Abstract
BACKGROUND
Durum wheat is the raw material used to produce pasta, and its price is determined by grain physical characteristics, gluten strength and semolina yellowness. Gluten strength is mainly determined by high‐ and low‐molecular‐weight glutenin subunits (HMW‐GS and LMW‐GS). Semolina yellowness is determined by loci that control carotenoid content and lipoxygenase activity. Arabinoxylans are the major dietary fibre component within the durum wheat endosperm. Twelve durum wheat cultivars were grown in five locations over two cropping seasons. The objectives of this study were to determine the variability in the aforementioned traits; to assess the influence of genotype, environment and their interaction; and to determine the allelic variation of the main genes associated with gluten strength and semolina yellowness.
RESULTS
Grain physical characteristics were mainly determined by the environment. However, the genotype exerted a strong influence on gluten strength, semolina yellowness and arabinoxylan content. There was wide variation in all traits, but arabinoxylan content was limited. For HMW‐GS the most common alleles were Glu‐A1c and Glu‐B1b, while for LMW‐GS they were GLU‐A3a, GLU‐B3a and GLU‐B2a. Regarding carotenoid synthesis genes, Psy‐A1l, Psy‐B1o, Pds‐B1b and TdZds‐A1.1 were the most frequent alleles; while Lpx‐A3 UC1113 and Lpx‐B1.1a were predominant for lipoxygenase genes.
CONCLUSIONS
Although the best alleles for gluten quality and yellow colour are present, they are not combined in a single cultivar, which limits the maximisation of overall quality. This study also highlights the importance of searching for arabinoxylan donors due to the limited genetic variability for this trait in commercial durum wheat cultivars. © 2025 The Author(s). Journal of the Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Keywords: arabinoxylan, dietary fibre, gluten strength, wheat quality, yellow index
ABBREVIATIONS
- ANOVA
analysis of the variance
- CTAB
cetyltrimethylammonium bromide
- GI
gluten index
- GPC
grain protein content
- GS
gluten strength
- LPX
lipoxygenase
- PAGE
polyacrylamide gel electrophoresis
- PDS
phytoene desaturase
- PSY
phytoene synthase
- RF
refined flour
- TKW
thousand kernel weight
- TOT‐AXs
total‐arabinoxylans
- TW
test weight
- VTR
vitreousness
- WE‐AXs
water‐extractable arabinoxylans
- WM
wholemeal flour
- WU‐AXs
water‐unextractable arabinoxylans
- YI
yellow index
- ZDS
ζ‐carotene desaturase
INTRODUCTION
Wheat is one of the main crops in the world. Under this term diverse species of the Triticum genus are grouped, 1 although two of them are the most important: bread or common wheat (Triticum aestivum L. ssp. aestivum) and durum wheat (T. turgidum ssp. durum Desf. em. Husn.), the former being clearly hegemonic. However, durum wheat is the tenth most cultivated cereal worldwide with 13.5 million hectares and 33.8 million tons of annual production in 2021. 2 It is mainly cultivated in dry and warm regions such as the Mediterranean Basin (Southern Europe and North Africa) and is used to produce food products such as pasta, couscous, bulgur or flat breads. 3 For these uses, durum wheat is preferred over common wheat because of its capacity to be milled into semolina, its more tenacious gluten and brighter yellow colour. 4 Since the latter two traits show high variability, the search and evaluation of genotypes with better values for both characteristics are highly justified.
Gluten is described as the protein network formed during dough preparation, primarily composed of grain storage proteins known as prolamins, glutenins and gliadins being their main components, along with other minor constituents. 5 Glutenins are classified into two groups according to their molecular weight: high‐molecular‐weight glutenin subunits (HMW‐GS), primarily encoded by the GLU‐A1 and GLU‐B1 genes; and low‐molecular‐weight glutenin subunits (LMW‐GS), mainly encoded by the GLU‐A3, GLU‐B3 and GLU‐B2 genes. Although other factors play a role in durum wheat gluten features, LMW‐GS are mainly responsible by influencing the amount and distribution of gluten polymers. 6 Durum wheat gluten presents less sticky dough with better extrusion properties, but the most important characteristic is its ability to form a consistent protein network with capacity to retain starch during the processing and cooking of the pasta, conferring superior cooked textural characteristics. 4
The yellow colour of semolina has mainly played an aesthetic role in pasta, contributing to a higher consumer acceptance due to its association with high‐quality pasta made with durum wheat semolina compared to products made with bread wheat flour. 7 Carotenoids are the compounds responsible for that yellow colour, and include both carotenes and xanthophylls, with the latter constituting the major carotenoids in durum wheat, particularly lutein, which represents approximately 90% of the total carotenoid pigments. Other carotenoids, such as zeaxanthin, and various isomers of lutein and zeaxanthin, along with carotenes (α‐ and β‐carotene or β‐cryptoxanthin) appear in low amounts. 8 , 9 These components also have important nutritional and health roles such as antioxidant properties, decreasing the risk of cardiovascular disorders and reinforcing the immune system among other health benefits. 10 Lutein and zeaxanthin play a crucial role in the protection of the macular region of the eye. 11
Carotenoids originate from lycopene, which is synthesised from two molecules of geranylgeranyl diphosphate through the sequential action of various enzymes, including phytoene synthase (PSY), phytoene desaturase (PDS) and ζ‐carotene desaturase (ZDS), among others. Nevertheless, a high initial carotenoid content in the wheat grain does not guarantee a high yellow colour in pasta or durum wheat products. During processing stages, oxidative degradation can occur due to the action of different enzymes, among which lipoxygenase (LPX) stands out. 12 Consequently, with the aim of selecting the best allelic combinations to breed for cultivars with high endogenous carotenoid content and low oxidative activity to produce pasta with bright yellow colour, several functional markers for some of these genes have been developed. 13 , 14 , 15 , 16
With the growing interest in the nutritional and health benefits of cereal‐based food products, other grain components such as dietary fibre (DF) have attracted attention. This term includes various polysaccharides, with the major ones being arabinoxylans (AXs) in the wheat grain. 4 It has been shown that the gut microbiota uses AXs by modifying the production of short‐chain fatty acids in the colon, regulating antioxidant capacity, which is associated with the prevention of colon cancer. 17 Likewise, AXs act on blood glucose levels by controlling the hypoglycaemic effect of the postprandial response. 18 Based on their solubility and extractability in water, AXs can be divided into water‐extractable arabinoxylans (WE‐AXs) and water‐unextractable arabinoxylans (WU‐AXs). This also has an impact at the industrial level; preliminary studies indicate that WE‐AXs could be associated with a reduction in pasta stickiness, while WU‐AXs might contribute to improve drying of the pasta. 19 , 20
The assessment of all these grain components can be of great interest for the selection and/or development of new durum wheat cultivars with enhanced nutritional and technological characteristics. Thus, the objectives of the study reported here were to determine the influence of genotype, environment and their interaction for some of the most important grain physical characteristics, gluten strength, semolina yellowness and AX content, in a set of Spanish durum wheat commercial cultivars; and to assess the allelic variation underlying some of the main genes described for gluten strength and semolina yellowness to understand the genetic control of these traits.
MATERIALS AND METHODS
Plant material
Twelve durum wheat commercial cultivars (Amilcar, Athoris, Avispa, Don Ricardo, Doudou, Euroduro, Ottaviano, RGT Tacodur, Sculptur, Semidou, SY Atlante and SY Nilo) were grown in a randomised block design with two replicates. These field trials were conducted by the Andalusian Network for Agricultural Experimentation (Red Andaluza de Ensayos Experimentales, RAEA) during 2020/21 and 2021/22 crop seasons at five different locations in Andalusia (southern Spain): Carmona, Granada, Jerez, Santa Cruz and Santaella. All these locations have a Mediterranean climate, but with remarkable differences in terms of temperature, precipitation and other variables during the growing seasons.
