folding. FOXF2, which is a distant family member of FOXC1 and is also located at 6p25, has been shown to have activation domains downstream of the forkhead domain (Blixt et al. 1998). The DNA sequence near the end of the FOXC1 gene is conserved between human, mouse, rat, Xenopus, and chicken, consistent with the presence of a functional element in the region.
The physical map of the region is useful for the detailed localization of sequenced large-insert clones and of candidate genes. Two other forkhead genes, FOXF2 and HFH1 are located distal to FOXC1 within 6p25. This region has been postulated to contain a second locus (IRID1B), for iridogoniodysgenesis, type 1 (IRID1 [MIM 601631]), important for the development of the anterior chamber of the eye (Mears et al. 1998). FOXF2 and HFH1 are located within the critical interval that has been proposed for IRID1, subtype B, and can be considered candidate genes. However, no mutations have been detected in either of these genes (D.Y.N., C.C.S., V.C.S., unpublished data). Genetic markers developed from STRs contained within the sequence of mapped large-insert clones have proved to be very useful for the characterization of DNA rearrangements within 6p25. Such markers will also be useful for linkage-mapping studies within the 6p25 region.
The identification of two unrelated families who have partial duplication of 6p25 and defects of the anterior chamber of the eye suggests that the proper dosage of a gene in this region is required for normal eye development. All three of the forkhead genes (FOXC1, FOXF2, and HFH1) are contained within each of the duplicated regions in the two families. There are likely to be other genes within this relatively large area of 6p25. Thus, the creation of a mouse model with a FOXC1 transgene would aid in the determination of whether the eye defects observed in the two families in this study are due solely to the extra copy of FOXC1 or to an extra copy of a different gene(s) within the duplicated regions.
The diagnosis of isolated anomalies in the anterior chamber of the eye in patients with gross structural rearrangements involving FOXC1 raises the possibility that anterior-chamber defects in other families in which there is evidence of linkage to 6p25 may result from mechanisms other than changes within the FOXC1 coding sequence. Sequence alterations or structural rearrangements located outside of the FOXC1 coding region that result in gene up-regulation or down-regulation could explain the lack of FOXC1 coding-sequence mutations in 6p25 linked families. Thus, a second 6p25 gene involved in anterior-chamber defects might not exist. Lehmann et al. (2000) have recently reported a large duplication, also in the 6p25 region, that results in an anterior-chamber defect, supporting this hypothesis.
Dosage effects have been observed for the PAX6 (MIM 106210) gene in human and mouse studies. Duplication of the 11p12-p13 region containing the PAX6 gene often results in abnormalities of the eye (Glaser et al. 1994; Aalfs et al. 1997). Similar results have been observed for 6p25 duplications, although it is difficult to discern a consistent pattern to the type of defect observed. This is likely to be due to differences in the clinical evaluations performed by different groups, as has been noted in similar studies involving 6p25 deletions. In the case of PAX6, the observations in humans have been supported by experimental evidence from transgenic-mouse studies (Schedl et al. 1996). Mice that carry multiple copies of PAX6 on a wild-type background were found to have developmental abnormalities of the eye. Thus, similar studies with FOXC1 may prove to be useful.
Acknowledgments
We are grateful to the patients and their families who participated in the study. We would also like to acknowledge Denise Crouch, for the pedigree ascertainment and patient recruitment, and Gretel Beck, Sara Brown, Deborah Guthrie, Christine Hartzler, Robin Hockey, Dennis Hulseburg, Heather Major, James Elder, Julian Rait, Andrew McNaught, and Nicole Meyer, for technical assistance. This work was supported by funds from the Knight’s Templar Eye Foundation (to D.Y.N.), Glaucoma Research Foundation (to D.Y.N and D.A.M.), and National Institutes of Health (grant R01-EY-10564 to V.C.S., W.L.M.A., and E.M.S.). V.C.S. is an associate investigator of the Howard Hughes Medical Institute.
