Abstract
The tight junctions (TJs) between nasal mucosal epithelial cells are a crucial component of the nasal barrier function. Incomplete formation or reduced expression of TJs is a primary contributor to the onset and progression of allergic rhinitis (AR). Therefore, an in-depth investigation into the mechanisms affecting the barrier function of human nasal mucosal epithelial cells (HNEpCs) may facilitate the identification of new therapeutic approaches for AR treatment. Bioinformatics analysis found RGS1 is upregulated in AR, but its impact on the nasal mucosal epithelial barrier function remains unclear. This study aims to explore the mechanism of RGS1 regulating epithelial barrier function in AR. Differentially expressed genes in AR were analyzed using GSE43523 from GEO database. RGS1 expression level was validated in AR clinical samples and IL-13-induced HNEpCs. Loss and function of RGS1 or/and AQP5 was performed in IL-13-induced HNEpCs to detect the activation of NF-κB signal pathway. The epithelial barrier function of HNEpCs was measured by trans-epithelial electrical resistance (TER) and FITC-Dextran 4(FD4) assay. TJs, such as ZO-1, Occludin and Claudin-1 were also detected by western blot and Immunofluorescence. Bioinformatics analysis, AR clinical samples and IL-13-induced HNEpCs consistently found up-regulated RGS1 expression in AR. RGS1 silencing can protect HNEpCs against IL-13-induced epithelial barrier dysfunction, evidence by increased TER value, decreased FD4 and elevated expression of ZO-1, Occludin and Claudin-1. RGS1 silencing can also suppress the activation of NF-κB signal pathway and increase AQP5 expression, which such expression pattern can be nullified in response to AQP5 silencing. RGS1 was found to be elevated in AR. Silencing of RGS1 can suppress NF-κB signal pathway to increase AQP5 expression, thereby attenuating epithelial barrier dysfunction in HNEpCs.
Supplementary Information
The online version contains supplementary material available at 10.1007/s10616-025-00825-4.
Keywords: Allergic rhinitis, Epithelial barrier dysfunction, RGS1, NF-κB, AQP5
Introduction
Allergic rhinitis (AR) is a prevalent chronic, non-infectious nasal disorder (Zhao et al. 2025), with symptoms of nasal itching, pruritus and paroxysmal sneezing, watery rhinorrhea, and nasal congestion (Wang et al. 2025). Although AR is traditionally considered as a childhood condition, data supported the incidence of AR in the geriatric population is underestimated, with 3–12% of geriatric individuals affected (Gelardi et al. 2025). Recent data in China reported the prevalence of AR is 19% and 22% for adults and children, respectively (Pang et al. 2022). China’s rapid industrialization and urbanization have been accompanied by increased air pollution, which has been implicated in the rising trend of AR nationwide (Zhang and Zhang 2019). In addition to that, indoor environmental exposures are also important; dampness and mold, which are commonly found in Chinese households, have been identified as significant risk factors for AR (Wang et al. 2019a, b). This allergic condition is mediated by immunoglobulin E (IgE) and immunoglobulin G1 (IgG1), that occurs in atopic individuals following inhalation of certain foreign substances (allergens) (Jing et al. 2025; Li et al. 2025), which consequently triggers IgE-mediated inflammation (Gelardi et al. 2025). Although not life-threatening, this disorder causes much burden to global health and economic development (Siddiqui et al. 2022), due to its significant impact on quality of life, education, productivity and use of healthcare resources (Bousquet et al. 2020). Currently, the therapeutic approach for this disorder mainly focused on symptomatic therapy and there is a pressing need for innovation in treatment options (Gori et al. 2025).