Grain quality parameters
Several grain quality parameters were measured in both grain and wholemeal flour. Test weight (TW, kg hL−1) was determined according to AACC Method 55‐10.01. 21 Thousand kernel weight (TKW, g) was determined using gravimetry and vitreousness (VTR, %) was calculated as the percentage of vitreous kernels with a grain cutter. The grain protein content (GPC) was calculated from the nitrogen content determined by the Kjeldahl method (% N × 5.7) and expressed on a 12.5% moisture basis.
Gluten strength (GS) was measured on wholemeal flour using the gluten index (GI) according to ICC Standard No. 155. 22 The yellow index (YI, b* value) was measured on semolina using a portable reflectance colorimeter (CR‐400; Konica‐Minolta, Japan).
The total arabinoxylan content (TOT‐AXs, mg g−1) and WE‐AX (mg g−1) were quantified in refined (RF) and wholemeal (WM) flour according to the colorimetric method based on phloroglucinol described by Hernández‐Espinosa et al. 23
HMW‐GS and LMW‐GS variability
Proteins were extracted from single crushed seeds according to the protocol described by Alvarez et al. 24 with some modifications. The Tris–HCl–SDS (pH = 6.8/8.8) buffer was replaced for a Tris–HCl–SDS (pH = 6.8/8.5) buffer, and the sodium dodecylsulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) gels were made at 13% (w/v; C: 1.33%). The gels were run for approximately 8 h and were stained overnight with 12% (w/v) trichloroacetic acid solution containing 5% (v/v) ethanol and 0.05% (w/v) Coomassie Brilliant Blue R‐250. De‐staining was carried out with tap water.
The alleles were identified and classified according to Payne and Lawrence 25 for HMW‐GS and according to Lerner et al. 26 and Nieto‐Taladriz et al. 27 for LMW‐GS.
DNA extraction and molecular markers
Genomic DNA was extracted from approximately 100 mg of young leaves of single plants using the cetyltrimethylammonium bromide (CTAB) method. 28
The polymorphic sequences of the main genes involved in the carotenoid concentration 7 (PSY‐A1, PSY‐B1, PDS‐B1, ZDS‐A1, LPX‐A3 and LPX‐B1.1 genes) were amplified by PCR analysis. All amplifications contained a final volume of 20 μL, containing 50 ng of genomic DNA, 1.5 mmol L−1 MgCl2, 0.2 μmol L−1 of each primer, 0.2 mmol L−1 dNTPs, 4 μL of 10× PCR buffer and 0.25 U of GoTaq® G2 Flexi DNA Polymerase (Promega, Madison, WI, USA). The specific primers for these genes together with the PCR conditions are listed in Table 1. For proper identification of some alleles from PDS‐B1 and LPX‐A3 genes, the PCR products were digested at 37 °C during 2 h with the endonucleases HpyCH4IV (New England Biolabs) and HaeII (New England Biolabs), respectively.
Table 1.
Description of PCR primers pairs used to characterise the 12 durum wheat commercial cultivars
| Primers designed by Singh et al. 16 | |
| Psy1‐A1_STS_F | 5′‐GCCTCCTCGAAGAACATCCTC‐3′ |
| Psy1‐A1_STS_R | 5′‐GTGGATATTCCCTGTCAGCATC‐3′ |
| Primers designed in this paper | |
| Pds‐B1_STS_F | 5′‐ACGTTGAAGCTCAAGATGGC‐3′ |
| Pds‐B1_STS_R | 5′‐TGCACTGCATGGATAACTCGT‐3′ |
| Primers designed by Pasten et al. 14 | |
| TdZdsA1.2iF | 5′‐CCGGAACTTCTGTTAGTTGGT‐3′ |
| TdZdsA1.2iR | 5′‐TGGGATTAAGCAAGAAGCAATC‐3′ |
| Primers designed by Carrera et al. 13 | |
| LOXA‐L1 | 5′‐CTGATCGACGTCAACAAC‐3′ |
| LOXA‐R1 | 5′‐CAGGTACTCGCTCACGTA‐3′ |
| LOXB‐L | 5′‐CACGATAACTTCATGCCAT‐3′ |
| LOXB‐R | 5′‐ACTCCTCCAGCTCCTTGT‐3′ |
| PCR conditions | ||||
|---|---|---|---|---|
| Initial denaturation = 3 min at 94 °C | ||||
| Pair [Fw/Rv] | Denaturation | Annealing | Extension | |
| Psy1‐A1_STS | 35 cycles | 30 s at 94 °C | 30 s at 56 °C | 1 min at 72 °C |
| Pds‐B1_STS | 35 cycles | 45 s at 94 °C | 45 s at 58 °C | 1 min at 72 °C |
| TdZdsA1.2i | 35 cycles | 45 s at 94 °C | 1 min at 50 °C | 45 s at 72 °C |
| LOXA, LOXB | 5 cycles | 30 s at 94 °C | 30 s at 60–55 °C | 45 s at 72 °C |
| 35 cycles | 45 s at 94 °C | 45 s at 55 °C | 45 s at 72 °C | |
Final extension = 10 min at 72 °C.
The PCR products and digestions were electrophoretically separated in all cases by PAGE at 10% (w/v; C: 1.28%), except for ZDS‐A1 whose concentration was 12% (w/v; C: 0.44%) and 8% (w/v; C: 1.28%) for LPX‐A3. The bands were stained with GelRed™ Nucleic Acid Stain (Biotium) and then visualised under UV light.
Statistical analyses
Data were analysed by an analysis of the variance (ANOVA) using cultivar (C), environment (E) and their interaction (C × E) as variation sources. The environment includes both location and harvest year. The means were compared by Tukey's honest significant difference method. All statistical analyses were performed using SAS® Studio (version 3.81, NC, USA).
RESULTS
Effects of cultivar, environment and their interaction on grain quality variation
The different quality traits within the specified cultivars set (all data are available in Table S1) were analysed by an ANOVA to identify the factors that contributed most significantly to the variation observed (Table 2). In this regard, the grain quality traits TW, TKW, GPC and VTR showed that most of variation was a consequence of the environment.
Table 2.
Effects of cultivar, environment and their interaction on quality traits in 12 durum wheat cultivars. Squares sum (Sq. sum), % of the total squares sum of squares from ANOVA analysis
| Source | Cultivar (%) | Environment (%) | Cultivar × environment (%) | Error (%) | Total |
|---|---|---|---|---|---|
| TW | 294.9*** (11.0) | 1528.8*** (56.9) | 471.0* (17.5) | 390.8 (14.6) | 2685.5 |
| TKW | 1366.9*** (9.1) | 11 265.5*** (75.2) | 1569.9*** (10.5) | 788 (5.3) | 14 990.3 |
| GPC | 82.1*** (4.3) | 1419.3*** (73.7) | 147.0 (7.6) | 278.5 (14.5) | 1926.9 |
| VTR | 670.6*** (3.8) | 11 999.9*** (67.5) | 3651.9*** (20.6) | 1442.4 (8.1) | 17 764.8 |
| GI | 17 876.7*** (21.2) | 30 403.4*** (36.0) | 28 026.9*** (33.2) | 8036.4 (9.5) | 84 343.4 |
| YI | 591.8*** (41.5) | 364.4*** (24.8) | 329.6*** (23.1) | 151.8 (10.6) | 1427.6 |
| RF TOT‐AXs | 214.6*** (16.8) | 615.7*** (48.2) | 222.2*** (17.4) | 226.1 (17.7) | 1278.6 |
| RF WE‐AXs | 43.6*** (27.9) | 51.6*** (33.0) | 31.3*** (20.0) | 30.0 (19.2) | 156.5 |
| WM TOT‐AXs | 712.6*** (19.3) | 798.0*** (21.6) | 1023.9 (27.7) | 1165.2 (31.5) | 3699.7 |
| WM WE‐AXs | 52.3*** (43.5) | 9.8** (8.2) | 39.4*** (32.8) | 18.7 (15.6) | 120.2 |
Values are significant for *P < 0.05, **P < 0.01, ***P < 0.001.
