Mucoadhesive Andrographolide-Loaded Liposomes for Nasal Delivery Modulate Inflammatory Responses in Tumor Necrosis Factor Alpha-Induced Acute Lung Injury in Mice

Abstract

Inflammatory lung injury from a fever or sepsis can impair pulmonary function. While anti-inflammatory agents are commonly used, side effects could occur. Andrographolide (AGP) exhibits potent anti-inflammatory activity, making it a promising alternative treatment. Nevertheless, AGP has low solubility and absorption, and drug-delivery liposomes (Lip) improve site-specific targeting and controlled release. This study aimed to develop and evaluate the physicochemical properties, safety, and therapeutic efficacy of AGP-Lip through both in vitro and in vivo studies. The characteristics of AGP-Lip included an average size of 139.7 ± 2.00 nm, a polydispersity index of 0.16 ± 0.02, and a zeta potential of 34.5 ± 0.80 mV, with strong mucoadhesive properties. AGP-Lip exhibited no cytotoxicity in IMR-90 lung fibroblast cells while effectively reducing inflammation by decreasing nitric oxide production in RAW 264.7 murine macrophage cells exposed to lipopolysaccharide. In the animal study, adult male C57BL/6 mice received a single intraperitoneal dose of 100 μg/kg of tumor necrosis factor-α (TNF-α)-induced acute pulmonary systemic inflammation. Mice were randomly assigned to six groups (9 mice per group): control, PBS (negative control), Blank-Lip, AGP-Lip, dexamethasone (POS), and AGP-Lip+POS. All treatments (20 to 25 μL with AGP-Lip, AGP-Lip, and/or POS at 1 mg/kg) were administered via nasal delivery daily for 7 days. The vehicle-treated mice exhibited signs of sickness and systemic inflammation, including reduced body weight gain, hyperlocomotion, decreased exploratory activity, elevated total white blood cell counts, serum IL-6 and TNF-α, and upregulation of targeted mRNA expression of lung inflammatory markers. Histological analysis showed an increase in inflammatory scores, and secretory cells were also observed in the vehicle-treated group. AGP-Lip improved body weight and stress-related behaviors, restored mRNA expression levels of IFN-γ, IL-1α/β, IL-6, IL-10, NF-κBp65, and TNF-α, and alleviated mucus secretion in lung histological analysis. Notably, AGP-Lip effectively mitigated the detrimental effects compared to POS alone, showing significant differences in serum IL-6, lung inflammation-related gene expression (i.e., IFN-γ, IL-1α, NF-κBp50, and VEGF), and PAS staining relative to the combined treatment. These findings suggest that AGP-Lip could serve as a potential alternative treatment for acute respiratory infections, warranting further consideration for long-term administration and clinical trials.

1. Introduction

Inflammatory lung injury, encompassing sepsis-induced acute lung injury (ALI) and acute respiratory distress syndrome, is marked by heightened expression of pro-inflammatory cytokines. This cytokine storm syndrome is characterized by elevated levels of pro-inflammatory cytokines including interleukins (IL), interferons (IFN), and tumor necrosis factor-alpha (TNF-α). The presence of cytokine storm syndrome is linked to clinical deterioration and high mortality in patients with viral infections, including coronavirus disease 2019, and influenza. Currently, efficient drugs or strategies to treat cytokine storm syndrome and its associated ALI in respiratory infections are lacking.

Although many anti-inflammatory and immunomodulatory medications, i.e., dexamethasone (DEX), a synthetic glucocorticoid, are commonly prescribed, , these treatments often elicit delayed responses and cause side effects such as hyperglycemia, osteoporosis, and increased susceptibility to infections. DEX exerts its effects through both genomic and nongenomic mechanisms. Genomically, it binds to glucocorticoid receptors, activating gene transcription to reduce inflammation by inhibiting phospholipase A2 and suppressing cytokines. Nongenomically, it interacts with cell membrane receptors, modulating ion transport, second messenger systems, and protein kinase activation to produce rapid anti-inflammatory effects. ,

Among natural anti-inflammatory compounds such as curcumin, boswellic acids, and epigallocatechin-3-gallate in green tea, − andrographolide (AGP), derived from Andrographis paniculata, has shown potential in alleviating inflammatory and immunomodulatory actions. , AGP could reduce cytokines (i.e., TNF-α, IL-6, and IL-1β) in bronchoalveolar lavage fluid and serum by inhibiting the mitogen-activated protein kinase and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathways, attenuating lipopolysaccharide-induced ALI. , Furthermore, AGP inhibits absent in melanoma 2 inflammasome activation to mitigate radiation-induced lung injury and reduces inflammatory and oxidative biomarkers including IL-1β, IFN-γ-induced protein 10, monocyte chemoattractant protein-1, keratinocyte chemoattractant, 8-isoprostane, and 3-nitrotyrosinewhile enhancing antioxidant enzyme activities in mice with radiation-induced lung injury and cigarette smoke-induced ALI. ,

One of the major challenges in utilizing natural AGP as a therapeutic agent lies in its attenuated pharmacological-like action and limited efficacy in treating inflammatory lung conditions. The development of advanced delivery systems, i.e., nanoparticles, can enhance the bioavailability and therapeutic efficacy of medication or natural anti-inflammatory agents, providing safer and more effective treatments for inflammatory conditions. − Optimization of the physicochemical properties of AGP is critical to enhancing its therapeutic efficacy and clinical applicability. This has prompted the advancement of nanocarrier-based delivery systems, particularly liposome (Lip)-encapsulated formulations. In liposomal design, factors such as lipid composition, particle size, and surface modifications significantly influence drug release kinetics, biodistribution, and cellular uptake. These characteristics collectively enable site-specific drug delivery, i.e., AGP to specific tissues or cellular sites affected by infection or inflammatory processes.

Although traditional Lip synthesis methods have been widely utilized, limitations persist in achieving precise control over the physicochemical properties. Microfluidic technology presents a novel and promising approach for synthesizing herbal compound-loaded Lip, as demonstrated in the successful encapsulation of catechin and curcumin. This technique holds potential for the efficient encapsulation of AGP, enabling improved targeting, enhanced bioavailability, and sustained release, thereby making it particularly well-suited for drug delivery applications.

In addition to drug design, among the various routes of administration, nasal drug delivery systems have garnered increasing attention due to their distinct pharmacokinetic advantages. Unlike oral, intraperitoneal, or intravenous routes, nasal administration can bypass first-pass metabolism by the liver and minimize drug degradation by the gastrointestinal tract or renal elimination. Building on this, microfluidic-generated AGP-Lips could enhance nasal drug delivery by enabling targeted and controlled release, offering therapeutic potential for the treatment of inflammatory lung conditions. To evaluate the therapeutic efficacy of AGP-Lips, an animal model of TNF-α-induced lung injury was utilized, , which closely mirrors the inflammatory processes observed in various lung diseases. The induction of TNF-α led to increased levels of pro-inflammatory cytokines, neutrophil infiltration, and tissue damage.

