Synergistic role of miRNA-1811 and miRNA-302 in enhancing direct reprogramming efficiency of chicken embryo fibroblasts to induced pluripotent stem cells

Abstract

The generation of induced pluripotent stem cells (iPSCs) from somatic cells holds immense promise for regenerative medicine and disease modeling. However, the reprogramming efficiency in avian species, such as chickens, has been notably lower than in mammalian models. This study investigates the potential of microRNAs (miRNAs) to enhance the reprogramming of chicken embryo fibroblasts (CEFs) into iPSCs. We report the identification and utilization of gga-miRNA-302s and the novel gga-miRNA-1811, which were found to be co-expressed during early chicken embryonic development. The combination of these miRNAs with key pluripotency genes significantly improved the reprogramming efficiency of CEFs into iPSCs, resulting in cells with robust pluripotency markers and differentiation potential. Our findings demonstrate that co-expression of gga-miRNA-1811 and gga-miRNA-302s plays a critical role in promoting the mesenchymal-to-epithelial transition, a crucial step in the reprogramming process. These results not only advance the field of avian iPSC generation but also offer a valuable strategy for improving reprogramming efficiency across species, with implications for stem cell research and translational medicine.

Introduction

iPSCs, or induced pluripotent stem cells, are a class of cells that acquire properties similar to embryonic stem cells through the reprogramming of somatic cells by specific transcription factors such as Oct3/4, Sox2, c-Myc, and Klf4 (Lakshmipathy et al., 2010; Chen et al., 2019). These cells can self-renew indefinitely in vitro and have the capacity to differentiate into various cell types (Ohnuki and Takahashi, 2015). In 2006, Professor Shinya Yamanaka's team at Kyoto University first succeeded in converting mouse fibroblasts into iPSCs, marking a landmark achievement in the field (Takahashi and Yamanaka, 2006).

In 2012, Lu et al. reported the first successful reprogramming of avian somatic cells, using pluripotency genes from humans (Oct4, Nanog, Sox2, Lin28, c-MYC, and Klf4) to reprogram quail embryonic fibroblasts (Lu et al., 2012). Subsequently, Lu et al. successfully obtained chicken iPSCs for the first time through the same system, and further obtained induced primordial germ cells, thereby confirming the conservation of cell reprogramming mechanisms between mammals and non-mammalian species (Lu et al., 2014). In 2018, Fuet et al. used chicken-derived pluripotency genes (Oct4, Nanog, Sox2, Lin28, Sox3, c-MYC, and Klf4) to reprogram chicken embryo fibroblasts (CEFs). Their research findings confirmed that Nanog is an essential factor for maintaining proliferating chicken iPSCs (Fuet et al., 2018; Lee et al., 2023). In 2022, Ding et al. reported a simplified method for reprogramming chicken iPSCs. They successfully achieved effective reprogramming of CEFs using only four chicken-derived pluripotency genes (Oct4, Nanog, Sox2, and Lin28A) (Ding et al., 2022). Despite these advances, the low efficiency and instability of chicken iPSC reprogramming remain challenges.

The reprogramming process is finely tuned by various factors, with miRNAs playing a central role (Lakshmipathy et al., 2010; Chen et al., 2019). miRNAs, a class of small non-coding RNAs, bind to the 3′ untranslated regions (UTRs) of target messenger RNAs (mRNAs) to regulate gene expression post-transcriptionally, leading to mRNA degradation or translation inhibition (Pietrykowska et al., 2022; Diener et al., 2024). The miR-302 cluster, for instance, can reprogram human skin cancer cells into a pluripotent state, with DNMT1 identified as a direct target of miR-302a-d, indicating its role in inducing global demethylation and genomic stability (Lin et al., 2008). Overexpression of the miR-290 family or the miR-302 family has been shown to enhance iPSC reprogramming efficiency(Ye et al., 2024). Human miR-372, a homolog of the mouse miR-290 cluster and miR-302 cluster, as well as the miR-17-92 cluster, miR-106b-25 cluster, and miR-106a-363 cluster, all of which share similar seed sequences with miR-302, have also been shown to improve reprogramming (Subramanyam et al., 2011). The expression of the core seed region of miR-302/367 via lentiviral vectors can lead to the reprogramming of approximately 10 % of fibroblasts into iPSCs within 12 to 14 days, a finding that has been widely applied in the reprogramming of cells from species such as pigs, goats, and sheep, providing valuable strategies for stem cell research and translational medicine(Sugawara et al., 2022). The miR-302 family, with its high conservation and specificity in embryonic stem cells and low expression in differentiated cells, is particularly promising for reprogramming applications due to its lack of tumorigenicity(Lin et al., 2020; Sugawara et al., 2020).