TW, test weight; TKW, thousand kernel weight; GPC, grain protein content expressed on a 12.5% moisture basis; VTR, vitreousness; GI, gluten index; YI, yellow index; RF TOT‐AXs, refined flour total arabinoxylans; RF WE‐AXs, refined flour water‐extractable arabinoxylans; WM TOT‐AXs, wholemeal total arabinoxylans; WM WE‐AXs, wholemeal water‐extractable arabinoxylans.
The comparative means of these traits by cultivar, location and harvest year are presented in Table 3. All cultivars exhibited TW values over 80 kg hL−1 except for Ottaviano and Sculptur with slightly lower values. Especially notable is the performance of the cultivar SY Atlante with 82.7 kg hL−1. The comparison among cultivars for TKW showed a separate set formed by three cultivars, Ottaviano, RGT Tacodur and SY Nilo, with values over 40 g. At the other extreme, the cultivars Amilcar, Sculptur and SY Atlante presented values below 35 g. The range for GPC varied between 14.5% for cv. Avispa and 17.0% for cv. RGT Tacodur. For VTR, the highest value corresponded to cv. Don Ricardo with a value of 98.5%, whereas the lowest ones were detected in cvs. Doudou and SY Nilo with 93.1% and 93.6%, respectively. Among the locations, Jerez was especially favourable for TW and TKW (82.6 kg hL−1 and 45.2 g, respectively). Regarding GPC and VTR, Granada was the most outstanding location with values of 18.7% and 99.3%, respectively. Between harvest years there were significant differences for most parameters but of lower magnitude.
Table 3.
Mean values of quality traits averaged by cultivar, location and harvest year
| TW (kg hL−1) | TKW (g) | GPC (%) | VTR (%) | GI (%) | YI (b*) | RF TOT‐AXs (mg g−1) | RF WE‐AXs (mg g−1) | WM TOT‐AXs (mg g−1) | WM WE‐AXs (mg g−1) | ||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Cultivar | Amilcar | 81.9ab | 34.8d | 15.2cd | 96.4ab | 46.1fg | 26.0gh | 14.5ef | 3.3g | 45.7e | 3.2e |
| Athoris | 80.7bcd | 36.4bcd | 15.1cd | 94.1ab | 58.9cd | 29.5bc | 16.6a | 4.4a | 51.4a | 4.4ab | |
| Avispa | 82.1ab | 35.9cd | 14.5d | 96.0ab | 49.9ef | 26.6fg | 14.7ef | 3.4fg | 47.0de | 3.3e | |
| Don Ricardo | 82.3ab | 39.8abc | 15.7abcd | 98.5a | 54.1cdef | 25.5h | 15.7bc | 4.2ab | 48.7bcd | 4.2bc | |
| Euroduro | 82.5a | 37.4abcd | 15.8abc | 95.4ab | 70.8a | 27.9de | 15.0cde | 3.7cde | 45.6e | 4.0c | |
| Doudou | 81.6abc | 35.7d | 15.6bcd | 93.1b | 51.6def | 28.3d | 14.0f | 3.5efg | 47.1de | 3.8cd | |
| Ottaviano | 79.6d | 41.0a | 16.6ab | 96.6ab | 67.7ab | 27.1ef | 14.7def | 4.0bc | 47.2cde | 4.4ab | |
| RGT Tacodur | 80.0cd | 40.0ab | 17.0a | 97.8ab | 60.6bc | 28.5d | 15.4bcde | 3.4fg | 49.1bcd | 3.7d | |
| Sculptur | 79.3d | 34.4d | 16.0abc | 94.3ab | 39.5g | 30.7a | 14.0f | 4.2ab | 50.4ab | 4.7a | |
| Semidou | 80.1cd | 36.4bcd | 15.3bcd | 94.0ab | 50.4def | 28.6cd | 15.2bcde | 3.6def | 49.1bc | 4.4ab | |
| SY Atlante | 82.7a | 33.7d | 15.8abcd | 95.5ab | 58.1cde | 29.9ab | 15.6bcd | 3.3g | 49.6ab | 3.3e | |
| SY Nilo | 80.9bcd | 40.6a | 15.3bcd | 93.6b | 62.8abc | 26.2fgh | 16.0ab | 3.8cd | 49.0bcd | 4.0cd | |
| Location | Carmona | 80.7c | 33.3c | 14.6c | 92.7b | 57.3b | 28.7ab | 15.0c | 3.6c | 47.8b | 3.9c |
| Granada | 77.4d | 33.1c | 18.7a | 99.3a | 53.8bc | 26.7c | 15.2bc | 3.8b | 50.2a | 4.2a | |
| Jerez | 82.6ab | 45.2a | 12.7d | 87.7c | 63.4a | 26.6c | 13.4d | 3.1d | 46.5c | 3.6d | |
| Santa Cruz | 81.8b | 34.8c | 16.4b | 98.9a | 54.6bc | 29.2a | 16.5a | 4.2a | 49.7a | 4.1ab | |
| Santaella | 83.1a | 39.4b | 15.8b | 98.8a | 50.3c | 28.3b | 15.7b | 4.0ab | 47.4bc | 3.9bc | |
| Harvest year | 2020/21 | 81.0 | 36.3b | 15.9 | 94.2b | 65.4a | 27.4b | 15.6a | 3.8a | 47.2b | 3.9 |
| 2021/22 | 81.3 | 38.1a | 15.4 | 96.7a | 46.3b | 28.4a | 14.6b | 3.7b | 49.5a | 4.0 | |
Means followed by different letters are significantly different (P < 0.05) according to Tukey's test.
TW, test weight; TKW, thousand kernel weight; GPC, grain protein content expressed on a 12.5% moisture basis; VTR, vitreousness; GI, gluten index; YI, yellow index; RF TOT‐AXs, refined flour total arabinoxylans; RF WE‐AXs, refined flour water‐extractable arabinoxylans; WM TOT‐AXs, wholemeal total arabinoxylans; WM WE‐AXs, wholemeal water‐extractable arabinoxylans.
Although the environment was still the most relevant factor, the values obtained for GI, YI and AXs showed a greater influence of the cultivar than for the previously discussed parameters (Table 2). The gluten strength was highly influenced by the environment accounting for 36.0% of the variance; the interaction between environment and cultivar also exerted a high influence accounting for 33.2% of the variance while the cultivar effect was higher than for the previously discussed parameters accounting for 21.2% of the variance. Regarding the genotypic variability, cvs. Euroduro and Ottaviano presented the highest gluten quality with GI mean scores of 70.8% and 67.7%, respectively. The cultivar Sculptur presented the weakest gluten, with a GI of 39.5%. The highest scores by location for that parameter were found in Jerez with a mean value of 63.4% in contrast to Santaella where the GI presented a mean of 50.3%. Between cropping seasons, the difference was pronounced, as in the first season the GI mean value was 65.4% while in the second it was 46.3%.
Regarding the yellow colour of semolina, the cultivar explained 41.5% of the variance, while the environment and the interaction had effects below 25% (Table 2). The range for the cultivars varied from Don Ricardo with a b* value of 25.5 to Sculptur with a b* value of 30.7. The means by location were more similar in this case ranging from 26.6 for Jerez to 29.2 for Santa Cruz. Between harvest years there was a difference of the b* value of 1.0.