Thus, the study aimed to develop and determine the in vitro safety and in vivo therapeutic efficacy of microfluidic AGP-Lips, with potential applications in clinical studies and medical treatment. The hypothesis was that the enhanced delivery properties of the nanoparticles would improve the bioavailability, leading to better outcomes for AGP in reducing inflammation in cultured cell lines and tissue damage in lung tissues in animal models.

2. Materials and Methods

Andrographolide was purchased from Sigma (MA, USA). Cholesterol (CAS No. 57-88-5) was purchased from Avanti Polar Lipids (Birmingham, USA). The 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC, CAS No. 63-89-8) was from Avanti Polar Lipids (Darmstadt, Germany). Didecyldimethylammonium bromide (DDAB, CAS No. 3282-73-3) was from Sigma–Aldrich Chemical Co. (St. Louis, USA). Phosphate-buffered saline pH 7.4 (PBS; containing 137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄ and 2 mM KH₂PO₄) and the Amicon filter were from Merck Millipore Ltd. Distilled water was from ELGA (PureLab Ultra, Illinois, USA).

2.1. Preparation and Characterization of Andrographolide-Loaded Liposome (AGP-Lip)

AGP-Lips were prepared by a microfluidic method. In short, lipids were dissolved in ethanol (total concentration: 5% v/v) consisting of 6.25 mM DPPC, 5.00 mM cholesterol, and 1.25 mM DDAB. Also, the water phase is PBS pH 7.4 (total concentration: 95% v/v). A lipid phase was forced through the Y-geometry of a microchip with a continuous water phase. The collected AGP-Lip was purified using an Amicon centrifugal filter with a 100 kDa molecular weight cutoff (Merck Millipore, Ireland). The physical properties of the nanoparticles were investigated by a dynamic light scattering (DLS) Nanosizer (Malvern, UK). The particle suspension was diluted 1,000 times in DI water before the analysis. All measurements were performed in triplicate at 25 °C. The percentage of encapsulation efficiency (%EE) was characterized using HPLC. The morphology of AGP-Lip was investigated by transmission electron microscope (TEM, JEM-2100 Plus, JEOL, Osaka, Japan). The TEM sample was diluted in DI water and dropped directly on a copper grid, and the samples were observed with a magnification of 40k and at 200 kV. The long-term stability of AGP-Lip during 3 month-storage in distilled water at 4, 25, and 40 °C was also observed. ,

2.2. Determination of the Mucoadhesive Potential of Liposomes

The mucoadhesive properties of liposomes were evaluated by assessing their interaction with mucin using the mucin particle method. Porcine mucin was prepared by suspending 1% w/v mucin in Tris-base buffer (pH 6.8) and stirring at 37 °C and 500 rpm for 24 h. The suspension was then sonicated (VCX750 probe, Sonics & Materials, Inc., Connecticut, USA) at 30% amplitude for 3 min, followed by centrifugation at 4 °C and 4,000 rpm for 30 min. AGP-Lip were subsequently mixed with the mucin solution in varying ratios and incubated at 37 °C for 1 h. Zeta potential and particle size were then analyzed using a DLS Nanosizer (Zetasizer NanoZS, Malvern Instruments, Worcestershire, UK). All measurements were performed in triplicate, and average values were reported according to the method of Khongkow et al. (2023).

2.3. Determination of Cytotoxicity Test of AGP-Lip

IMR-90 cells were cultured in EMEM (EBSS) supplemented with 2 mM glutamine, 1% nonessential amino acids (NEAA), and 10% fetal bovine serum (FBS). Then, IMR-90 cells (10,000 cells per well) were seeded into 96-well plates and cultured for 24 h. Subsequently, the cells were treated with blank liposome (Blank-Lip), AGP-Lip, and AGP extract at varying concentrations (0–250 μg/mL) for another 24 h. Following the treatment, 100 μL of MTT solution (1 mg/mL) was added to each well and incubated for 4 h. The resulting formazan crystals were dissolved using DMSO, and the absorbance was recorded at 570 nm using a microplate reader.

2.4. Determination of Nitric Oxide (NO) Test of AGP-Lip

RAW 264.7 cells were cultured in 48-well plates at a density of 5 × 10⁴ per well and incubated for 24 h. Once the cells reached 70–80% confluence, they were treated with either 100 μg/mL of AGP-Lip or AGP extract for 24 h. Following this pretreatment, the cells were exposed to 0.1 μg/mL lipopolysaccharide (LPS) for 24 h. After the incubation period, the cells were harvested, and the supernatant was collected to assess nitrite levels using the Griess reagent (Sigma) in accordance with the manufacturer’s instructions. Specifically, 150 μL of supernatant was mixed with an equal volume of Griess reagent and incubated in the dark at room temperature for 15 min, and the absorbance was measured at 546 nm using a UV/vis microplate reader. NO concentrations were expressed as a percentage relative to the untreated control group.

2.5. Preparation of Animals and Treatments

Fifty-four 8-week-old male C57BL/6 mice were obtained from the Nomura Siam International Co., Ltd., Bangkok, Thailand, and were housed under standard conditions at the Laboratory Animal Center, Thammasat University. The environment was maintained at 24.0 ± 2 °C with 50 ± 5% humidity and a 12 h light/dark cycle (lights on at 6:00 a.m. and off at 6:00 p.m.). Each cage housed four to five mice, with access to distilled water and rodent chow ad libitum. All experimental procedures strictly adhered to the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals (8th edition) and were approved by the Institutional Committee for Animal Care and Use (IACUC) of Thammasat University, Thailand (Protocol 21/2021, renewed in 2024). After a one-week acclimatization period, mice were randomly divided into six groups (n = 9). The noninflammatory induction mice (control, CON) received a single intraperitoneal injection (i.p.) of 10 mL/kg PBS, while inflammatory induction mice received TNF-α dissolved in PBS. To compare the efficacy of liposomal nanodelivery, the control (CON) and negative control (NEG) groups received phosphate-buffered saline (PBS). The positive control (POS) group was treated with dexamethasone (DEX) at a dose of 1 mg/kg. Another group received Blank-Lip at the same dose (1 mg/kg). The AGP-Lip group was treated with AGP-loaded liposomes (1 mg/kg), while the combined AGP-Lip+POS group received both AGP-Lip and DEX. All treatments were administered intranasally for 7 consecutive days in a volume of 20–25 μL of PBS, Blank-Lip, or AGP-Lip, adjusted according to body weight. To induce acute systemic inflammation, mice received a single dose of 100 μg/kg recombinant human TNF-α (i.p.), which recruited neutrophils and macrophages, initiating inflammation and mediating DNA fragmentation and apoptosis. This was followed by treatment with 1 mg/kg AGP-Lip, and/or 1 μg/kg DEX between 13:00 and 14:00 for 7 days (Days 1–7). This dose was based on previous findings, where treatment with 1 mg/kg AGP in a 1 μL/mL AGP-Lip formulation resulted in a significant reduction in lymphocyte, neutrophil, and macrophage counts in mice treated with AGP. Therefore, for a mouse weighing 25 g, 25 μL of the 1 mg/mL solution was administered to deliver a 1 mg/kg dose.