Building on preliminary transcriptomic and miRNA profiling that established a transcription factor-miRNA co-expression network during early avian embryonic development (Liao et al., 2022, 2023). Integrated analysis identified the avian-specific gga-miR-1811-a previously uncharacterized Gallus gallus miRNA (Griffiths-Jones et al., 2006; Glazov et al., 2008)-as a novel reprogramming factor with potential to enhance iPSC generation. Supporting this, gga-miR-1811 overexpression in CEF cells significantly upregulated Oct4 mRNA levels. To validate the reprogramming function of gga-miR-1811, CEFs were reprogrammed using gga-miR-302s combined with gga-miR-1811. Control groups employed gga-miR-302s alone or conventional 4-factor (4F) reprogramming. Alkaline phosphatase (AP) staining and colony morphology analysis were performed to assess iPSC colony formation. Western blot analysis evaluated expression of core pluripotency markers (OCT4, SOX2, NANOG) across iPSC groups. Additionally, dissociated iPSCs were cultured in ultra-low attachment plates to examine aggregate formation, with cell viability monitored via trypan blue exclusion and proliferation rates quantified after 6 days. These findings advance understanding of avian cellular reprogramming mechanisms, establishing a scientific foundation for applying iPSC technology to conserve and breed indigenous poultry breeds.

Material and methods

Cultivation and isolation of CEFs

The induction cells used in this study were CEFs, all isolated within a negative-pressure cell culture hood. SPF chicken embryos (Guangdong Wens Dahuanong Biotechnology Co., Ltd) at 9-11 days incubation were surface-disinfected with 70 % ethanol and stabilized before aseptically opening the air chamber. The chorioallantoic membrane was grasped to extract embryos, after which heads, limbs, and viscera were excised. Following PBS rinsing of remaining tissues, two parallel primary culture protocols were implemented: For the explant attachment method, deboned muscle tissue was minced into 1-mm³ fragments, plated in 24-well plates with serum supplementation to enhance adhesion, fixed with 4 % paraformaldehyde for 30 min, then slowly supplemented along the well wall with high-glucose DMEM (Gibco, 11966025) containing 10 % FBS (Gibco, A5256701) until cell migration occurred for passaging. Alternatively, the enzymatic digestion protocol involved transferring tissue fragments to centrifuge tubes, digesting with 0.25 % trypsin (Gibco, 25200072) at 37 °C for 15 min, quenching digestion with 10 % FBS-DMEM, sequentially filtering through 100-μm mesh and 70-μm cell strainers, centrifuging filtrate at 1200 g for 5 min, resuspending pellets in DMEM, and seeding at 1 × 10⁷ cells/mL in 175-cm² flasks with 25 mL of 10 % FBS-DMEM. All cultures were maintained at 37 °C/5 % CO₂, with passaging initiated at 80 % confluence via spent medium removal, PBS washing, 3-minute 0.25 % trypsin digestion, termination with equal-volume serum-complete medium, centrifugation, resuspension, and subculture. CEFs within passage 7 (P7) were recommended for iPSC induction, with P2–P3 cells demonstrating optimal viability.

Construction of lentiviral vectors

Total RNA was extracted from 8-day-old chicken embryos using the TRIzol method. RNA concentration was quantified with a nucleic acid/protein analyzer. cDNA synthesis was performed using the TaKaRa PrimeScript™ RT reagent kit (two-step protocol) according to the manufacturer's instructions. Primers containing pCDH-CMV homology arms were designed for Oct4, Sox2, Nanog, and Lin28A genes, with the pCDH-CMV plasmid serving as the template. PCR amplification of target genes was conducted using their respective templates and primers (Table 1). Synthesized miRNA precursors (gga-miR-302s, gga-miR-1811) (Table 2) included terminal pCDH-CMV homology arms.PCR reaction mixtures were vortex-mixed, centrifuged, and subjected to thermal cycling under the following conditions: 98 °C for 30 s (initial denaturation); 35 cycles of 98 °C for 10 s, 55 °C for 5 s/kb, and 72 °C for 30 s; final extension at 72 °C for 1 min; hold at 4 °C.Amplified products were separated by 1.5 % agarose gel electrophoresis. Target bands of expected sizes were excised under UV illumination, purified using the EZNA Gel Extraction Kit, and quantified via microvolume spectrophotometry. Purified DNA fragments and miRNA precursors were ligated into the pCDH-CMV vector via Takara In-Fusion HD Cloning, generating the following recombinant constructs: pCDH-Oct4, pCDH-Nanog, pCDH-Lin28A, pCDH-Sox2, pCDH-miR-302s, pCDH-miR-1811. All constructs were verified by Sanger sequencing (Sangon Biotech, Shanghai).