The airway epithelial barrier is the first defence protecting the host immune system from the invasion of harmful pathogens or aeroallergens (Nur Husna et al. 2021), responsible for maintaining functions and epithelial homeostasis in the nasal mucosa (Gohy et al. 2020). Upon detection of foreign substances trapped in the nasal mucosa by epithelial cells, the epithelial barrier becomes progressively impaired, allowing harmful agents to penetrate deeper and provoke immune reactions in the nasal tissues (Zhang et al. 2023). Therefore, the integrity and function of the nasal epithelial barrier are inextricably bound up with the pathology of allergic diseases, including AR (Nur Husna et al. 2021).
Regulators of G-protein signaling 1 (RGS1) is a member of the RGS family that functions by binding to G protein-coupled receptor (GPCR)/G protein complexes (Wang et al. 2023), and is associated with various diseases such as myocardial infarction, Alzheimer's Disease and cancers (Xue et al. 2023; Zhang et al. 2022). Recently, studies have attached their emphasis of RGS1 on tumors, where RGS1 exhibits abnormally high expression within various malignant tumors and has been associated with poor prognosis (Chen et al. 2022; Wu et al. 2024). RGS1, as a regulator in inflammation, is also found to be highly expressed in immune cells (Feng et al. 2022; Xie et al. 2016). A previous study using oligonucleotide chip technique identified RGS1 as a differentially expressed gene (DEG) between AR and normal mucosa of the inferior nasal concha, suggesting the possible implication of RGS1 in AR (Wu et al. 2009). However, there is limited information regarding the role and implication of RGS1 in AR. In addition to that, bioinformatics analysis in this study showed RGS1 expression was up-regulated in AR. Previous study has reported that RGS1 knockdown inhibits the NF-κB signaling pathway (Shengnan et al. 2025), while suppression of NF-κB signaling has been shown to enhance the expression of aquaporin 5 (AQP5) in the nasal mucosa (Chang et al. 2017). Nasal epithelial cells (NEpCs) are vital in regulating innate and adaptive mucosal immunity in AR (Sha et al. 2025). Interleukin-13 (IL-13) is a key cytokine involved in the pathogenesis of AR (Jung et al. 2023) and was found to disrupt epithelial barrier integrity in human nasal epithelial cells (HNEpCs) (Huang et al. 2020). Based on these information, this study was conducted to test the hypothesis that RGS1 may regulate the barrier function of HNEpCs via the NF-κB/AQP5 axis using IL-13-induced HNEpCs, with the aim to provide theoretic basis for a better understanding of AR pathogenesis.
Materials and methods
Bioinformatics analysis
GSE43523 datasets, containing 5 control samples and 7 AR samples were downloaded from GEO (http://www.ncbi.nlm.nih.gov/geo). DEGs were identified using edgeR package, with the selection criteria defined as |logFC|≥ 1 and adj.P (False Discovery Rate [FDR]) < 0.05. A volcano plot and a heatmap visualizing the DEGs were generated using the ggplot2 and pheatmap packages, respectively. Functional enrichment analysis, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, was conducted using the clusterProfiler package. The GO analysis was further divided into three categories: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF).