Daily body weight changes from the start of the experiment and locomotor activity were recorded to determine sickness-like symptoms. Upon completion of the treatment period, all mice were evaluated for anxiety and locomotor activities using an open-field test (OFT) on day 8. Subsequently, the mice were anesthetized via the inhalation of isoflurane. Blood and lungs were collected by cardiac puncture and from the thoracic cavity for complete blood counts, inflammatory mRNA expression, and histopathological analyses.

2.6. Determination of Sickness-Like Symptoms

Following a 7-day treatment period, weight loss and locomotor activity were evaluated to assess sickness behavior. Mice were weighed at each assessment, and the weight changes were recorded. The body weight gains were expressed as changes from the starting experimental period. In addition, the OFT assesses exploration in a novel environment, general locomotor activity, and anxiety-like behavior. On day 8, the OFT was conducted in a black acrylic enclosure (100 × 100 × 40 cm) marked with a 20 × 20 grid. The inner zone (90 × 90 cm) and outer zone were defined for anxiety assessment. The apparatus was illuminated with 200 lx, and behavior was recorded with an overhead infrared camera for 5 min. After each trial, the apparatus was cleaned with 20% alcohol between tests. Locomotor and rearing-exploratory activity responses in the open arena were assessed by counting the total number of line crosses. Increased time spent in the outer zone and the count of fecal pellets indicated higher levels of anxiety. ,,

2.7. Determination of Hematological Profiles

Complete blood counts were performed on whole blood samples collected in EDTA tubes and analyzed using an automated hematology analyzer (Mindray BC-5000 VET, Guangdong, China). Serum TNF-α and IL-6 levels were quantified using the mouse TNF-α and IL-6 ELISA kits (RayBiotech Life, Inc., Georgia, USA), following the manufacturer’s instructions.

2.8. Determination of Lung Inflammation Gene Expression

All lung tissues from C57BL/6 mice were collected in fresh conditions and transferred directly by a nitrogen tank to the laboratory. First, the samples were ground in a frozen mortar with a frozen pestle for 60 s. Then, 5 mL of liquid nitrogen was added to the mortar to grind the tissues a second time. The homogenized tissues were transferred to 1.5 mL of RNase-free Eppendorf tube containing 1 mL of TRIzol reagent (Thermo Fisher Scientific, MA, USA) and stored on ice. The mixture was incubated at 65 °C for 30 min and vortexed per 5 min. Then, all samples were centrifuged at 3500 rpm at 4 °C for 10 min, and the supernatant was transferred into a new Eppendorf tube. Next, 200 μL of chloroform was added and the mixture was incubated at room temperature for 5 min. Thereafter, it was separated into three phases by centrifugation at 12,000 rpm at 4 °C for 15 min. The colorless upper aqueous phase was transferred to a new RNA tube, supplemented with 4 μL of glycogen (20 mg/mL) and 500 μL of 100% isopropanol, incubated for 10 min at room temperature, and then centrifuged at 12,000 rpm at 4 °C for 15 min. The supernatants of the centrifuged tubes were discarded, and the RNA pellets were washed twice with 500 μL of 75% ethanol, mixed by vortexing, and centrifuged at 7,500 rpm at 4 °C for 10 min. Thereafter, the supernatant was discarded again, and the RNA pellet was dried under vacuum for 20 min and resuspended with 50 μL of DEPC water. RNA concentration and integrity were confirmed by a Nanodrop and Bioanalyzer (Thermo Scientific Inc., USA).

After that, the total RNA was extracted from lung tissue from 50 mg mice using the TRIzol reagent. Then, cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The process of cDNA synthesis is as follows: thaw, mix, and centrifuge the components of the kit, then add the template RNA 1 μg, primer 1 μL, nuclease-free water up to 12 μL, 5× reaction buffer 4 μL, Ribolock RNase inhibitor 1 μL, 10 mM dNTP mix 2 μL, and RevertAid M-MuLV RT 1 μL. After mixing and brief centrifugation, the samples were incubated for 5 min at 25 °C followed by 60 min at 42 °C. Finally, the reaction was terminated by heating at 70 °C for 5 min. The product of the first strand cDNA synthesis can be used directly in real-time quantitative PCR (RT-qPCR).

The RT-qPCR contained 10 μL of SYBR Green from SensiFast (Bioline), 0.4 μL of forward and 0.4 μL of reverse primers, 0.1 μL of Taq polymerase, 1 μL of cDNA, and 8.1 μL of distilled water in a total volume of 20 μL. The reactions were carried out on the QuantStudio 6 (Thermo Fisher Scientific) according to the manufacturer’s protocol. PCR conditions were as follows: denaturation at 95 °C for 2 min with 45 cycles, annealing at 59 °C for target genes including, Vegf (vascular endothelial growth factor), Il1a, and Il10, annealing at 58 °C for Il1b, Il6, and Tnfa and annealing at 56 °C for Ifng, Nfkb1, and Nfkb2, respectively for 30 s. Fluorescence signals from the amplified product were detected at the end of the annealing step. In this study, glyceraldehyde 3-phosphate dehydrogenase (Gapdh), which was used as the housekeeping gene or the reference gene. The expression of the target genes was normalized to Gapdh, and the fold change was calculated as 2^–ΔΔCT method. Specific primer sequences are listed in Table .

1. Primers (Mus musculus) Used for Real-Time Quantitative PCR.

Gene	Primer (5′-3′)	Anneal Temperature (°C)	GenBank accession numbers
Gapdh	F-GTTGTCTCCTGCGACTTCA R-GGTGGTCCAGGGTTTCTTA	53	NM_001411841.1
Ifng	F-ACTGGCAAAAGGATGGTGAC R-TGAGCTCATTGAATGCTTGG	51	K00083.1
Il10	F-CTTACTGACTGGCATGAGGATCA R-GCAGCTCTAGGAGCATGTGG	54	BC137844.1
Il1a	F-CGCCAATGACTCAGAGGAAGA R-AGGGCGTCATTCAGGATGAA	54	NM_010554.4
Il1b	F-GAAATGCCACCTTTTGACAGTG R-TGGATGCTCTCATCAGGACAG	53	NM_008361.4
Il6	F-CTGCAAGAGACTTCCATCCAG R-AGTGGTATAGACAGGTCTGTTGG	54	NM_031168.2
Nfkb1	F-CAAAGACAAAGAGGAAGTGCAA R-GATGGAATGTAATCCCACCGTA	51	AY521463.1
Nfkb2	F-AGCTGATGTGCATCGGCAAGTG R-GTAGCTGCATGGAGACTCGAACAG	57	AF019048.1
Tnfa	F-CAGGCGGTGCCTATGTCTC R-CGATCACCCCGAAGTTCAGTAG	56	NM_001278601.1
Vegf	F-GAGGATGTCCTCACTCGGATG R- GTCGTGTTTCTGGAAGTGAGCAA	55	NM_001287057.1