Electronic-Database Information
Accession numbers and URLs for data in this article are as follows:
- NIH Image Home Page, http://rsb.info.nih.gov/nih-image/ (for NIH Image, version 1.62)
- Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/ (for MYOC [MIM 601652], CYP1B1 [MIM 601771], PITX2 [MIM 601542], RIEG1 [MIM 180500], FOXC1 [MIM 601090], RIEG2 [MIM 601499], FOXC2 [MIM 602402], FOXF2 [MIM 603250], iris hypoplasia [MIM 308500], IRID1 [MIM 601631], and PAX6 [MIM 106210])
- Sanger Centre, The, http://www.sanger.ac.uk/ (for FISH analysis) and ftp://ftp.sanger.ac.uk/pub/human/sequences/ (for sequence data)
References
- Aalfs CM, Fantes JA, Wenniger-Prick LJ, Sluijter S, Hennekam RC, van Heyningen V, Hoovers JM (1997) Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product? Am J Med Genet 73:267–271 [DOI] [PubMed] [Google Scholar]
- Alward WL (2000) The genetics of open-angle glaucoma: the story of GLC1A and myocilin. Eye 14:429–436 [DOI] [PubMed] [Google Scholar]
- Blixt A, Mahlapuu M, Bjursell C, Darnfors C, Johannesson T, Enerback S, Carlsson P (1998) The two-exon gene of the human forkhead transcription factor FREAC-2 (FKHL6) is located at 6p25.3. Genomics 53:387–390 [DOI] [PubMed] [Google Scholar]
- Fingert JH, Heon E, Liebmann JM, Yamamoto T, Craig JE, Rait J, Kawase K, Hoh ST, Buys YM, Dickinson J, Hockey RR, Williams-Lyn D, Trope G, Kitazawa Y, Ritch R, Mackey DA, Alward WL, Sheffield VC, Stone EM (1999) Analysis of myocilin mutations in 1703 glaucoma patients from five different populations. Hum Mol Genet 8:899–905 [DOI] [PubMed] [Google Scholar]
- Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet 7:463–471 [DOI] [PubMed] [Google Scholar]
- Gould DB, Mears AJ, Pearce WG, Walter MA (1997) Autosomal dominant Axenfeld-Rieger anomaly maps to 6p25. Am J Hum Genet 61:765–768 [PMC free article] [PubMed] [Google Scholar]
- Graff C, Jerndal T, Wadelius C (1997) Fine mapping of the gene for autosomal dominant juvenile-onset glaucoma with iridogoniodysgenesis in 6p25-tel. Hum Genet 101:130–134 [DOI] [PubMed] [Google Scholar]
- Jordan T, Ebenezer N, Manners R, McGill J, Bhattacharya S (1997) Familial glaucoma iridogoniodysplasia maps to a 6p25 region implicated in primary congenital glaucoma and iridogoniodysgenesis anomaly. Am J Hum Genet 61:882–888 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lehmann OJ, Ebenezer ND, Jordan T, Fox M, Ocaka L, Payne A, Leroy BP, Clark BJ, Hitchings AR, Povey S, Khaw PT, Bhattacharya SS (2000) Chromosomal duplication involving the forkhead transcription factor gene FOXC1 causes iris hypoplasia and glaucoma. Am J Hum Genet 67:1129–1135 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mears AJ, Jordan T, Mirzayans F, Dubois S, Kume T, Parlee M, Ritch R, Koop B, Kuo W-L, Collins C, Marshall J, Gould DB, Pearce W, Carlsson P, Enerbäck S, Morissette J, Bhattacharya S, Hogan B, Raymond V, Walter MA (1998) Mutations of the forkhead/winged-helix gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am J Hum Genet 63:1316–1328 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mears AJ, Mirzayans F, Gould DB, Pearce WG, Walter MA (1996) Autosomal dominant iridogoniodysgenesis anomaly maps to 6p25. Am J Hum Genet 59:1321–1327 [PMC free article] [PubMed] [Google Scholar]
- Mirzayans F, Gould DB, Heon E, Billingsley GD, Cheung JC, Mears AJ, Walter MA (2000) Axenfeld-Rieger syndrome resulting from mutation of the FKHL7 gene on chromosome 6p25. Eur J Hum Genet 8:71–74 [DOI] [PubMed] [Google Scholar]
- Nishimura DY, Swiderski RE, Alward WL, Searby CC, Patil SR, Bennet SR, Kanis AB, Gastier JM, Stone EM, Sheffield VC (1998) The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. Nat Genet 19:140–147 [DOI] [PubMed] [Google Scholar]
- Phillips JC, del Bono EA, Haines JL, Pralea AM, Cohen JS, Greff LJ, Wiggs JL (1996) A second locus for Rieger syndrome maps to chromosome 13q14. Am J Hum Genet 59:613–619 [PMC free article] [PubMed] [Google Scholar]
- Quigley HA (1996) Number of people with glaucoma worldwide. Br J Ophthalmol 80:389–393 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, Hastie ND (1996) Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86:71–82 [DOI] [PubMed] [Google Scholar]
- Semina EV, Reiter R, Leysens NJ, Alward WL, Small KW, Datson NA, Siegel-Bartelt J, Bierke-Nelson D, Bitoun P, Zabel BU, Carey JC, Murray JC (1996) Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet 14:392–399 [DOI] [PubMed] [Google Scholar]
- Smith RS, Zabaleta A, Kume T, Savinova OV, Kidson SH, Martin JE, Nishimura DY, Alward WL, Hogan BL, John SW (2000) Haploinsufficiency of the transcription factors FOXC1 and FOXC2 results in aberrant ocular development. Hum Mol Genet 9:1021–1032 [DOI] [PubMed] [Google Scholar]
- Stoilov I, Akarsu AN, Sarfarazi M (1997) Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 6:641–647 [DOI] [PubMed] [Google Scholar]
- Stone EM, Fingert JH, Alward WLM, Nguyen TD, Polansky JR, Sunden SLF, Nishimura D, Clark AF, Nystuen A, Nichols BE, Mackey DA, Ritch R, Kalenak JW, Craven ER, Sheffield VC (1997) Identification of a gene that causes primary open angle glaucoma. Science 275:668–670 [DOI] [PubMed] [Google Scholar]
- Swiderski RE, Reiter RS, Nishimura DY, Alward WL, Kalenak JW, Searby CS, Stone EM, Sheffield VC, Lin JJ (1999) Expression of the Mf1 gene in developing mouse hearts: implication in the development of human congenital heart defects. Dev Dyn 216:16–27 [DOI] [PubMed] [Google Scholar]