Collection of clinical samples
The clinical samples were obtained from 20 AR patients and 20 controls in the Department of Otolaryngology at Children’s Hospital of Soochow University from January 2022 to January 2023. Written informed consent was obtained from all participants, and the study protocol was approved by the Medical Ethics Committee of Children’s Hospital of Soochow University (Approval No.: 2023C2113). The AR was diagnosed based on Chinese guideline for diagnosis and treatment of allergic rhinitis (2022, revision) (Honeybrook et al. 2018; Mullol 2009; Subspecialty Group of Rhinology et al. 2022; Wang et al. 2022), and a comprehensive assessment, including medical history, clinical symptoms, nasal endoscopy findings, and either allergen-specific IgE testing or a positive skin prick test result and environmental exposure assessment. 1. Clinical Symptoms: Patients with AR typically present with symptoms such as sneezing, nasal itching, nasal congestion, and rhinorrhea; 2. Nasal Endoscopy: An endoscopic examination of the nasal cavity reveals that patients with AR typically exhibit pale or light purplish nasal mucosa with frequent mucosal edema. Nasal secretions are usually watery, clear, and produced in large quantities; 3. Skin Prick Test (SPT): SPT results were evaluated by calculating the Skin Index (SI), defined as the ratio of the wheal diameter induced by the allergen to that induced by the positive control (histamine). The SPT was determined according to 4 grades: + : 0.3 ≤ SI < 0.5; + + : 0.5 ≤ SI < 1.0; + + + : 1.0 ≤ SI < 2.0; + + + + : SI ≥ 2.0; 4. Allergen-Specific IgE Testing: The ImmunoCAP system was used to test for common allergens, including dust mites, pollen, animal dander, and mold. A result of specific IgE ≥ 0.35 kUA/L was considered positive; 5. Environmental Exposure Assessment: Patients were interviewed regarding lifestyle factors (such as pet ownership and exposure to damp environments), occupational exposures (including dust and chemicals), and outdoor factors (such as pollen exposure) to identify potential triggers. A detailed timeline outlining each experimental phase is provided in Supplementary Table 1.
Inferior turbinate samples from AR patients were collected from individuals undergoing nasal septoplasty or surgical intervention for nasal congestion, while control samples were obtained from patients undergoing surgeries unrelated to the sinus conditions, such as procedures for nasal septal deviation, cerebrospinal fluid rhinorrhea, or anterior skull base tumors. Exclusion criteria included a history of allergen immunotherapy, a diagnosis of an infectious disease, pregnancy, or the concurrent use of medications such as antihistamines, steroids, or immunomodulatory drugs. These conditions were excluded because they may alter gene expression in NEpCs, potentially compromising the reliability of our findings on target gene expression in AR.
Quantitative reverse transcription-PCR (qRT-PCR)
Total RNA from tissues or cells were extracted using Total RNA Isolation Kit V2 (RC112-01, Vazyme, China) and cDNA was prepared using HiScript III All-in-one RT SuperMix Perfect for qPCR (R333, Vazyme). ABI 7500 (Applied Biosystems, Foster City, CA, USA) was used for RT-qPCR. The relative expression was detected using SYBR Green PCR Master Mix (Q111-02, Vazyme) and calculated using 2−ΔΔCT method using GAPDH as the internal control. The primer sequences are listed in Table 1.
Table 1.
Primer sequences
| Gene | Primer sequence | NCBI accession number | Products length |
|---|---|---|---|
| RGS1 | Forward: GAGTTCTGGCTGGCTTGTGA | NM_002922.4 | 136 bp |
| Reverse: ATTCTCGAGTGCGGAAGTCA | |||
| AQP5 | Forward: CCCGCTCACTGGGTTTTCT | NM_001651.4 | 144 bp |
| Forward: GTCCTCGTCAGGCTCATACG | |||
| GAPDH | Forward: TTCTTTTGCGTCGCCAGCC | NM_002046.7 | 236 bp |
| Reverse: TCCCGTTCTCAGCCTTGAC |
Western blot