2.9. Determination of Lung Histopathology

Lung samples were fixed in 4% paraformaldehyde overnight, followed by dehydration through a series of alcohol and xylene treatments. The samples were then embedded in paraffin. Paraffin blocks were sectioned at 5 μm, deparaffinized, and placed on slides for Hematoxylin and Eosin (H&E) and Periodic Acid-Schiff (PAS) staining. Stained sections were examined using a light microscope (BX53, Olympus Corporation, Tokyo, Japan). Lung inflammation and goblet cell hyperplasia were scored on a subjective scale from 0 to 4. , To assess inflammatory cell infiltration in the intraluminal, alveolar, peribronchial, and perivascular regions, cell counts were conducted in a blinded manner using a five-point grading system: 0 (normal), 1 (few cells), 2 (a ring of inflammatory cells one cell layer deep), 3 (a ring of inflammatory cells two to four cells deep), and 4 (a ring of inflammatory cells greater than four cells deep). For quantifying goblet cells in the bronchi and bronchioles, the same five-point grading system was applied: 0 (<0.5% PAS-positive cells), 1 (<25%), 2 (25–50%), 3 (50–75%), and 4 (>75%). Five fields were analyzed for each slide, and the mean score was calculated from four mice. The quantification of PAS-positive goblet cells was expressed as the number of PAS-positive cells per millimeter of basement membrane to account for airway size. Histological scoring was performed by two blinded pathologists from the Pathology Information and Learning Center, Department of Pathobiology, Faculty of Science, Mahidol University, Bangkok, Thailand.

2.10. Statistical Analysis

Data were performed using mean ± standard error of the mean (SEM). Unpaired Student’s t-tests were applied to compare two data sets, while one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test was used to assess group differences. Statistical significance was defined as p < 0.05. All analyses and graphical representations were carried out using GraphPad Prism 10 (GraphPad Software Inc., San Diego, CA, USA).

3. Results

3.1. The Physical Properties of Andrographolide-Loaded Lipid Liposome (AGP-Lip)

The average size, polydispersity index (PdI), and zeta potential of AGP-Lip were approximately 139.70 ± 2.00 nm, 0.16 ± 0.02, and 34.50 ± 0.80 mV, respectively, as determined by DLS. Additionally, the size of Blank-Lip was slightly smaller than that of AGP-Lip, which was approximately 125.4 ± 0.60 nm. The PdI and zeta potentials of Blank-Lip were 0.11 ± 0.01 and 31.50 ± 2.10 mV. AGP-Lip and Blank-Lip had a positive charge due to the presence of DDAB. The PdI values of less than 0.20 indicated homogeneously dispersed nanoparticles. The concentrations of encapsulated AGP in liposomes and %EE were approximately 0.99 ± 0.02 mg/mL and 98.05 ± 0.10%, respectively. The morphology of AGP-Lip was determined by TEM analysis. AGP-Lip performed spherical nanoparticles and bilayers of liposome as shown in Figure A.

1.

Morphological characterization and long-term stability of andrographolide-loaded lipid liposomes (AGP-Lip). (A) The characterization of AGP-Lip was determined by TEM micrographs. The physicochemical properties of AGP-Lip were evaluated over a three-month storage period (the 1st month, T1; the 2nd month, T2; and the 3rd month, T3) in distilled water at 4 , 25, and 40 °C. The assessed parameters included (B) size (Z) average size, (C) polydispersity index (PdI), (D) zeta potential, and (E) loaded andrographolide (AGP) concentration. Data are presented as mean ± SEM. *p < 0.05 compared to the starting period.

The long-term stability of AGP-Lip was evaluated over a 3-month storage period in distilled water at 4, 25, and 40 °C, as shown in Figure B–D. The average size, PdI, and zeta potential of both AGP-Lip and Blank-Lip did not show significant changes at 4 and 25 °C, indicating high stability of the nanoparticles. The size of AGP-Lip slightly increased from 139.7 ± 2.0 to 150.3 ± 2.3 nm after 3 months of storage (Figure B). However, a statistically significant increase in the PdI of AGP-Lip was observed at 40 °C after 2 and 3 months (p < 0.05), indicating reduced colloidal stability at elevated temperatures. The PdI gradually increased from 0.16 ± 0.02 to 0.26 ± 0.01 (Figure C), while the zeta potential of AGP-Lip, initially at 34.5 ± 0.8 mV, slightly decreased to 31.05 ± 1.87 mV at 40 °C but remained relatively stable at 34.58 ± 1.04 and 33.89 ± 0.65 mV at 25 and 4 °C, respectively (Figure D). The observed instability may be partly due to thermally induced disruption of the nanoparticle structure, leading to premature AGP release, as confirmed by a 5% loss of the encapsulated AGP concentration, from 0.99 ± 0.02 to 0.90 ± 0.02 mg/mL after 3 months of storage (Figure E).

3.2. Mucoadhesive Property Investigation of Formulated AGP-Lip

The mucoadhesive properties of AGP-Lip with and without DDAB were investigated by evaluating particle size, zeta potential, and their correlation with mucin concentration. Figure A shows that particle size increases as the liposome-to-mucin volume ratio rises from 0.1:1 to 3.2:1, with AGP-Lip-DDAB displaying larger particle sizes compared to AGP-Lip-noDDAB. This change indicates that DDAB enhances interactions with mucin. Additionally, the zeta potential changes progressively, suggesting the adsorption of liposomes onto mucin particles. The relative zeta potential (Z/Z ₀), which decreases with increasing liposome concentration, confirming electrostatic interactions between liposomes and mucin (Figure B). AGP-Lip-DDAB shows a marked decline in relative zeta potential compared to AGP-Lip-noDDAB, suggesting stronger mucoadhesion due to the presence of DDAB. The observed linear correlation further supports the role of electrostatic interactions in the mucoadhesive behavior of AGP-loaded liposomes. Therefore, these results indicate that incorporating DDAB potentially enhances mucoadhesion, which could improve liposome retention in mucosal environments.

2.

Mucoadhesive determination of andrographolide-loaded liposomes with and without dimethyldioctadecylammonium bromide (AGP-Lip DDAB and AGP-Lip-noDDAB). (A) Particle size and zeta potential were measured at varying liposome-to-mucin volume ratios (0.1:1 to 3.2:1). (B) Linear correlation of the relative zeta potential, defined as the zeta potential at each liposome concentration (Z) relative to the initial zeta potential of mucin particles (Z ₀), for the formulated liposomes. Data are presented as mean ± SEM from three independent replicates.

3.3. In Vitro Cytotoxicity of AGP-Lip in IMR-90 Lung Fibroblasts and Its Effect on the Inhibition of Nitric Oxide (NO) Production in RAW 264.7 Murine Macrophage Cells

To evaluate the toxicity of formulated particles, lung fibroblast, IMR-90, was used and incubated with AGP, AGP-Lip, and Blank-Lip for 24 h. We found that all AGP, AGP-Lip, and Blank-Lip exhibited minimal cytotoxicity, with cell viability exceeding 80% following exposure up to 32 ppm of the tested samples. However, a concentration-dependent decline in cell viability was observed within the range of 62.5 to 250 ppm (Figure A). These findings indicate that AGP-Lip can be classified as noncytotoxic at concentrations of 32 ppm or lower. Noteworthy, at higher tested concentrations (65–250 ppm), AGP-Lip exhibited lower toxicity as compared to AGP extract (Figure A), suggesting that the liposomal formulation could mitigate the toxicity of AGP.

3.