Table 1.

Primer sequences for PCR.

Genes	Squence	Gene accession numbers	Product sizes (bp)
pCDH-CMV	F: GGATCCGCGGCCGCAAGGATCTGCGATCGCTCCGGT	none	8176
	R: GGTGGCTAGCTCTAGAATCTTCTATGGAGGTCAAAACAG
Oct-4 (Pou5f3)	F: CTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCCACC ATGTTCAGCCCGGACGGGGG	NM_001309372.2	1170
	R: GGCACCGGAGCGATCGCAGATCCTTGCGGCCGCGGAT CTCAGTGGCTGCTGTTGTTCA
Sox2	F: CTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCCACC ATGTACAACATGATGGAAAC	NM_205188.3	960
	R: GGCACCGGAGCGATCGCAGATCCTTGCGGCCGCGGATCC TTACATATGTGATAGAGGGA
Nanog	F: CTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCCACC ATGAGCGCTCACCTGGCCAT	NM_001146142.2	930
	R: GGCACCGGAGCGATCGCAGATCCTTGCGGCCGCGGATCC CTAAGTCTCATAACCATTCT
Lin28A	F: CTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGCCACC ATGGGGTCTGTTTCCAACCA	NM_001031774.2	609
	R: GGCACCGGAGCGATCGCAGATCCTTGCGGCCGCGGATCC TCACACGTACCACTCGTTAA

Table 2.

Pre-miRNA sequences.

Genes	Sequence
miRNA-302a sense	5’-GATATCTCGAGTCACGCGTTCCACAACTTAAATGTGGATGTGCTTGCTTTGTTCTGAAAAGAAAGTGCTTCCATGTTTTAGTGATGGATAGATCTCT C-3’
miRNA-302b sense	5’-CCCTTTTACTTTAACATGGAGGTGCTTTCTGTGATTTTACAAAAGTAAGTGCTTCCATGTTTTAGTAGAGGT-3’
miRNA-302c sense	5’-CCTCCGCTTTAACATGGAGGTACCTGCTGCCTACAAAAGTAAGTGCTTCCATGTTTCAGTGGTGG-3’
miRNA-302d sense	5’-CCTCAACTTTAACATGGAGGTACTTGCTGGACACCTGAAAAAGTAAGTGCTTCCATGTTTTAGTTGTGG-3’
miRNA-1811 sense	5’-GCTGACATGGTTTATTGCAGCGCTGGGTGCATGGAGATCTTCACTTAGCGTGCACCCAGCGCTGAAATAACCAATGTTGGC-3’

Lentiviral production

293T cells (ATCC® CRL-3216™) were cultured in DMEM supplemented with 10 % FBS at 37 °C/5 % CO₂. For transfection, cells at 80 % confluency were seeded in 10-cm dishes.The following plasmids were co-transfected using Lipofectamine™ 3000 (Invitrogen, L3000015) according to the manufacturer’s protocol:

14 μg recombinant transfer vector

10 μg pLP1 (packaging plasmid)

10 μg pLP2 (packaging plasmid)

6 μg pVSV-G (envelope plasmid)

At 10 h post-transfection, the medium was replaced with 8 mL fresh DMEM/10 % FBS. Viral supernatants were harvested at 48 h and 72 h, pooled, and centrifuged (4 °C, 2000 × g, 5 min) to remove cellular debris. The clarified supernatant was filtered through a 0.45-μm PVDF membrane and concentrated using Amicon® Ultra-15 100 kDa centrifugal filters (Millipore, UFC910024) at 4 °C (2500 × g, 25 min). Concentrated virus (∼350 μL) was aliquoted and stored at -80 °C.