Tissues or cells were lysed on ice using RIPA buffer (PP111-02, Beyotime, China) for 15 min, followed by centrifugation at 13,000 g for 5 min. After measuring the protein concentration using a BCA protein assay kit (P0010, Beyotime), the proteins were added with loading buffer in a boiling bath for 10 min to enable protein denature. The loading volume for each group was calculated based on a total protein amount of 40 μg. Electrophoresis was performed at 80 V for 30 min until bromophenol blue entered the separating gel, followed by 120 V for 90 min. Proteins were then transferred onto a 0.45 μm PVDF membrane (IPVH00010, Millipore, USA) using a semi-dry transfer system (Bio-Rad) in transfer buffer. The entire process was conducted under ice bath conditions with a constant current of 250 mA for 100 min. The PVDF membrane was washed three times with Tris-Buffered Saline with Tween-20 (TBST), each wash lasting 1–2 min. The proteins were then reacted with blocking buffer containing 5% skimmed milk for 1 h before further incubation with TBST diluted primary antibodies: goat polyclonal antibody against RGS1 (ab117077, 1:1000), rabbit monoclonal antibody against ZO-1 (ab307799, 1:1000), rabbit monoclonal antibody against Occludin (ab216327, 1:1000), rabbit monoclonal antibody against Claudin-1 (ab307692, 1:1000), rabbit monoclonal antibody against p-p65 (ab76302, 1:1000), rabbit monoclonal antibody against p65 (ab32536, 1:5000), rabbit monoclonal antibody against AQP5 (ab305303, 1:1000) and rabbit monoclonal antibody against GAPDH (ab181602, 1:10,000) (all from Abcam, Cambridge, UK) at 4 °C overnight. After TBST washing for three times, 10 min each, the proteins were further incubated with TBST diluted secondary antibody, donkey anti-goat IgG (H + L) HRP (711–035-152, Jackson Immuno Research) or goat anti-rabbit IgG H&L (HRP) (ab6721, abcam), for 1 h at room temperature, followed by TBST washing for three times, 10 min each. ECL chemiluminescent substrate (P0018S, Beyotime) was added for color development and the protein band was analyzed under a chemiluminescence imaging system (Bio-Rad) using ImageJ software.
Cell culture and treatment
HNEpCs purchased from BeNa Culture Collection (China, Cat. No.: BNCC356247) were cultured in EMEM (Cat. No.: BNCC360906) containing 10% fetal bovine serum at 37℃ in an 5% CO2 incubator. The HNEpCs were treated by 20 ng/mL IL-13 for 24 h for in vitro modeling (Liu et al. 2025). To achieve stable and efficient knockdown of RGS1 or AQP5, HNEpCs were transfected with lentiviral vectors encoding RGS1 or AQP5 short hairpin RNA (shRNA) (GeneChem Co., Ltd., Shanghai).
Determination of trans-epithelial electrical resistance (TER)
HNEpCs were seeded in a transwell plate with 105 per well. Once cell confluency reached 100%, the TER of cells were determined using EVOM/EndOhm system (World Precision Instrument, USA) (Zhan et al. 2023).
FITC-Dextran 4(FD4) permeability assay
HNEpCs (105) were seeded into the upper chamber of Transwell plate and the lower chamber was added with 500 μL complete culture medium. The culture medium was refreshed every two days and cell culture was maintained at a temperature of 37 °C with 5% CO2 for about 7 days. The cell monolayers were washed three times with serum-free medium to eliminate serum interference. Subsequently, 2 mg/mL FD4 (60842-46-8, Merck, Germany) was added to the apical side of the cultured HNEpCs at a volume of 200 μL per well. A total of 600 μL serum-free medium was added to the basolateral side. After incubation at 37℃ in 5% CO2 for 4 h, 100 μL of medium was collected from the basolateral side and transferred to a black 96-well plate. The fluorescence intensity of FD4 in the basolateral compartment of HNEpCs was measured using a fluorescence microplate reader (VL0000D0, Thermo Fisher Scientific; Ex/Em = 490/520 nm), and the FD4 concentration was calculated based on a standard curve (Zhan et al. 2023). The apparent permeability coefficient (Papp) was calculated using the following equation: Papp = Q / (A × C0), where Q is the rate of FD4 accumulation on the basolateral side per unit time (μg/s), A is the surface area of the membrane (cm2), C0 is the initial concentration of FD4 on the apical side (2 mg/mL = 2000 μg/mL).