Cytotoxicity in IMR-90 lung fibroblasts and anti-inflammatory effects in the RAW 264.7 murine macrophage cell. (A) Cell viability of blank liposomes (Blank-Lip), andrographolide (AGP), and andrographolide-loaded liposomes (AGP-Lip); and (B) nitric oxide (NO) production. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01 compared to the AGP-treated group.

Additionally, the RAW 264.7 murine macrophage cell line is commonly employed for evaluating anti-inflammatory compounds. In this study, the potential of AGP and AGP-Lip on the NO production in LPS-stimulated macrophages was investigated. The results demonstrated that 25 ppm of both AGP extract and AGP-Lip markedly suppressed nitrite accumulation (p < 0.01) as shown in Figure B. Importantly, AGP-Lip-treated cells exhibited a greater reduction in NO production compared to those treated with AGP alone. These findings indicate that AGP possesses anti-inflammatory properties, which may be further enhanced through its liposomal formulation.

Based on the findings of the in vitro study, AGP-Lip demonstrated no significant cytotoxicity at 32 ppm and effectively reduced inflammation by inhibiting NO production at 25 ppm, as assessed in RAW 264.7 murine macrophage cells. Given the maximum yield preparation of 1 mg/mL, a safe dose of 1 mg/kg was selected for use in the in vivo study.

3.4. Effects of Nasal AGP-Lip Delivery on Physical, Behavioral, and Biochemical Alterations in Male Mice with Acute Systemic Inflammation

Since acute inflammation is commonly induced to model conditions that mimic human inflammatory diseases, the intervention with AGP-Lip seems to be aimed at modulating or alleviating the adverse effects of this condition. Our study found that vehicle-treated mice in the NEG group had significantly lower daily body weight gain (p < 0.05) compared to the control group. However, liposome treatments in both the Blank-Lip (p < 0.05) and AGP-Lip groups (p < 0.01) were able to improve this effect. Therefore, AGP-Lip administration significantly improved the physical health of treated mice compared to untreated or inflammation-only groups (Figure A). This is likely reflected in physiological changes, including behavior, and biochemical profiles, where the treatment reduced the severity of these symptoms.

4.

Potential therapeutic intervention of AGP-Lip in physiological changes in mice induced by acute systemic inflammation via a single intraperitoneal TNF-α injection in male mice. (A) Changes in daily body weight gain, (B) Time spent in the inner zone of the open arena indicated antianxiety levels, (C) Time spent in the outer zone of the open arena indicated anxiety levels, (D) Total line crosses indicated locomotor activity, (E) The number of rearing indicated exploration activity, (F) The number of fecal pellets indicated stress response in the open arena, (G) Total white blood cell count, (H) Serum IL-6 and (I) TNF-α indicated inflammatory response. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the control group; ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 compared to the negative control group; †p < 0.05, ††p < 0.01, †††p < 0.001 compared to the Blank-Lip-treated group; p < 0.001 compared to the AGP-Lip group. CON: control; NEG: negative control; POS: positive control; Lip: liposomes; AGP-Lip: andrographolide-loaded liposomes.

Behaviorally, this study assesses changes in locomotor activity, anxiety-like behavior, and motor activities using the OFT (Figure B). The NEG group exhibited lower anxiolytic levels (p < 0.001) or higher anxiety levels (p < 0.001), as demonstrated by spending less time in the inner zone or more time in the outer zone of the arena. Additionally, this group displayed hyperlocomotor activity (p < 0.05), reduced rearing exploration (p < 0.01), and increased stress responses, as indicated by the number of fecal pellets (p < 0.05) in the unfamiliar environment. Although all treatments significantly alleviated anxiety-like behavior resulting from inflammation, the most prominent effects were observed in the POS group. This group showed improvements in the number of rearing (p < 0.01) and a reduction in defecation (p < 0.05), indicating a decrease in anxiety (Figure D–F). Furthermore, AGP-Lip exhibited greater attenuation of anxiety-like behaviors (time spent in inner and outer zones, p < 0.01) and improved motor function (p < 0.05) compared to Blank-Lip, suggesting that liposome-delivered AGP had a protective or modulatory effect on behavior affected by systemic inflammation (Figure B–D).

At the biochemical level, vehicle-treated mice in the NEG group exhibited a significant increase in total white blood cells (p < 0.001), IL-6 (p < 0.01), and TNF-α (p < 0.001) in serum. All treatments restored white blood cell levels to those of the normal control group (p < 0.001). Interestingly, treatment with AGP-Lip, comparable to POS, significantly reduced white blood cell counts (p < 0.05) as well as the inflammatory cytokine IL-6 (p < 0.001), but not TNF-α, indicating its modulating anti-inflammatory effect, as shown in Figure G–I.

3.5. Effects of Nasal AGP-Lip Delivery on Lung Inflammatory and Angiogenesis Gene Markers and Targeted Gene Expression Alterations in Male Mice with Acute Systemic Inflammation

The RT-qPCR results in Figure show significant alterations in the mRNA expression of inflammatory markers in the lung tissues of mice injected with TNF-α and treated with various experimental interventions. The vehicle-treated mice in the NEG group showed upregulated expression of target genes related to inflammation and vasculogenesis, including Ifng (p < 0.05), Il1a (p < 0.01), Il1b (p < 0.001), Il6 (p < 0.05), Il10 (p < 0.05), Nfkb1 (p < 0.05), Nfkb2 (p < 0.05), Tnfa (p < 0.05), and Vegf (p < 0.05), compared to the control group, confirming a pronounced inflammatory response. Compared to the NEG group, all targeted genes responded well to DEX treatment in the POS group, showing restored gene expression, including Ifng (p < 0.05), Il1a (p < 0.01), Il1b (p < 0.01), Il6 (p < 0.01), Il10 (p < 0.001), Nfkb1 (p < 0.05), Nfkb2 (p < 0.001), Tnfa (p < 0.05), and Vegf (p < 0.01), suggesting that DEX effectively mitigated the inflammatory response and modulated the expression of genes involved in inflammation and angiogenesis. Moreover, AGP-Lip showed a comparable effect to DEX in the POS group by downregulating Ifng (p < 0.001), Il1a (p < 0.001), Il1b (p < 0.01), Il6 (p < 0.05), Il10 (p < 0.05), Nfkb2 (p < 0.05), and Tnfa (p < 0.01). Additionally, AGP-Lip exhibited a greater anti-inflammatory effect than Blank-Lip, as indicated by the significant suppression of Ifng (p < 0.01), Il6 (p < 0.01), Il10 (p < 0.05), Nfkb2 (p < 0.05), and Tnfa (p < 0.05). These results suggest that AGP-Lip effectively reduces inflammation, demonstrating a comparable effect to DEX and a superior anti-inflammatory response compared to Blank-Lip. However, the combination treatment with AGP-Lip + POS was even more effective in suppressing inflammation and angiogenesis, as it further downregulated Ifng (p < 0.05), Il1a (p < 0.01), Nfkb1 (p < 0.01), and Vegf (p < 0.05). These results indicate that the combination treatment with AGP-Lip + POS enhances the suppression of inflammation and angiogenesis more effectively than either treatment alone.

5.