TOT‐AXs and WE‐AXs showed distinct trends based on the ANOVA factors in the RF and WM flour (Table 2). In this context, the environmental effects on AXs (both TOT‐AXs and WE‐AXs) were greater for RF than for WM flour. It is also important to highlight that WE‐AXs where more influenced by the cultivar than by the environment, in both RF and WM flour. For RF TOT‐AXs, cv. Athoris was the best genotype (16.6 mg g−1), while the lowest value (14.0 mg g−1) was measured for cv. Sculptur. In the case of WM TOT‐AXs, cv. Athoris was again the best genotype (51.4 mg g−1), while cv. Euroduro had the lowest content (45.6 mg g−1). WE‐AX values obtained for RF and WM flour were within the same range, 3.3–4.4 mg g−1 for RF and 3.2–4.7 mg g−1 for WM. The best genotype for RF WE‐AXs was cv. Athoris (4.4 mg g−1) while cvs. Avispa, Doudou, RGT Tacodur and SY Atlante presented the lowest values (3.3–3.4 mg g−1). For WM WE‐AXs, cv. Sculptur presented the highest content (4.7 mg g−1) and the lowest contents corresponded to cvs. Amilcar, Avispa and SY Atlante (3.2–3.3 mg g−1).
HMW‐GS and LMW‐GS variability
The composition for HMW‐GS and LMW‐GS of the cultivars evaluated here is presented in Fig. 1. The combinations of both glutenin subunit types were grouped in five haplotypes (Table 4). For the GLU‐A1 locus no subunit was detected, with all the genotypes exhibiting the Glu‐A1c (Null) allele. The variation for the GLU‐B1 locus was also limited, although up to three alleles were detected. The Glu‐B1b allele (subunits 7 + 8) was present in all genotypes, except for cv. Ottaviano with the Glu‐B1d (6 + 8) allele and cv. Sculptur showing Glu‐B1z (7 + 15).
Figure 1.

SDS‐PAGE patterns of HMW‐GS and LMW‐GS in representative durum wheats from the analysed genotypes. Lanes are as follows: 1: Amilcar; 2: Athoris; 3: Avispa; 4: Don Ricardo; 5: Euroduro; 6: Doudou; 7: Ottaviano; 8: RGT Tacodur; 9: Sculptur; 10: Semidou; 11: SY Atlante; 12: SY Nilo.
Table 4.
Variability for HMW‐GS and LMW‐GS, and mean value of GI by haplotype in the evaluated materials
| Haplotype | HMW‐GS | LMW‐GS | Cultivar | GI (%) | |||
|---|---|---|---|---|---|---|---|
| GLU‐A1 | GLU‐B1 | GLU‐A3 | GLU‐B3 | GLU‐B2 | |||
| I | c [Null] | b [7 + 8] | c [6 + 10] | a [2 + 4 + 15 + 19] | b [Null] | Don Ricardo, SY Atlante | 56.1b |
| II | c [Null] | b [7 + 8] | a [6] | a [2 + 4 + 15 + 19] | a [12] | Amilcar, Athoris, Avispa, Euroduro, Doudou, RGT Tacodur, Semidou | 55.3b |
| III | c [Null] | b [7 + 8] | ax [6.1] | a [2 + 4 + 15 + 19] | a [12] | SY Nilo | 61.9ab |
| IV | c [Null] | d [6 + 8] | ax [6.1] | a [2 + 4 + 15 + 19] | a [12] | Ottaviano | 66.9a |
| V | c [Null] | z [7 + 15] | h [Null] | g [2 + 4 + 15 + 16] | a [12] | Sculptur | 39.5c |
Means followed by different letters are significantly different (P < 0.05) according to Tukey's test.
In the case of LMW‐GS, four alleles were found for the GLU‐A3 locus: Glu‐A3a (6), Glu‐A3ax (6.1), Glu‐A3c (6 + 10) and Glu‐A3h (Null). For the GLU‐B3 locus, all the genotypes presented the Glu‐B3a allele (2 + 4 + 15 + 19), except for cv. Sculptur that had the Glu‐B3g allele (2 + 4 + 15 + 16). Lastly, the most frequent allele for the GLU‐B2 locus was Glu‐B2a (12), present in all genotypes except for the cultivars Don Ricardo and SY Atlante that carried the Glu‐B2b allele (Null).
According to GI values, the five different haplotypes were distinguished based on their glutenin composition and grouped in three significance group sets (Table 4). The most common haplotype was haplotype II with the following alleles: Glu‐A1c, Glu‐B1b, Glu‐A3a, Glu‐B3a and Glu‐B2a that had medium gluten strength (GI = 55.3%). The strongest gluten (GI = 66.9%) was that of haplotype IV that was only detected in cv. Ottaviano, whereas the weakest gluten (GI = 39.5%) corresponded to haplotype V detected in cv. Sculptur.
Allelic variation for genes related to grain carotenoid content
For the PSY‐A1 gene only the Psy‐A1l allele was detected (Fig. 2(a)) while for the PSY‐B1 gene (Fig. 2(a)), two different alleles (Psy‐B1n and Psy‐B1o) were found, although the first one was only detected in two cultivars (Athoris and RGT Tacodur). For the PDS‐B1 gene (Fig. 2(b)) four genotypes presented the Pds‐B1a allele and eight the Pds‐B1b allele. Of the two alleles detected for the ZDS‐A1 gene (Fig. 2(c)) most of the genotypes presented the TdZds‐A1.1 allele, while cvs. Ottaviano and Sculptur presented the TdZds‐A1.2 allele.
Figure 2.

Genomic segments of yellow colour‐related genes obtained using primers. (a) Psy1‐A1_STS; (b) Pds‐B1_STS; (c) TdZdsA1.2i; (d) LOXA; (e) LOXB. Lanes are as follows: 1: Amilcar, 2: Athoris, 3: Avispa, 4: Don Ricardo, 5: Euroduro, 6: Doudou, 7: Ottaviano, 8: RGT Tacodur; 9: Sculptur, 10: Semidou, 11: SY Atlante; 12: SY Nilo.
Regarding the carotenoid degradation related genes, all genotypes exhibited the Lpx‐B1.2 allele and Lpx‐B1.1a allele for the LPX‐B1.1 gene (Fig. 2(d)), except for cv. Ottaviano which presented the Lpx‐B1.1c allele, characterised by a deletion of the gene (null allele). The analysis of the LPX‐A3 gene (Fig. 2(e)) showed two different alleles: the Lpx‐A3 UC1113 allele, which was detected in most of the cultivars except for Athoris, Don Ricardo, Euroduro and Sculptur and that was associated with the digestion of the LPX‐A3 920 bp amplicon through the restriction enzyme HaeII; and the Lpx‐A3 Kofa allele, whose Lpx‐A3 amplicon was not digested with the restriction enzyme HaeII. No variation was observed for the LPX‐B3 gene, which was amplified with the same primers as LPX‐A3.
According to the combinations of these genes, eight haplotypes were defined among the cultivars evaluated (Table 5). The mean values for YI (measured as the b* parameter) for each haplotype were obtained and statistically evaluated. The most frequent haplotype was haplotype VI with an average b* value of 27.5 and presenting the following alleles: Psy‐A1l, Psy‐B1o, Pds‐B1b, TdZds‐A1.1, Lpx‐B1.1a and Lpx‐A3 UC1113. The remaining haplotypes are represented by only one cultivar. The highest YI value corresponded to haplotype VII (cv. Sculptur), b* = 30.7; and the lowest one, b* = 25.5, to haplotype III (cv. Don Ricardo).
Table 5.