LentiViral titer determination

293T cells were plated in 96-well plates (3 × 10⁴ cells/well) and cultured for 24 h. Serial 10-fold dilutions of concentrated virus were prepared in serum-free DMEM containing 8 μg/mL polybrene (Sigma, TR-1003-G). After removing culture medium, 100 μL of diluted virus was added to triplicate wells. At 24 h post-infection, the medium was replaced with DMEM/2 % FBS. After 72 h, enhanced green fluorescent protein (EGFP) expression was quantified under an inverted fluorescence microscope (Olympus IX73, 20×objective). The titer (transducing units/mL, TU/mL) was calculated using the formula:

Titer (TU/mL) = (Number of fluorescent cells × Dilution factor × 10⁴) / Virus volume (mL)

iPSC reprogramming

CEF cells at passages 3–5 exhibiting normal morphology were seeded into 12-well plates at 5 × 10⁴ cells/well in DMEM supplemented with 10 % FBS (Gibco, 10270106). Concentrated lentiviral stocks were thawed on ice and mixed with culture medium containing 6 μg/mL polybrene (Sigma-Aldrich, TR-1003) for transduction (24 h, 37 °C/5 % CO₂). Post-infection media was replaced with fresh DMEM/10 % FBS and renewed daily. At 72-96 h, viable cells were passaged onto Matrigel®-coated dishes (Corning, 354230; 1:100 dilution) and transitioned to avian-specific reprogramming medium: KnockOut™ DMEM/F12 (Gibco, 12660012) with 15 % KSR (Gibco, 10828028), 1 % NEAA (Gibco, 11140050), 1 mM L-glutamine (Gibco, 25030081), 0.1 mM β-mercaptoethanol (Sigma, M3148), 10 ng/mL chicken bFGF (R&D Systems, 3218-FB-025), and 1× penicillin/streptomycin (Gibco, 15140122). Media was refreshed every 48 h until emergence of compact, clone-like colonies (typically 21-28 days).

Alkaline phosphatase staining

Preliminary identification of iPSCs was performed using the Alkaline Phosphatase Detection Kit (Beyotime Biotechnology, C3206) according to the manufacturer’s protocol. Briefly, cells were removed from the incubator, and the culture medium was aspirated. After washing with PBS (5 min per wash, repeated three times), cells were fixed with 4 % paraformaldehyde (PFA) for 15 min at room temperature. The PFA was then removed, followed by three additional PBS washes (5 min each). A BCIP/NBT working solution was prepared as instructed. After the final wash, PBS was completely removed, and 500 μL of BCIP/NBT working solution was added to ensure full coverage of the well surface. Cells were incubated with the staining solution for 30 min at room temperature in the dark. The reaction was terminated by aspirating the BCIP/NBT solution and rinsing twice with distilled water.

Immunofluorescence staining

iPSCs cultured in 24-well plates at 70 % confluency were fixed with 4 % PFA (500 μL/well, 30 min) after PBS washing (3 × 5 min), permeabilized with 0.5 % Triton X-100 (300 μL/well, 10 min), and blocked with 1 % BSA (500 μL/well, 30 min). Primary antibodies against OCT4 (Abcam ab19857, 1:300), SOX2 (CST 3579S, 1:300), NANOG (Proteintech 14295-1-AP, 1:300), SSEA1 (Santa Cruz sc-21702, 1:300), and TRA-1-81 (Millipore MAB4381, 1:300) diluted in Beyotime antibody buffer (P0203) were applied overnight at 4 °C (negative controls: PBS only). After PBST washes, Alexa Fluor®-conjugated secondary antibodies (Invitrogen, 1:500) were incubated for 1 h (dark), followed by DAPI nuclear staining (0.1 μg/mL, 10 min). Samples were mounted with ProLong™ Diamond Antifade Mountant (Invitrogen P36970) and imaged using a Leica TCS SP8 confocal microscope with appropriate emission filters.

Quantitative PCR analysis

Total RNA was extracted from iPSCs using TRIzol® reagent (Invitrogen), quantified via NanoDrop™ 2000 (Thermo Scientific), and reverse-transcribed into cDNA with the PrimeScript™ RT Kit (TaKaRa, RR037A). qPCR was performed in triplicate using TB Green® Premix Ex Taq™ (TaKaRa, RR420A) on a QuantStudio™ 5 system under optimized cycling: 95 °C for 5 min (initial denaturation); 35 cycles of 95 °C for 10 sec and 60 °C for 30 sec; followed by melt curve analysis (95 °C→60 °C→95 °C, 15 sec/step). Primer sequences for real time-qPCR are provided in Table 3.

Table 3.

Primer sequences for Real Time-qPCR.