Potential therapeutic intervention of AGP-Lip in lung inflammatory gene expression and targeted gene expression changes in mice induced by acute systemic inflammation via a single intraperitoneal TNF-α injection in male mice. (A) IFN-γ: Interferon gamma, (B) IL-10: Interleukin 10, (C) IL-1A: Interleukin 1α, (D) IL-1β: Interleukin 1 beta, (E) IL-6: Interleukin 6, (F) NF-κB p50: Nuclear factor kappa-light-chain-enhancer of activated B cells p50, (G) NF-κB p65: Nuclear factor kappa-light-chain-enhancer of activated B cells p65, (H) TNF-α: Tumor necrosis factor alpha, and (I) VEGF: Vascular endothelial growth factor. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the control group; ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 compared to the negative control group; †p < 0.05, ††p < 0.01 compared to the Lip-treated group; p < 0.05, p < 0.01 compared to the AGP-Lip + POS-treated group. CON: control; NEG: negative control; POS: positive control; Lip: liposomes; AGP-Lip: andrographolide-loaded liposomes.

3.6. Effects of Nasal AGP-Lip Delivery on Lung Inflammatory Histopathological Alterations in Male Mice with Acute Systemic Inflammation

The histological analysis of lung tissues revealed significant differences in tissue morphology among the experimental groups (Figure ). In the control group, the lung tissue maintained normal alveolar structure, with well-preserved alveolar spaces and no signs of inflammation or tissue damage. This indicates healthy lung morphology without any inflammatory response. In contrast, the lung tissues of mice in the NEG group, which were injected with TNF-α, exhibited pronounced changes in pathological stability (Figure A,B). The lung tissue with high inflammatory scores (p < 0.01) showed considerable thickening of the alveolar walls, along with dense infiltration of inflammatory cells (Figure C). These observations suggest a severe inflammatory response, along with a higher PAS-positive area induced by TNF-α, leading to extensive tissue damage and compromised lung architecture, especially in the NEG (p < 0.001) and Blank-Lip (p < 0.01) groups (Figure D).

6.

Potential therapeutic intervention of AGP-Lip in lung histopathological changes in mice induced by acute systemic inflammation via a single intraperitoneal TNF-α injection in male mice: (A) Histological morphology of lung tissues with H&E staining (bar scale = 100 μm), (B) Histological morphology of lung tissues with PAS staining (bar scale = 40 μm), (C) Calculated histological inflammatory scores, and (D) The percent PAS-positive area indicated mucus production. Data are presented as mean ± SEM (n = 4). **p < 0.01, ***p < 0.001 compared to the control group; ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 compared to the negative control group; †p < 0.05 compared to the Blank-Lip-treated group; p < 0.05, compared to the AGP-Lip-treated group. CON: control; NEG: negative control; POS: positive control; Lip: liposomes; AGP-Lip: andrographolide-loaded liposomes.

Treatment with DEX in the POS group showed marked anti-inflammatory effects (p < 0.05), as well as diminished mucus production (p < 0.01), as shown by the reduced intensity of PAS staining, which typically appears purplish-red in lung tissue. This was further supported by H&E staining, which revealed reduced inflammatory cell infiltration and preserved lung tissue morphology, demonstrating that DEX effectively mitigates TNF-α-induced lung inflammation. Although there were no significant differences in inflammatory scores among the various groups, PAS staining showed that AGP-Lip attenuated mucus production, comparable to the POS group (p < 0.05). Moreover, AGP-Lip had a greater effect than Blank-Lip. Interestingly, the combination treatment with AGP-Lip + POS further enhanced the therapeutic effects, markedly reducing the PAS-positive area compared to both the NEG group (p < 0.001) and AGP-Lip alone (p < 0.05). This suggests that the combined treatment led to a more profound suppression of inflammation and mucus production, potentially through synergistic effects between AGP-Lip and DEX, resulting in an improved lung tissue morphology (Figure D).

4. Discussions

Inflammatory lung injury, including ALI and ARDS, is driven by excessive cytokine expression, leading to severe outcomes in viral infections, e.g., coronavirus disease 2019, severe acute respiratory syndrome, and influenza. − While anti-inflammatory agents are widely used, side effects and delayed responses highlight the need for safer, more effective treatments. − AGP, an anti-inflammatory herbal medicine, reduces cytokines in ALI models. , However, poor solubility limits the efficacy. Lipid-based nanoparticles, particularly liposomes, enhance the bioavailability and targeted delivery of AGP. To enhance the pharmacological-like action of AGP, this study developed and evaluated microfluidic-derived AGP-Lip in a TNF-α-induced lung injury model, aiming to attenuate inflammation.

Based on our findings, the physicochemical characteristics of AGP-Lip were analyzed using TEM and DLS to assess morphology, size, stability, and encapsulation efficiency. A spherical shape with a bilayer structure was confirmed through TEM imaging (Figure A), which is essential for encapsulating hydrophobic AGP, ensuring controlled release and protection from degradation, and suggesting its potential as an effective drug delivery system for lung inflammation treatment in both in vitro and in vivo experimental studies.

The physicochemical properties of AGP-Lip were characterized by TEM and DLS. TEM showed spherical bilayer structures suitable for hydrophobic AGP encapsulation (Figure A). DLS analysis revealed an average size of 139.7 ± 2.0 nm, which falls within the optimal nanoparticle size range (1–150 nm) for efficient drug delivery, enhancing cellular uptake and enabling nasal penetration, particularly toward inflamed tissues. − The PdI of 0.16 ± 0.02 indicates a narrow size distribution, ensuring consistency in drug delivery. The zeta potential of AGP-Lip was 34.5 ± 0.8 mV, indicating a positive surface charge that enhances stability by preventing aggregation through electrostatic repulsion. , In comparison, Blank-Lip had slightly smaller particles (125.4 ± 0.6 nm) and a lower PdI (0.11 ± 0.01), suggesting better size uniformity. Both formulations displayed positive charges due to DDAB, with PdI values below 0.20, indicating well-dispersed particles with minimal aggregation. AGP-Lip exhibited a high EE of 98.05 ± 0.10%, with a concentration of 0.99 ± 0.02 mg/mL of encapsulated AGP, ensuring effective loading of the active ingredient for therapeutic efficacy. ,

As shown in Figure B–E, the stability of AGP-Lip was assessed over 3 months at 4, 25, and 40 °C, which is critical for long-term storage and transportation. − At 4 and 25 °C, the size, PdI, and zeta potential of both AGP-Lip and Blank-Lip remained stable, indicating the liposomal formulation maintained integrity under standard storage conditions. At 40 °C, the AGP-Lip size increased from 139.7 ± 2.0to 150.3 ± 2.3 nm, and the PdI significantly rose from 0.16 ± 0.02 to 0.26 ± 0.01, indicating mild aggregation and instability. Additionally, a 5% decrease in encapsulated AGP concentration was observed after 3 months at 40 °C, suggesting AGP leakage due to compromised liposome integrity. Despite this, AGP-Lip demonstrated high encapsulation efficiency (98.05 ± 0.10%) and stability, supporting its potential for treating inflammatory conditions.