Variability for genes related to colour and degradation colour and mean value of YI (b*) of the different haplotypes in the evaluated materials
| Haplotype | PSY‐A1 | PSY‐B1 | PDS‐B1 | ZDS‐A1 | LPX‐B1.1 | LPX‐A3 | Cultivar | b* mean |
|---|---|---|---|---|---|---|---|---|
| I | Psy‐Al | Psy‐B1n | Pds‐B1a | TdZds‐A1.1 | Lpx‐B1.1a | Kofa | Athoris | 29.5ab |
| II | Psy‐Al | Psy‐B1o | Pds‐B1b | TdZds‐A1.2 | Lpx‐B1.1c | UC1113 | Ottaviano | 27.2c |
| III | Psy‐Al | Psy‐B1o | Pds‐B1a | TdZds‐A1.1 | Lpx‐B1.1a | Kofa | Don Ricardo | 25.5d |
| IV | Psy‐Al | Psy‐B1o | Pds‐B1a | TdZds‐A1.1 | Lpx‐B1.1a | UC1113 | Doudou | 28.3bc |
| V | Psy‐Al | Psy‐B1o | Pds‐B1b | TdZds‐A1.1 | Lpx‐B1.1a | Kofa | Euroduro | 27.9c |
| VI | Psy‐Al | Psy‐B1o | Pds‐B1b | TdZds‐A1.1 | Lpx‐B1.1a | UC1113 | Amilcar, Avispa, Semidou, SY Atlante, SY Nilo | 27.5c |
| VII | Psy‐Al | Psy‐B1o | Pds‐B1b | TdZds‐A1.2 | Lpx‐B1.1a | Kofa | Sculptur | 30.7a |
| VIII | Psy‐Al | Psy‐B1n | Pds‐B1a | TdZds‐A1.1 | Lpx‐B1.1a | UC1113 | RGT Tacodur | 28.5bc |
Means followed by different letters are significantly different (P < 0.05) according to Tukey's test.
DISCUSSION
Various physical, chemical and functional characteristics determine the industrial quality of wheat, affecting its suitability for different uses in the food industry and other sectors, along with its market price. In durum wheat the traits related to grain filling and size (TW and TKW), protein content (GPC) and flour/semolina yield (VTR) are very important in Spain 29 and other countries as they are used as the primary traits to classify the grain into groups in the market. Gluten strength and the yellow colour of semolina are also very important quality traits and highly demanded by the pasta industry worldwide. Furthermore, the current trend is an increasing demand for cereal‐based foods with improved nutritional quality and enhanced health benefits. This trend has sparked growing interest in the development of new wheat cultivars with enhanced levels of beneficial components, such as dietary fibre. 30
Every year, novel durum wheat cultivars are evaluated in Andalusia (southern Spain) to assess their grain yield and quality characteristics, ensuring they meet industry and consumer standards. In this context, 12 durum wheat commercial cultivars were grown in Andalusia over two consecutive seasons to examine key traits. Additionally, the allelic variation in glutenin subunits (HMW‐GS and LMW‐GS) and genes associated with semolina yellowness was analysed.
Grain physical characteristics (TW, TKW, GPC and VTR) were predominantly influenced by the environment and the cultivar × environment interaction. The cultivar also had a significant effect, although to a lesser extent. Similar results were found by Tabbita et al. 31 evaluating eight durum wheat cultivars across different farmers' fields for these physical characteristics. Most of the cultivars exhibited TW ≥ 80 kg hL−1, reflecting the good adaptability of the cultivars to the different target environments. The values obtained for TKW were between 33.7 and 41 g depending on the cultivar, which is slightly lower than similar studies conducted under rainfed conditions with values over 40 g in most cases. 32 , 33 The results obtained among the different locations suggest that Jerez was the best‐suited environment for the cultivation of these durum wheat cultivars while Granada (with some influence of mountain climate) did not show positive results for physical grain characteristics. GPC was in general high, in most cases exceeding 15%. This high protein content could be explained by the low TKW as GPC is usually negatively correlated with grain size, as well as grain yield. 34 A high protein content contributes to a more compact and dense structure in the endosperm, reducing air spaces and conferring a vitreous appearance which is desirable to produce pasta products. Among the cultivars studied, Don Ricardo and Euroduro were the most outstanding genotypes for these characteristics, with the largest grains, well filled and medium protein content.
Although high GPC is a desirable trait, it is highly influenced by environmental factors, which makes it difficult to obtain genetic gains for this trait by breeding programmes. For this reason, durum wheat breeders put more efforts into improving the grain protein composition, which is genetically dependent, as it contributes to the production of wheat with strong gluten associated with high‐quality end products. A good indicator of gluten strength is GI, 35 being used here for the determination of protein quality. Although the environment was the biggest contributor to this trait, the genotype played a significant role, and an almost twofold variation was obtained.
Several studies have suggested the importance of prolamin composition on gluten quality of any genotype or cultivar. In durum wheat, the relevant role of LMW‐GS has been separated, although other prolamins such as HMW‐GS or gliadins also play a role. 5 , 6 The beneficial or detrimental effect of each subunit or allele has been extensively studied in bread wheat. The studies in durum wheat are scarcer, but there is certain consensus about which alleles are desirable to obtain high gluten strength. 36 For that reason, it is important to dissect the genetic composition underlying the phenotypic variability of that trait.
For HMW‐GS, no variation was detected in the cultivars evaluated here for the GLU‐A1 locus, all the cultivars showing the Glu‐A1c (Null) allele, which has a detrimental effect in comparison to other GLU‐A1 alleles. In fact, the introgression of new subunits for this locus, including variants with active y‐subunits, has been proposed as an alternative way for increasing the technological quality in durum wheat. 37 , 38 The GLU‐B1 locus showed more variation with three alleles, being Glu‐B1b (7 + 8) hegemonic. That is also the most frequent allele in modern durum wheat cultivars, being predominant in most countries. 39 The other two alleles were Glu‐B1d (6 + 8), present in cv. Ottaviano, and Glu‐B1z (7 + 15) in cv. Sculptur. This last allele is less frequent and was reported in CIMMYT‐derived germplasms and in one Iranian landrace. 40 , 41 These GLU‐B1 alleles have been described as beneficial alleles for gluten strength, although the Glu‐B1b (7 + 8) allele is considered better than the other two. 42 Paradoxically, in our case, cv. Sculptur showed the weakest gluten although it had the theoretical positive allele Glu‐B1z (7 + 15). However, this allele was only present in this cultivar, so it is not possible to draw clear conclusions about its effect.
The role of LMW‐GS in durum wheat quality was firstly described by Payne et al. 43 and Carrillo et al., 42 who established two band models associated with good (LMW‐2) and poor (LMW‐1) quality. Afterwards, these models were dissected according to the three loci (GLU‐A3, GLU‐B3 and GLU‐B2), which allowed more fine and accurate research focused on the relations among these loci and durum gluten quality. 27 According to the first classification, all cultivars of this study are catalogued as LMW‐2 and consequently of potential good gluten quality. Regarding the locus GLU‐A3, there are discrepancies about the effects on quality of the alleles Glu‐A3a (6) and Glu‐A3c (6 + 10). 34 In our study these alleles were present in cultivars with medium–low gluten strength. However, the effects of Glu‐A3ax (6.1) and Glu‐A3h (Null) have been described as beneficial. 36 It is notable that in our case the cultivars SY Nilo and Ottaviano, carrying Glu‐A3ax (6.1), presented some of the highest GI scores. On the other hand, cv. Scultptur with Glu‐A3h (Null) showed the weakest gluten. For GLU‐B3 most of the cultivars presented Glu‐B3a (2 + 4 + 15 + 19), described as having beneficial effects on gluten strength; except the cultivar Sculptur, carrying Glu‐B3g (2 + 4 + 15 + 16) related to intermediate effects.