Genes		Sequence(5’-3’)	Gene accession numbers	Product sizes (bp)	Amplification efficiency
Endo-Oct4(Pou5f3)	F	CGGGATCTCCATGAACAACAG	NM_001309372.2	185	98 %
	R	CTGGCCCCAGGCAGGTAA
Endo-Sox2	F	CCCCAAGCAGACTTCATA	NM_205188.3	197	101 %
	R	AAAAGGTCCAGAATTTCTAATA
Endo-Nanog	F	GTATGCAACCAGCTCACC	NM_001146142.2	105	103 %
	R	TAGTAGTGTCCGCACCTAAC
Endo-Lin28A	F	AAAGCCAATGCCAAGTGA	NM_001031774.2	65	101 %
	R	CAAACAAACCCAAAGATACG
Gata4	F	CCACTTGGACTTCTTCGCCCTTC	NM_001293106.2	134	97 %
	R	ACAGTTGACACATTCTCGCCCTTC
Gata6	F	AGAGAGCACCAGTCCCGAAAGC	NM_205420.2	121	102 %
	R	ACACCAGTGATCCTGCCTGACG
Pax6	F	CCCCGTTTCCTCTTTCAC	NM_205066.2	246	101 %
	R	ATGGGCTGGCTATTCATG
Ecamp	F	CGTGTCCGTCAACTGCGAGATC	NM_001012564.2	75	99 %
	R	CCCGATTTCGTGTTTGCCATTTCAG
N-Cadherin F	F	CATCCTCCTCAGTCAACAGCAACC	NM_001001615.2	145	100 %
	R	GGTCCCGAGCAGTGAAAGTTGTC
E-Cadherin	F	AGGAGGTCTTCGTCGGCTACATC	NM_001039258.3	100	104 %
	R	TTGTCCGTGTTCACCGCATCG
Sall4	F	AATACCAAGTGAGCGTCCCATTAGC	NM_001080872.2	97	96 %
	R	GAACTTCGGTCGTGGCACAAGG
TERT	F	GTAAGACTAAGCCGTGTTGTTG	NM_001031007.2	158	102 %
	R	CTCCCGAATACTGAAGAGC
GAPDH	F	GGGTGGTGCTAAGCGTGTTA	NM_204305.2	118	101 %
	R	GCACGATGCATTGCTGACAA

Western blot analysis

The expression levels of pluripotency genes Oct4, Sox2, and Nanog in iPSCs were analyzed by Western blot using specific antibodies. β-actin was used as a loading control. Protein samples from iPSCs were mixed with loading buffer, denatured at 100 °C for 8 min, and separated on a 10 % SDS-PAGE gel (90 V for 20 min, then 120 V for 40 min). Proteins were transferred to ethanol-activated PVDF membranes using a semi-dry system (220 mA, 60 min) in a "sandwich" configuration. Membranes were blocked with rapid blocking buffer for 30 min after TBST rinsing, followed by overnight incubation at 4 °C with anti-Oct4, Sox2, and Nanog monoclonal antibody (1:5,000 dilution). After three TBST washes (10 min each), membranes were incubated with HRP-conjugated goat anti-mouse secondary antibody (1:10,000 in TBST) for 40 min. Signals were detected using the Yeasen ECL kit, with molecular weights validated against a prestained protein ladder via chemiluminescence imaging.

Telomere length measurement

qPCR-based method for determining telomere length involves sequential procedures beginning with DNA extraction from test samples using specialized kits. Following extraction, DNA concentration is standardized across samples through quantification with a NanoDrop spectrophotometer. Subsequently, telomere-specific primers targeting repetitive telomeric sequences are designed to enable PCR amplification of telomeric regions. During the amplification phase, DNA templates are combined with these primers and PCR reaction mixtures for qPCR analysis, with reaction conditions and cycling parameters configured according to established laboratory protocols. Finally, data interpretation entails calculating the relative abundance of telomeric sequences against an internal reference gene by measuring threshold cycle (Ct) values from amplification curves, with results expressed as the telomere-to-single-copy gene (T/S) ratio.

Statistical analysis

Statistical analysis was performed using Student’s t-test or one-way ANOVA followed by Tukey’s post-hoc test, as appropriate. Data are presented as mean ± standard deviation (SD). P-values less than 0.05 were considered statistically significant.