The mucoadhesive properties of AGP-Lip were assessed by analyzing the particle size and zeta potential in relation to mucin concentration. As the liposome-to-mucin ratio increased from 0.1:1 to 3.2:1, particle size also increased, with AGP-Lip containing DDAB exhibiting sizes larger than those without DDAB. This suggests that DDAB enhances interactions with mucin, leading to aggregation. Additionally, the zeta potential decreased progressively with higher mucin concentrations, indicating the adsorption of liposomes onto mucin particles. AGP-Lip with DDAB showed a more pronounced decline in relative zeta potential compared to those without DDAB, suggesting stronger mucoadhesion (Figure A,B). These findings align with previous studies, demonstrating that cationic modifications enhance mucoadhesive interactions through electrostatic attraction. Therefore, incorporating DDAB into AGP-Lip imparts a positive surface charge, promoting electrostatic interactions with the negatively charged mucin. This enhancement could improve liposome retention in mucosal environments, potentially leading to more effective drug delivery. ,,

The results from the cytotoxicity assessments of AGP, AGP-Lip, and Blank-Lip in lung fibroblast IMR-90 cells showed minimal cytotoxicity at concentrations up to 32 ppm with cell viability above 80% (Figure A). A concentration-dependent decrease in cell viability was noted from 62.5 to 250 ppm, with AGP-Lip demonstrating lower toxicity than AGP extract at higher concentrations (65–250 ppm). ,, This suggests that AGP-Lip could reduce AGP toxicity while maintaining its therapeutic potential (Figure A). Furthermore, the anti-inflammatory effects of AGP and AGP-Lip were assessed in the RAW 264.7 murine macrophage cell line, a model for evaluating anti-inflammatory agents. , Since AGP alone undergoes rapid metabolism, leading to fluctuating tissue levels, liposomal delivery is preferred, as it enhances cellular uptake and stability, thereby reducing ROS and NO overproduction and subsequent inflammation. Accordingly, both formulations suppressed nitrite accumulation in LPS-stimulated macrophages starting at 12.5 ppm, with a marked effect at 25 ppm (Figure B). Notably, AGP-Lip produced a greater reduction in NO levels compared to AGP alone, consistent with previous studies on liposomal AGP. , These results highlight that liposomal AGP not only maintains but could also enhance its anti-inflammatory potency.

Based on in vitro toxicity findings, where AGP formulations at 62.5 and 12.5 ppm effectively reduced nitric oxide production without cytotoxic effects (Figure ), a dose of 1 mg/kg was selected for in vivo studies. When administered intranasally, it enhances drug delivery to specific brain regions through nanoemulsion-based transport. Subsequent animal experiments were conducted to validate the therapeutic potential of AGP-Lip in an inflammatory disease model with elevated total white blood cells, circulating TNF-α, and IL-6. Nasal AGP-Lip delivery alleviated physical, behavioral, and biochemical symptoms of acute systemic inflammation, likely due to its anti-inflammatory properties.

Mice injected with TNF-α to induce acute systemic inflammation exhibited reduced body weight, potential hyperthermia, and increased total white blood cell recruitment. TNF-α mediates these effects through its interaction with the central nervous system, promoting fever via prostaglandin-dependent pathways and potentially elevates the hypothalamic temperature set point, ultimately leading to fever. Elevated levels of pro-inflammatory cytokines, such as IL-6 and TNF-α, along with increased neutrophil and leukocyte counts, were reported in TNF-α-injected mice, which are key mediators of fever and weight loss. , However, AGP-Lip administration was able to reverse these effects, as displayed by the recovery of the body weight (Figure A). This improvement could be attributed to reduced inflammation and relief from TNF-α-induced hyperthermia associated with infection, supporting the notion that AGP-Lip effectively mitigates the physiological consequences of acute systemic inflammation. Furthermore, AGP, the AGP in liposome, is known for its potent anti-inflammatory properties, particularly its ability to regulate TNF-α and IL-6 production. By reducing pro-inflammatory cytokines and total white blood cell counts, AGP-Lip may help alleviate inflammation and promote recovery (Figure G–I).

In addition, AGP-Lip-treated mice also showed improvements in sickness-related locomotor activity, including reduced anxiety-like behavior and enhanced motor coordination. These observations suggest that AGP-Lip may offer neuroprotective or anxiolytic effects. The OFT, a widely utilized test for evaluating the impact of systemic inflammation on the central nervous system, is instrumental in assessing treatments for anxiety and motor impairments. , Inflammation models often lead to increased anxiety-like behavior and motor dysfunction (Figure B–F), which are linked to neuroinflammation and the disruption of normal brain function. Therefore, AGP-in nanoparticle’s ability to alleviate these symptoms led to a reduction in sickness- and stress-related behaviors during inflammation induction. This effect may be linked to the modulation of neuroinflammatory pathways through the suppression of key cytokines (e.g., IL-1β, and TNF-α) and regulation of oxidative stress, potentially mediated via the Nrf2/HO-1 signaling pathway. , On a biochemical level, AGP-Lip reduces the levels of pro-inflammatory cytokines (TNF-α, IL-6, IFN-γ, IL-23, and IL-17A) and oxidative stress markers (malondialdehyde, catalase, glutathione, superoxide dismutase, and nitrite/nitrate), suggesting a protective role against multiorgan injury. ,

In particular, the therapeutic potential of AGP or AGP-Lip was reported in acute inflammatory lung injury induced by TNF-α, LPS, or Mycoplasma pneumoniae infection. ,,, The RT-qPCR analysis revealed significant insights into the molecular mechanisms underlying the AGP-Lip anti-inflammatory effects in a mouse model of acute systemic inflammation (Figure ). AGP-Lip notably modulated the NF-κB pathway, a critical regulator of inflammation, as indicated by reduced mRNA expression of the Nfkb1 and Nfkb2 subunits, , which are central to inflammatory responses. This suppression suggests that AGP-Lip exerts its anti-inflammatory effects by inhibiting Nfkb activation, thereby reducing the transcription of pro-inflammatory cytokines. These findings support AGP’s ability to inhibit NF-κB signaling and prevent the upregulation of inflammatory mediators. ,

Moreover, the mechanisms of action in modulating key inflammatory pathways can be attributed to the observed anti-inflammatory effects of AGP-Lip and its combination with DEX. AGP-Lip likely exerts its effects by inhibiting NF-κB signaling, a central regulator of inflammation, which is supported by the significant downregulation of Nfkb1 and Nfkb2. The reduction in TNF-α expression suggests a suppression of pro-inflammatory cytokine cascades that contribute to systemic inflammation. Furthermore, AGP-Lip may exert immunomodulatory effects through the downregulation of Ifng and Il1a, which are known to amplify immune responses and enhance cytokine release.