The most common strategy for the development of cultivars with high YI has been traditionally focused on phenotypic selection of this trait. An increase in the knowledge of genetic control put the focus on the main genes contributing to carotenoid synthesis and degradation: PSY and LPX genes, respectively. 44 , 45 After identifying variants with contrasting effects of those genes, marker‐assisted selection started to be applied in breeding programmes. Nowadays, more genes related to this trait (PDS‐B1, ZDS‐A1, etc.) have been identified, which opens the possibility of developing new molecular markers that allow better selection for this trait. Previous studies have already analysed the influence of specific alleles related to PSY‐A1 and LPX‐B1.1 genes. 46 , 47 To our knowledge, this is the first report in which the PDS‐B1, ZDS‐A1 and LPX‐A3 genes were also analysed, identifying eight different haplotypes through the combined use of molecular markers from the aforementioned genes. The most common haplotype was haplotype VI with an average b* value of 27.5 for YI and presenting the following alleles: Psy‐A1l, Psy‐B1o, Pds‐B1b, TdZds‐A1.1, Lpx‐B1.1a and Lpx‐A3 UC1113. For PSY‐A1 all the cultivars showed the allele Psy‐A1l, associated with high yellow colour in these studies. Regarding PSY‐B1, the cultivars Athoris and RGT Tacodur were the only cultivars carrying the beneficial allele described for this gene, Psy‐B1n. 48 A similar case happened with ZDS‐A1, for which only cvs. Sculptur and Ottaviano had the allele associated with high yellow colour, TdZds‐A1.2. 14 In the case of PDS‐B1 there was a better balance between both alleles, although in this case it is still not clear which one is linked with better carotenoid content, as our results showed. More studies with a high number of genotypes are needed to know more about the influence of these genes and other contributing factors. In addition to this, we found that most of these cultivars carried the Lpx‐B1.1a allele, associated to higher degradation of carotenoids during processing stages. Only cv. Ottaviano had the allele Lpx‐B1.1c, which consists of a deletion of the enzyme that affects its functionality, 13 preventing pigment degradation. For LPX‐A3, these cultivars showed a higher frequency of the allele present in cv. UC1113, which in principle is linked to a higher yellow colour in semolina and pasta products. 13
Dietary fibre and other bioactive grain components are not a breeding target in durum wheat programmes. However, the changes in food patterns have increased the interest for these grain components associated with nutritional and health benefits. 49 For this reason, numerous public research institutions are making intense efforts to know more about them targeting their possible inclusion in breeding pipelines. 50 The main component of the dietary fibre in wheat, the arabinoxylans, present an asymmetric distribution in wheat grain, being more concentrated in the bran than in the endosperm, 51 which contributes to the better nutritional properties of whole‐meal foods. However, in general, consumers prefer food prepared with refined materials and, consequently, the pasta industry uses mostly refined semolina. Because of this, the search of genotypes with high AX content in the endosperm is an interesting objective, to develop semolina with better nutritional properties.
Our results showed that in the endosperm both TOT‐AXs and WE‐AXs were affected by the genotype and the environment, TOT‐AXs being more influenced by the environment. On the other hand, in wholemeal, the influence of the genotype was higher than in the endosperm, especially for WE‐AXs. For RF, the variation found for TOT‐AXs (14.5–16.7 mg g−1) was very similar to that of the study of De Santis et al. 52 (1.4–1.8%), where semolina of eight modern and seven old Italian durum wheat varieties was measured. The WE‐AX variation was narrower in our case (3.3–4.4 mg g−1) in comparison to De Santis et al., 52 reporting values of 0.3–0.8%. For WM, the TOT‐AX content corresponding to our cultivars (47.5–51.5 mg g−1) was slightly higher than that of the study of Ciccoritti et al. 53 where 19 durum wheat varieties were analysed for that trait and whose content was 4.3–5.2%. In the case of WE‐AXs (3.2–4.7 mg g−1) the variation was lower than the one reported by Ciccoritti et al. 53 (0.5–0.9%) for WE‐AX fractions. The variation found in durum wheat for the TOT‐AX content, particularly in the endosperm, is narrower than the variation identified in common wheat. This difference is even more pronounced in the WE‐AX fraction. 54 In bread wheat, outstanding cultivars for AX content, such as Yumai‐34, have been identified. Therefore, it is necessary to screen tetraploid genetic resources looking for possible donors of this trait before starting breeding approaches to obtain healthier grains with high dietary fibre content and to meet the demands of consumers. Otherwise, another alternative could be the transference of previously described quantitative trait loci from common wheat. 55
CONCLUSIONS
The contrasting environments used in this study had an important influence on quality traits, highlighting the strong variability of Mediterranean locations for durum wheat cultivation. The genotype also had a significant influence on the three main quality traits of the study: gluten strength, yellow index and arabinoxylans (dietary fibre). Don Ricardo and Euroduro showed the best performances in terms of grain morphological characteristics, Ottaviano was the cultivar with the highest gluten strength, Sculptur had the highest yellow colour of semolina and Athoris stood out for its AX content. Our data reveal that in terms of gluten quality and yellow colour the best alleles are present in the cultivars used, but they are not merged in a single cultivar to maximise those quality traits. This study also highlights the importance of searching for durum wheat dietary fibre donors, as its genetic variability is limited, particularly in the endosperm.
AUTHOR CONTRIBUTIONS
Virginia Garcia‐Calabres: Writing – original draft, Formal analysis, Investigation, Data curation. Francisco Andrade: Investigation. Facundo Tabbita: Writing – review and editing, Formal analysis. Alejandro Castilla: Investigation, Writing – review and editing. Josefina C Sillero: Investigation, Writing – review and editing. Nayelli Hernández‐Espinosa: Methodology. Maria Itria Ibba: Methodology, Writing – review and editing. Carlos Guzmán: Writing – review and editing, Supervision, Project administration, Funding acquisition, Conceptualisation. Juan B Alvarez: Writing – review and editing, Supervision, Project administration, Funding acquisition, Conceptualisation.
FUNDING INFORMATION
This research was supported by the project P20_00426 from the Regional Ministry of Economy, Innovation, Science and Employment (Regional Government of Andalusia, Spain). V. Garcia‐Calabres gratefully acknowledges to FPI predoctoral fellowship (PRE2022‐101234) linked to the project PID2021‐122530OB‐I00 funded by the Spanish State Research Agency (Spanish Ministry of Science and Innovation) ‐ MCIN/AEI/10.13039/501100011033. CG gratefully acknowledges the European Social Fund and the Spanish State Research Agency (Spanish Ministry of Science and Innovation) for financial funding through the Ramon y Cajal Program (RYC‐2017‐2021 891). FT acknowledges economic funding from the Maria Zambrano Grants financed by the European Union's Next Generation EU. RAEA field trials are funded by the European Regional Development Fund, project Andalucia 2014–2020.
CONFLICT OF INTEREST
The paper has not been published or simultaneously submitted for publication elsewhere. We have no conflict of interest to declare and all the authors agreed with this submission.
Supporting information
Table S1. Raw data of wheat quality traits, glutenin composition, and molecular markers associated with yellow colour for all genotypes across environments, locations, years, and replicates. Data include test weight (TW), thousand kernel weight (TKW), vitreousness (VIT), gluten index (GI), protein content (PRO), yellow index (b*), and total and water‐extractable arabinoxylans (TOTAX and WEAX), both in refined flour (RF) and wholemeal (WM).
ACKNOWLEDGEMENTS
We thank RAEA, Spain for carrying out the field trials and supplying the analysed materials. Funding for open access charge: Universidad de Córdoba / CBUA.
DATA AVAILABILITY STATEMENT
The data that supports the findings of this study are available in the supplementary material of this article.