Results

Generation and titration of pluripotency factor-expressing lentiviral vectors

Samples exhibiting peak expression of pluripotency factors were selected for RNA extraction. Total RNA was reverse-transcribed into cDNA, followed by PCR amplification to obtain full-length sequences of the Oct4, Nanog, Sox2 and Lin28A genes (Fig. 1A). The resulting PCR products and synthesized miRNA-1811 and miRNA-302s were cloned into the multiple cloning site (MCS) of the pCDH-CMV vector. Target bacterial strains were recovered, and plasmids pCDH-Oct4, pCDH-Nanog, pCDH-Sox2, pCDH-Lin28A, pCDH-302s, and pCDH-302s-1811 were extracted. Plasmid concentration and purity, assessed using a microvolume spectrophotometer, met the requirements for subsequent experiments. Restriction enzyme digestion confirmed the presence of correctly sized bands consistent with expected results (Fig. 1, Fig. 1). For lentiviral packaging, recombinant lentiviral vectors were co-transfected with the helper plasmids pLP1, pLP2, and VSVG into 293T cells using Lipo3000 transfection reagent. GFP expression was observed via inverted fluorescence microscopy within 24 h post-transfection. Fluorescence intensity peaked between 48-72 h post-transfection, with over 90 % of cells exhibiting successful GFP expression (Fig. 1D). For viral titration, harvested viral supernatant was filtered, concentrated, and serially diluted across eight 10-fold dilutions (from 10⁴ to 10⁻⁶ μL equivalents). Dilutions were applied to 293T cells in 96-well plates. After 48 h of culture, GFP-positive cells were counted under an inverted fluorescence microscope at each dilution. Viral titers were calculated based on the number of infected cells observed at the highest dilution showing detectable fluorescence. Results for all recombinant lentiviruses are presented in Table 4.

Fig. 1.

Generation and characterization of lentiviral vectors expressing key reprogramming factors. (A) PCR amplification of Oct4, Nanog, Sox2, and Lin28A transcripts from reverse-transcribed cDNA templates. (B) Restriction endonuclease cleavage confirms successful insertion of target genes into pCDH backbone vectors. (C) Digestion patterns of recombinant plasmids pCDH-Oct4, pCDH-Nanog, pCDH-Sox2, pCDH-Lin28A, pCDH-302s, and pCDH-302s-1811, displaying restriction fragments of predicted molecular weights. (D) Transduction efficiency assessment: GFP expression visualized in 293T cells under fluorescence microscopy following lentiviral transduction.

Table 4.

Titer of recombinant lentivirus.

Recombinant lentivirus	Virus titer (Tu/ mL)
LV-Oct4	7.5 × 108
LV-Sox2	2 × 109
LV-Nanog	1 × 109
LV-Lin28	1.5 × 109
LV-miR-302s	8 × 108
LV-miR-302s-1811	9 × 108

Generation of chicken iPSCs

Through lentiviral infection, we successfully reprogrammed CEF cells into iPSCs. The process of miRNA-mediated reprogramming of CEF is depicted in Fig. 2A. From day 0 to day 7, significant changes in cell morphology occurred, transitioning from long spindle shapes to round forms. From day 8 to day 10, the cells began to aggregate, and embryonic stem cell-like colonies emerged. These colonies were characterized by distinct boundaries and a high nucleus-to-cytoplasm ratio (Fig. 2B). The expression of pluripotency protein factors in iPSCs obtained through reprogramming was observed using immunofluorescence cell technology. The results showing the expression of pluripotency markers Oct4, Sox2, SSEA-1, and EMA-1 proteins in iPSCs are presented in Fig. 2C. The in vitro differentiation potential of iPSCs was assessed through the induction of embryoid body (EB) formation. iPSCs were dissociated into single cells, transferred to ultra-low attachment dishes, and cultured with EB differentiation media. Seven to eight days later, embryoid bodies (EBs) were formed, as shown in Fig. 2D. The EBs were collected, and RNA was extracted. Using RT-PCR, we detected the expression of marker genes for the three germ layers: ectoderm (Pax6), mesoderm (Gata6), and endoderm (Gata4). As illustrated in Fig. 2E, the EBs derived from iPSCs expressed the marker genes for all three germ layers, demonstrating the capacity of iPSCs generated from CEF reprogramming to differentiate into the three germ layers in vitro. Notably, transfection with miRNA-1811 alone failed to induce pluripotency in CEFs.

Fig. 2.

Reprogramming and characterization of chicken induced pluripotent stem cells. (A) Workflow diagram illustrating the reprogramming of CEFs into iPSCs using Yamanaka factors and miRNA. (B) Time-lapse morphological transitions during reprogramming (days 1, 5, 7, 12; scale bar: 100 μm). (C) Co-expression analysis of pluripotency markers (OCT4, SOX2, SSEA-1, EMA-1) via immunofluorescence staining (scale bar: 100 μm). (D) In vitro differentiation assay demonstrating embryoid body formation (scale bar: 250 μm). (E) Triple-germlayer differentiation potential validated by PCR detection of lineage-specific markers.