The additional suppression of Vegf mRNA expression in the AGP-Lip + POS group suggests that AGP-Lip inhibits pathological angiogenesis, likely by reducing inflammation-driven angiogenic signaling. , This is consistent with previous studies showing that chronic inflammation promotes VEGF-mediated vascular remodeling. AGP-Lip modulates angiogenesis similarly to AGP or DEX in tumor-bearing nude mice with Hep3B xenografts and primary human myoblasts. , In chronic inflammation, excessive angiogenesis can exacerbate tissue damage, and the inhibition of Vegf expression may help mitigate this effect, as observed in lung tissue remodeling. The ability of AGP-Lip to reduce Vegf expression suggests its potential to prevent excessive angiogenesis in inflammatory diseases. These findings indicate that AGP-Lip is a potent anti-inflammatory agent likely through NF-κB inhibition and cytokine modulation. Moreover, its combination with DEX further enhances its therapeutic potential by suppressing inflammation-induced angiogenesis.

Histological analysis of lung tissues revealed significant differences across the experimental groups (Figure ). The control group exhibited a normal alveolar structure, while the TNF-α-injected vehicle group showed thickened alveolar walls and inflammatory cell infiltration, indicating severe inflammation and tissue damage. Treatment with AGP-Lip reduced alveolar wall thickening and inflammatory cell infiltration, while better preserving alveolar architecture, resulting in lower pathological scores as assessed by H&E staining (Figure A). These findings suggest a strong anti-inflammatory effect, comparable to that of AGP sulfonate, a sulfonated derivative of andrographolide. The positive control, DEX, showed similar results, reducing inflammatory cell infiltration and preserving lung morphology, confirming its effectiveness. ,

Quantitative analysis supported these findings, showing a significantly higher PAS-positive area in the lungs of the vehicle group, and lower levels in the AGP-Lip and DEX groups, consistent with previous studies on lung inflammation, such as those involving inhalational burns and asthma. , This indicates the potential of AGP-Lip to alleviate TNF-α-induced mucus retention and preserve lung tissue structure. This suggests that the combined treatment led to a more profound suppression of inflammation and mucus production, potentially through synergistic effects between AGP-Lip and DEX, resulting in an improved lung tissue morphology (Figure B–D).

The reduction in inflammatory cells (e.g., neutrophils, macrophages) in the AGP-Lip group supports AGP’s anti-inflammatory effects, , likely due to suppression of immune signaling pathways (i.e., NF-κB and MAPKs) critical for immune cell recruitment. ,,,, In this study, AGP-Lips administered via nasal delivery demonstrated enhanced bioavailability and stability, improving targeting of immune cells involved in inflammationsimilar to the effects observed with pulmonary delivery of liposomal AGP dry powder inhalers in Staphylococcus aureus-induced pneumonia in male rats. Moreover, AGP’s antioxidant properties also contribute to tissue preservation by neutralizing reactive oxygen species and preventing cellular damage. ,,

Intranasal administration of liposomal formulations has demonstrated superior therapeutic outcomes in models of respiratory inflammation. Consistent with these findings, our study showed that intranasal delivery of AGP-Lip, compared to liposomal DEX, significantly reduced mortality during disease progression and markedly suppressed pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6. Similarly, parenteral administration of liposomal angiotensin-(1–7) has been shown to reduce viral load and improve survival in infected models. Together, these findings suggest that AGP liposomal nanoformulations, particularly when administered intranasally, have potential as effective therapeutic strategies for the management of inflammatory lung diseases.

Based on these findings, intranasal delivery of AGP-Lip demonstrates strong potential to exert therapeutic effects comparable to classical treatments by reducing pulmonary viral burden and suppressing inflammatory mediators, likely through targeted action within immune-responsive lung tissue. This positions AGP-Lip as a promising alternative for managing cytokine storms and inflammation associated with respiratory diseases. By inhibiting pro-inflammatory cytokines, decreasing immune cell infiltration, and preserving lung architecture, AGP-Lip offers a novel strategy for the treatment of inflammatory lung conditions, as summarized in Figure .

7.

Summary of study findings (created with BioRender and organized by Sarawut Lapmanee). Andrographolide-loaded liposomes (AGP-Lip) were developed and evaluated for physicochemical characterization, stability, and mucoadhesive properties. Cytotoxicity, nitric oxide production, and anti-inflammatory effects were examined in lung and macrophage cell cultures before conducting the animal study. Male C57BL/6 mice were induced with systemic inflammation by TNF-α intraperitoneal injection and treated with AGP-Lip for 7 days. Nasal AGP-Lip delivery improved sickness-like symptoms, alleviated inflammation, and partially regulated angiogenesis-related gene expression, leading to improved histomorphological architecture. These findings suggest that nasal AGP-Lip administration has therapeutic potential for treating inflammatory lung diseases by targeting inflammation and promoting tissue repair.

Future studies should investigate the underlying mechanisms of AGP-Lip’s anti-inflammatory activity with particular emphasis on its role in chronic inflammatory conditions. Moreover, comprehensive evaluations of its long-term efficacy and safety in both animal models and clinical settings are essential to validate its therapeutic potential for the treatment of human inflammatory diseases.

5. Conclusions

In conclusion, the AGP-Lip formulation demonstrated favorable physical properties, including small particle size, narrow size distribution (i.e., PdI), and positive surface chargekey attributes for effective drug delivery. Its high encapsulation efficiency further supports its therapeutic potential. While AGP-Lip exhibited excellent stability at lower temperatures, slight aggregation and loss of encapsulated AGP occurred at higher storage temperatures, indicating that cooler conditions are preferable for maintaining formulation integrity and efficacy. Additionally, DDAB enhanced AGP-liposome mucoadhesion by increasing the surface charge, promoting stronger binding to negatively charged mucin, as indicated by an increased particle size, reduced zeta potential, and mucin concentration-dependent interactions. The formulation also demonstrated good biocompatibility, showing no cytotoxicity to IMR-90 cells, and significantly reduced nitrite production in LPS-stimulated RAW 264.7 macrophages, indicating potent anti-inflammatory activity.

Overall, nasal delivery of AGP-Lip shows promising potential in alleviating physical, behavioral, and biochemical alterations induced by acute systemic inflammation in male mice. The observed reduction in physical symptoms, behavioral improvements, and biochemical markers of inflammation emphasizes its therapeutic promise for treating inflammation-driven diseases. Gene expression analysis of inflammation and angiogenesis and histological findings further support strong anti-inflammatory effects of AGP-Lip, positioning it as a promising candidate for the treatment of lung inflammation. Additionally, its dual actions in suppressing pro-inflammatory cytokines and enhancing neuroprotective effects suggest that AGP-Lip could be a valuable therapeutic agent for conditions characterized by systemic inflammation and neuroinflammatory changes, such as ALI, sepsis, and other inflammatory disorders.

Data sets and analyses from this study can be provided from the corresponding author upon reasonable request. All data in this study are presented in the manuscript.

S.L. and M.K. conceived the research and designed the experiments. N.R., K.N., P.B., R.S., N.B., C.P., P.W., C.S., P.W., M.K. conducted the investigation and performed data analysis. S.L., K.N., and M.K. provided resources and acquired funding. S.L., K.N., C.S., P.W., and M.K. visualized the data and drafted the manuscript. All authors participated in editing the manuscript.

The experimental procedures received approval from the Institutional Animal Care and Use Committee at Thammasat University, Pathum Thani, Thailand (approval number 21-2021, renewed in 2024). The study adhered to the ARRIVE guidelines (https://arriveguidelines.org).

The authors declare no competing financial interest.