REFERENCES
- 1. Feldman M, Levy AA and Triticum L, Wheat Evolution and Domestication. Springer International Publishing, Cham, pp. 365–526 (2023). [Google Scholar]
- 2. Martínez‐Moreno F, Ammar K and Solís I, Global changes in cultivated area and breeding activities of durum wheat from 1800 to date: a historical review. Agronomy 12:1135 (2022). 10.3390/agronomy12051135. [DOI] [Google Scholar]
- 3. Faridi H and Faubion JM eds, Wheat end uses around the world, in Wheat End Uses Around the World. American Association of Cereal Chemists, St Paul, MN: (1995). [Google Scholar]
- 4. Sissons M, Role of durum wheat composition on the quality of pasta and bread. Food 2:75–90 (2008). [Google Scholar]
- 5. Shewry PR and Halford NG, Cereal seed storage proteins: structures, properties and role in grain utilization. J Exp Bot 53:947–958 (2002). 10.1093/jexbot/53.370.947. [DOI] [PubMed] [Google Scholar]
- 6. Porceddu E, Turchetta T, Masci S, D'Ovidio R, Lafiandra D, Kasarda DD et al., Variation in endosperm protein composition and technological quality properties in durum wheat. Euphytica 100:197–205 (1998). 10.1023/A:1018338308795. [DOI] [Google Scholar]
- 7. Colasuonno P, Marcotuli I, Blanco A, Maccaferri M, Condorelli GE, Tuberosa R et al., Carotenoid pigment content in durum wheat (Triticum turgidum L. var durum): an overview of QTL and candidate genes. Front Plant Sci 10:1347 (2019). 10.3389/fpls.2019.01347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Adom KK, Sorrells ME and Liu RH, Phytochemical profiles and antioxidant activity of wheat varieties. J Agric Food Chem 51:7825–7834 (2003). 10.1021/jf030404l. [DOI] [PubMed] [Google Scholar]
- 9. Hentschel V, Kranl K, Hollmann J, Lindhauer MG, Böhm V and Bitsch R, Spectrophotometric determination of yellow pigment content and evaluation of carotenoids by high‐performance liquid chromatography in durum wheat grain. J Agric Food Chem 50:6663–6668 (2002). 10.1021/jf025701p. [DOI] [PubMed] [Google Scholar]
- 10. Mezzomo N and Ferreira SRS, Carotenoids functionality, sources, and processing by supercritical technology: a review. J Chem 2016:3164312 (2016). 10.1155/2016/3164312. [DOI] [Google Scholar]
- 11. Mrowicka M, Mrowicki J, Kucharska E and Majsterek I, Lutein and zeaxanthin and their roles in age‐related macular degeneration‐neurodegenerative disease. Nutrients 14:827 (2022). 10.3390/nu14040827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Borrelli GM, Troccoli A, Di Fonzo N and Fares C, Durum wheat lipoxygenase activity and other quality parameters that affect pasta color. Cereal Chem 76:335–340 (1999). 10.1094/CCHEM.1999.76.3.335. [DOI] [Google Scholar]
- 13. Carrera A, Echenique V, Zhang W, Helguera M, Manthey F, Schrager A et al., A deletion at the Lpx‐B1 locus is associated with low lipoxygenase activity and improved pasta color in durum wheat (Triticum turgidum ssp. durum). J Cereal Sci 45:67–77 (2007). 10.1016/j.jcs.2006.07.001. [DOI] [Google Scholar]
- 14. Pasten MC, Roncallo PF, Camargo Acosta EY, Echenique V and Garbus I, Association of novel characterized sequence variations in the z‐carotene desaturase (Zds) gene with yellow color and yellow pigment content in durum wheat cultivars. J Cereal Sci 99:103185 (2021). 10.1016/j.jcs.2021.103185. [DOI] [Google Scholar]
- 15. Rasheed A, Wen W, Gao F, Zhai S, Jin H, Liu J et al., Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor Appl Genet 129:1843–1860 (2016). 10.1007/s00122-016-2743-x. [DOI] [PubMed] [Google Scholar]
- 16. Singh A, Reimer S, Pozniak CJ, Clarke FR, Clarke JM, Knox RE et al., Allelic variation at Psy1‐A1 and association with yellow pigment in durum wheat grain. Theor Appl Genet 118:1539–1548 (2009). 10.1007/s00122-009-1001-x. [DOI] [PubMed] [Google Scholar]
- 17. Hald S, Schioldan AG, Moore ME, Dige A, Lærke HN, Agnholt J et al., Effects of arabinoxylan and resistant starch on intestinal microbiota and short‐chain fatty acids in subjects with metabolic syndrome: a randomised crossover study. PLoS One 11:e0159223 (2016). 10.1371/journal.pone.0159223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Vogel B, Gallaher DD and Bunzel M, Influence of cross‐linked arabinoxylans on the postprandial blood glucose response in rats. J Agric Food Chem 60:3847–3852 (2012). 10.1021/jf203930a. [DOI] [PubMed] [Google Scholar]
- 19. Brijs K, Ingelbrecht JA, Courtin CM, Schlichting L, Marchylo BA and Delcour JA, Combined effects of endoxylanases and reduced water levels in pasta production. Cereal Chem 81:361–368 (2004). 10.1094/CCHEM.2004.81.3.361. [DOI] [Google Scholar]
- 20. Turner MA, Soh CH, Ganguli NK and Sissons MJ, A survey of water‐extractable arabinopolymers in bread and durum wheat and the effect of water‐extractable arabinoxylan on durum dough rheology and spaghetti cooking quality. J Sci Food Agric 88:2551–2555 (2008). 10.1002/jsfa.3385. [DOI] [Google Scholar]
- 21. AACC International , Approved Methods of Analysis (Method 55‐10.01), 11th edn. AACC International, Minnesota: (2010). 10.1094/AACCIntMethod-55-10.01. [DOI] [Google Scholar]
- 22. International Association for Cereal Science and Technology (ICC) , Standard No. 155: Determination of wet gluten quantity and quality (Gluten Index according to Perten) of whole wheat meal and wheat flour (Triticum aestivum). ICC, Vienna: (1994). [Google Scholar]
- 23. Hernández‐Espinosa N, Saulnier L, Posadas‐Romano G and Ibba MI, Quantification of the total and water‐extractable pentosan content in wheat flour using a higher‐throughput version of the phloroglucinol colorimetric assay. Zenodo (2022). 10.5281/zenodo.6824411. [DOI] [Google Scholar]
- 24. Alvarez JB, Martín A and Martín LM, Variation in the high‐molecular‐weight glutenin subunits coded at the Glu‐Hch1 locus in Hordeum chilense . Theor Appl Genet 102:134–137 (2001). 10.1007/s001220051628. [DOI] [Google Scholar]
- 25. Payne PI and Lawrence GJ, Catalogue of alleles for the complex gene loci, Glu‐A1, Glu‐B1 and Glu‐D1 which code for high‐molecular‐weight subunits of glutenin in hexaploid wheat. Cereal Res Commun 11:29–35 (1983). [Google Scholar]
- 26. Lerner SE, Cogliatti M, Ponzio NR, Seghezzo ML, Molfese ER and Rogers WJ, Genetic variation for grain protein components and industrial quality of durum wheat cultivars sown in Argentina. J Cereal Sci 40:161–166 (2004). 10.1016/j.jcs.2004.05.001. [DOI] [Google Scholar]
- 27. Nieto‐Taladriz MT, Ruiz M, Martinez MC, Vazquez JF and Carrillo JM, Variation and classification of B low‐molecular‐weight glutenin subunit alleles in durum wheat. Theor Appl Genet 95:1155–1160 (1997). 10.1007/s001220050676. [DOI] [Google Scholar]
- 28. Stacey J and Isaac PG, Isolation of DNA from plants, in Protocols for Nucleic Acid Analysis by Nonradioactive Probes, ed. by Isaac PG. Humana Press, Totowa, NJ, pp. 9–15 (1994). [Google Scholar]
- 29. Royal Decree , 190/2013 by the Spanish Ministry of Agriculture, Food and Environment Available: https://www.boe.es/eli/es/rd/2013/03/15/190 [10 October 2024].