Co-expression of miR-1811 and miR-302s promote reprogramming efficiency

An analysis was conducted comparing miRNA-iPSCs (co-transfected with gga-miRNA-302s and gga-miRNA-302s-1811) with iPSCs induced by the 4-factor (4F) method, aiming to investigate whether miRNA-induced iPSCs are more efficient and stable. Fig. 3A presents a comparison of cell morphology following the formation of iPSC clones, indicating that the colonies of miRNA-iPSCs are more three-dimensional and robust, whereas 4F-iPSC colonies are relatively flatter. iPSCs induced by co-transfection with gga-miRNA-1811 and gga-miRNA-302s exhibit a more stable cell morphology. Alkaline phosphatase staining combined with clone morphology analysis was used to count positive clones, and the reprogramming efficiency was calculated using ImageJ software. Fig. 3, Fig. 3 shows a comparison of reprogramming efficiencies for iPSCs, demonstrating that there was no significant difference between 302s-iPSCs and 4F-iPSCs, but the positive clone rate of 302s-1811-iPSCs was significantly higher than that of 4F-iPSCs. Starting with 50,000 cells, the reprogramming efficiency of 302s-1811-iPSCs was approximately 0.38 %, that of 302s-iPSCs was around 0.16 %, and that of 4F-iPSCs was about 0.15 %. The reprogramming efficiency of 302s-1811-iPSCs was 2.5 times higher compared to 4F-iPSCs.

Fig. 3.

Comparative analysis of reprogramming efficiency induced by different factor combinations in generating iPSCs. A. Morphological characterization of iPSCs derived from various reprogramming factor sets (Scale bar: 100 μm). B. AP staining representative images. C. Quantitative analysis of AP-positive cell population.

Enhanced iPSC aggregation and viability through miR-1811/miR-302 Co-expression

iPSCs cultured in adherent conditions were digested into single cells and then seeded onto ultra-low attachment plates. As shown in Fig. 4A, after 6 days of culture, the cells spontaneously began to aggregate into clusters, which would gradually increase in size as the cells grew. Viability testing using trypan blue staining revealed that the viability of all three groups of iPSCs remained above 95 % (Fig. 4B), with the viability of 4F-iPSCs showing a downward trend. The growth curves of the three groups of iPSCs were similar, with the cell proliferation rate of 302s-1811-iPSCs significantly higher than that of the other two groups (Fig. 4C). 302s-1811-iPSCs displaying higher telomerase activity, which is crucial for maintaining the pluripotent state by preserving telomere length, was significantly lower in 4F-iPSCs (Fig. 4D). Telomerase is essential for the self-renewal capacity of these cells. Our analysis demonstrated that iPSCs reprogrammed with miRNA had longer telomeres than 4F-iPSCs, indicating a more favorable environment for cellular proliferation and stability.

Fig. 4.

Single-cell suspension culture and expansion of chicken pluripotent stem cells. (A) Morphological characterization of pluripotent stem cells during suspension culture at sequential time points (Scale bar = 100 μm); (B) Cell viability dynamics throughout the suspension culture period; (C) Comparative analysis of proliferation kinetics across distinct cell lines.

Co-expression of miR-1811 and miR-302s enhances mesenchymal-to-epithelial transition in iPSCs reprogramming

The successful generation of iPSCs is marked by the induction of pluripotency-associated genes such as Oct4, Sox2, and Nanog. The expression of Sall4, a gene linked to both pluripotency and self-renewal, further indicates a fully reprogrammed state. Our analysis demonstrated consistent expression of Oct4, Sox2, and Sall4 across all iPSC groups. However, the level of Nanog expression was significantly higher in the 302s-1811-iPSCs compared to their counterparts. Moreover, at the protein level, Western Blot analysis, as depicted in Fig. 5B, confirmed the presence of stem cell pluripotency markers in all iPSC groups. Notably, the 302s-1811-iPSCs exhibited enhanced Nanog protein expression, while the 4F-iPSCs displayed diminished levels.

Fig. 5.

Co-expression of miR-1811 and miR-302s promotes MET during iPSC reprogramming. (A) Differential expression analysis of MET-related genes across distinct reprogramming conditions; (B) Western blot assessment of E-cadherin protein levels in reprogramming iPSCs; (C) Comparative profiling of core pluripotency marker genes among three iPSC group; (D) Western blot validation of pluripotency-associated protein expression in CEFs and three iPSC groups.

During reprogramming, the mesenchymal-to-epithelial transition (MET) represents a pivotal event where somatic cells adopt traits characteristic of an embryonic phenotype. This transition is crucial for attaining pluripotency and is characterized by the upregulation of epithelial markers like E-cadherin and the downregulation of mesenchymal genes such as N-cadherin. When comparing miRNA-induced pluripotent stem cells (miRNA-iPSCs) with those derived from the 4-factor (4F) methodology, we identified distinct expression patterns for these markers. Specifically, miRNA-iPSCs exhibited significantly elevated levels of E-cadherin and its associated protein, in contrast to 4F-iPSCs, which showed reduced expression of N-cadherin (Fig. 5A and B). These findings suggest a more efficient MET in miRNA-iPSCs, potentially enhancing their pluripotent and differentiation capabilities.

Discussion

We successfully generated two types of miRNA-reprogrammed iPSCs (302s-iPSC and 302s-1811-iPSC) and performed comparative analyses with conventional 4F-iPSC. Reprogramming efficiency was significantly enhanced in miRNA-iPSCs: 302s-1811-iPSC reached ∼0.38 %, representing a 2.5-fold increase over 4F-iPSC (∼0.15 %), while 302s-iPSC achieved ∼0.16 %. This demonstrates that miRNA-mediated reprogramming generally yields higher efficiency and stability than the 4F method.

The distinct gene expression patterns observed in miRNA-iPSCs likely arise from the ability of miRNAs to simultaneously target multiple genes within complex regulatory networks, mechanisms still under active investigation. Notably, miR-302s inhibits key G1-phase checkpoint regulators (CDK2, cyclin D, BMI-1) while indirectly activating p16Ink4a and p14/p19Arf, collectively suppressing >70 % of cell cycle activity during reprogramming (Lin et al., 2020). This induction of a relatively quiescent G0/G1 state may prevent random growth and tumorigenic transformation, promoting a more accurate and safer reprogramming outcome (Subramanyam et al., 2011). Further elucidation of cell cycle regulation remains a critical research direction.

The combination miRNA-302s-1811 significantly enhances MET process. Elevated E-cadherin expression strengthens cell adhesion and aggregation in miRNA-iPSCs, which is crucial for maintaining pluripotent stem cell integrity and function (Chen et al., 2010). As MET is the initiating and rate-limiting step in iPSC generation, its enhancement represents a key target for improving reprogramming technology and contributes to the observed stability of the miRNA-iPSC stem cell state.

NANOG expression is pivotal for inducing and sustaining the fully reprogrammed pluripotent state: It is essential for transitioning from an intermediate dedifferentiated state to ground-state pluripotency. Nanog deficiency arrests the inner cell mass in a pre-pluripotent state, ultimately causing developmental failure (Silva et al., 2009). Furthermore, Nanog can overcome p-Erk signaling and high Oct4 levels to achieve reprogramming under minimal conditions, facilitating the conversion from primed to naïve pluripotency (Theunissen et al., 2011). While necessary for long-term avian reprogrammed cell culture (Fuet et al., 2018), achieving fully reprogrammed, stable avian iPSCs requires identifying additional factors and optimal culture conditions. In our study, significantly higher NANOG expression in 302s-1811-iPSC compared to 4F-iPSC correlates with observed differences in passaging behavior and proliferation capacity.

Telomerase reactivation in iPSCs extends telomere length (Huang et al., 2014). Longer telomeres indicate superior telomere homeostasis and slower attrition rates, which are critical for pluripotent stem cell proliferation and survival (Boyle et al., 2020). Consistent with this, miRNA-iPSCs exhibited significantly longer telomeres than 4F-iPSCs, indicating enhanced proliferative capacity and improved maintenance of genomic structure and stability.

It is important to acknowledge that reprogramming involves highly complex, incompletely understood steps and regulatory networks. miRNA-iPSCs still face challenges, including potential genetic/epigenetic abnormalities and variable efficiency. Ongoing research focuses on addressing these limitations and optimizing iPSC applications across diverse fields.

Ethics statement

All experiments were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The use of animals in this study was approved by the South China Agricultural University Committee of Animal Experiments (approval ID: SYXK2022-0136).

CRediT authorship contribution statement

Zhenkai Dai: Software, Resources, Project administration, Data curation. Liqin Liao: Software, Resources, Funding acquisition, Conceptualization. Sheng Chen: Formal analysis, Data curation, Conceptualization. Zhengzhong Xiao: Writing – review & editing, Conceptualization. Xinheng Zhang: Writing – review & editing, Visualization. Qingmei Xie: Writing – review & editing, Writing – original draft, Validation, Supervision, Conceptualization.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.