- 30. Shewry PR, Charmet G, Branlard G, Lafiandra D, Gergely S, Salgó A et al., Developing new types of wheat with enhanced health benefits. Trends Food Sci Technol 25:70–77 (2012). 10.1016/j.tifs.2012.01.003. [DOI] [Google Scholar]
- 31. Tabbita F, Ortiz‐Monasterio I, Piñera‐Chavez FJ, Ibba MI and Guzmán C, On‐farm assessment of yield and quality traits in durum wheat. J Sci Food Agric 103:5108–5115 (2023). 10.1002/jsfa.12580. [DOI] [PubMed] [Google Scholar]
- 32. Rharrabti Y, Villegas D, Royo C, Martos‐Nunez V and del García Moral LF, Durum wheat quality in Mediterranean environments II. Influence of climatic variables and relationships between quality parameters. Field Crop Res 80:133–140 (2003). 10.1016/S0378-4290(02)00177-6. [DOI] [Google Scholar]
- 33. Royo C, Villegas D, Rharrabti Y, Blanco R, Martos V and García Del Moral LF, Grain growth and yield formation of durum wheat grown at contrasting latitudes and water regimes in a Mediterranean environment. Cereal Res Commun 34:1021–1028 (2006). 10.1556/CRC.34.2006.2-3.233. [DOI] [Google Scholar]
- 34. Blanco A, Mangini G, Giancaspro A, Give S, Colasuonno P, Simeone R et al., Relationships between grain protein content and grain yield components through quantitative trait locus analyses in a recombinant inbred line population derived from two elite durum wheat cultivars. Mol Breed 30:79–92 (2012). 10.1007/s11032-011-9600-z. [DOI] [Google Scholar]
- 35. AbuHammad WA, Elias EM, Manthey FA, Alamri MS and Mergoum M, A comparison of methods for assessing dough and gluten strength of durum wheat and their relationship to pasta cooking quality. Int J Food Sci Technol 47:2561–2573 (2012). 10.1111/j.1365-2621.2012.03135.x. [DOI] [Google Scholar]
- 36. Ruiz M and Giraldo P, The influence of allelic variability of prolamins on gluten quality in durum wheat: an overview. J Cereal Sci 101:103304 (2021). 10.1016/j.jcs.2021.103304. [DOI] [Google Scholar]
- 37. Ciaffi M, Lafiandra D, Turchetta T, Ravaglia S, Bariana H, Gupta RB et al., Breadbaking potential of durum wheat lines expressing both x‐ and y‐type subunits at the Glu‐A1 locus. Cereal Chem 72:465–469 (1995). [Google Scholar]
- 38. Alvarez JB, Caballero L, Nadal S, Ramirez MC and Martín A, Development and gluten strength evaluation of introgression lines of Triticum urartu in durum wheat. Cereal Res Commun 37:243–248 (2009). 10.1556/CRC.37.2009.2.11. [DOI] [Google Scholar]
- 39. Magallanes‐Lopez AM, Ammar K, Morales‐Dorantes A, Gonzalez‐Santoyo H, Crossa J and Guzman C, Grain quality traits of commercial durum wheat varieties and their relationships with drought stress and glutenins composition. J Cereal Sci 75:1–9 (2017). 10.1016/j.jcs.2017.03.005. [DOI] [Google Scholar]
- 40. Bellil I, Hamdi O and Khelifi D, Diversity of five glutenin loci within durum wheat (Triticum turgidum L. ssp. durum (Desf.) Husn.) germplasm grown in Algeria. Plant Breed 133:179–183 (2014). 10.1111/pbr.12156. [DOI] [Google Scholar]
- 41. Hernández‐Espinosa N, Payne T, Huerta‐Espino J, Cervantes F, Gonzalez‐Santoyo H, Ammar K et al., Preliminary characterization for grain quality traits and high and low molecular weight glutenins subunits composition of durum wheat landraces from Iran and Mexico. J Cereal Sci 88:47–56 (2019). 10.1016/j.jcs.2019.05.007. [DOI] [Google Scholar]
- 42. Carrillo JM, Vazquez JF and Orellana J, Relationship between gluten strength and glutenin proteins in durum wheat cultivars. Plant Breed 104:325–333 (1990). 10.1111/j.1439-0523.1990.tb00443.x. [DOI] [Google Scholar]
- 43. Payne PI, Jackson EA and Holt LM, The association between γ‐gliadin 45 and gluten strength in durum wheat varieties: a direct causal effect or the result of genetic linkage? J Cereal Sci 2:73–81 (1984). 10.1016/S0733-5210(84)80020-X. [DOI] [Google Scholar]
- 44. Hessler TG, Thomson MJ, Benscher D, Nachit MM and Sorrells ME, Association of a lipoxygenase locus, Lpx‐B1, with variation in lipoxygenase activity in durum wheat seeds. Crop Sci 42:1695–1700 (2002). 10.2135/cropsci2002.1695. [DOI] [Google Scholar]
- 45. Pozniak CJ, Knox RE, Clarke FR and Clarke JM, Identification of QTL and association of a phytoene synthase gene with endosperm colour in durum wheat. Theor Appl Genet 114:525–537 (2007). 10.1007/s00122-006-0453-5. [DOI] [PubMed] [Google Scholar]
- 46. Campos KM, Royo C, Schulthess A, Villegas D, Matus I, Ammar K et al., Association of phytoene synthase Psy1‐A1 and Psy1‐B1 allelic variants with semolina yellowness in durum wheat (Triticum turgidum L. var. durum). Euphytica 207:109–117 (2016). 10.1007/s10681-015-1541-x. [DOI] [Google Scholar]
- 47. Parada R, Royo C, Gadaleta A, Colasuonno P, Marcotuli I, Matus I et al., Phytoene synthase 1 (Psy‐1) and lipoxygenase 1 (Lpx‐1) genes influence on semolina yellowness in wheat Mediterranean germplasm. Int J Mol Sci 21:4669 (2020). 10.3390/ijms21134669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Zhang W and Dubcovsky J, Association between allelic variation at the phytoene synthase 1 gene and yellow pigment content in the wheat grain. Theor Appl Genet 116:635–645 (2008). 10.1007/s00122-007-0697-8. [DOI] [PubMed] [Google Scholar]
- 49. Nitzko S, Consumer preferences for naturally high‐fiber and fiber‐fortified foods: a preliminary segmentation study. J Consum Prot Food Saf 18:119–132 (2023). 10.1007/s00003-023-01429-w. [DOI] [Google Scholar]
- 50. Shewry PR, Hazard B, Lovegrove A and Uauy C, Improving starch and fibre in wheat grain for human health. Biochemistry 42:40–45 (2020). 10.1042/BIO20200051. [DOI] [Google Scholar]
- 51. Marcotuli I, Hsieh YS, Lahnstein J, Yap K, Burton RA, Blanco A et al., Structural variation and content of arabinoxylans in endosperm and bran of durum wheat (Triticum turgidum L.). J Agric Food Chem 64:2883–2892 (2016). 10.1021/acs.jafc.6b00103. [DOI] [PubMed] [Google Scholar]
- 52. De Santis MA, Kosik O, Passmore D, Flagella Z, Shewry PR and Lovegrove A, Comparison of the dietary fibre composition of old and modern durum wheat (Triticum turgidum spp. durum) genotypes. Food Chem 244:304–310 (2018). 10.1016/j.foodchem.2017.09.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Ciccoritti R, Scalfati G, Cammerata A and Sgrulletta D, Variations in content and extractability of durum wheat (Triticum turgidum L. var durum) arabinoxylans associated with genetic and environmental factors. Int J Mol Sci 12:4536–4549 (2011). 10.3390/ijms12074536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Gebruers K, Dornez E, Boros D, Fraś A, Dynkowska W, Bedo Z et al., Variation in the content of dietary fiber and components thereof in wheats in the HEALTHGRAIN diversity screen. J Agric Food Chem 56:9740–9749 (2008). 10.1021/jf800975w. [DOI] [PubMed] [Google Scholar]
- 55. Ibba MI, Juliana P, Hernández‐Espinosa N, Posadas‐Romano G, Dreisigacker S, Sehgal D et al., Genome‐wide association analysis for arabinoxylan content in common wheat (T. aestivum L.) flour. J Cereal Sci 98:103166 (2021). 10.3390/plants12010184. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Raw data of wheat quality traits, glutenin composition, and molecular markers associated with yellow colour for all genotypes across environments, locations, years, and replicates. Data include test weight (TW), thousand kernel weight (TKW), vitreousness (VIT), gluten index (GI), protein content (PRO), yellow index (b*), and total and water‐extractable arabinoxylans (TOTAX and WEAX), both in refined flour (RF) and wholemeal (WM).
Data Availability Statement
The data that supports the findings of this study are available in the supplementary material of this article.