Immunofluorescence
The culture medium of HNEpCs in the culture disk were removed. The cells were washed with phosphate-buffered saline (PBS) for 3 times, followed by fixation with 4% polyformaldehyde for 15 min, permeabilization with 0.5% Triton-100 (R21239, OriLeaf, China) for 15 min and blocking with 5% bovine serum albumin (BSA) for 1 h. Afterward, cells were incubated with following primary antibodies at 4℃ overnight: ZO-1 (ab307799, 1:500), Occludin (ab216327, 1:100), and Claudin-1 (ab307692, 1:50) (all from Abcam). Then the fluorophore-labeled secondary antibody was added for incubation for 2 h. Cells were washed three times with PBS and then counterstained with DAPI to label the nuclei. Image acquisition was performed using an inverted fluorescence microscope (IX51, Olympus, Japan), with a minimum of five distinct fields captured for each sample. The mean fluorescence intensity of the target regions was subsequently quantified using ImageJ software and subjected to statistical analysis.
Statistical analysis
All data are presented as mean ± standard deviation (SD). Statistical analysis was performed using SPSS software (version 26.0, SPSS, Inc.). The Shapiro–Wilk test was used to assess the normality of the data, and Levene’s test was employed to evaluate the homogeneity of variances. Differences between two groups were analyzed using Student’s t-test, while comparisons among multiple groups were conducted using one-way analysis of variance (ANOVA), followed by Tukey’s post hoc test. A P-value of less than 0.05 was considered statistically significant.
Results
Bioinformatics data identified upregulated RGS1 expression in AR
Analyzing the dataset GSE43523 from GEO database indicated 28 downregulated genes, including CST1, ITLN1, and TFF3, and 40 upregulated genes in AR (Fig. 1A). The upregulated genes, CST1, ITLN1, and TFF3, have also been reported in AR in a previous study (Wang et al. 2021), which supports the reliability of our bioinformatics analysis.
Fig. 1.
Bioinformatics analysis reveals upregulated expression of RGS1 in AR. A Heatmap displaying differentially expressed genes in the GSE43523 dataset (red indicates upregulation, while blue indicates downregulation); B Volcano plot illustrating differentially expressed genes in the GSE43523 dataset (red indicates genes that meet the screening criteria of |logFC|≥ 1 and adj. P < 0.05. Genes with X-axis values ≤ -1 are considered significantly downregulated, while those with values ≥ 1 are considered significantly upregulated.); C GO enrichment analysis of upregulated genes in AR samples; D KEGG enrichment analysis of upregulated genes in AR samples; E GO enrichment analysis of downregulated genes in AR samples; F KEGG enrichment analysis of downregulated genes in AR samples. Five control samples and seven AR samples
Notably, we found that RGS1 was one of the upregulated genes in AR (Fig. 1B); however, its role in AR has not yet been reported. Therefore, this study is to investigate the function and mechanism of RGS1 in AR progression. GO and KEGG enrichment analyses on DEGs in GSE43523 dataset showed that the upregulated genes were mainly enriched in signaling pathways, such as ERK1/2, while the downregulated genes were primarily enriched in pathways, such as MAPK (Fig. 1C–F).
Elevated RGS1 expression in AR clinical samples and cell models
The expression levels of RGS1 in nasal mucosa samples from 20 individuals (controls) and 20 AR patients were assessed using qRT-PCR and western blot. The results revealed a higher expression in the nasal mucosa of AR patients than that in the control samples (Fig. 2A, B, mRNA: fold change [FC] = 1.60, P < 0.0001, Protein: FC = 3.42, P < 0.0001). Consistently, RGS1 expression was also found to be upregulated following IL-13 treatment in HNEpCs (Fig. 2C, D, mRNA: FC = 2.04, P = 0.0008, Protein: FC = 5.49, P = 0.0016). These findings suggest that RGS1 expression is upregulated in AR and may implicate in its progression.
Fig. 2.
RGS1 expression is upregulated in AR clinical samples and cell models. A qRT-PCR analysis of RGS1 expression in nasal mucosa samples from control individuals (n = 20) and AR patients (n = 20); B Western blot analysis of RGS1 expression in nasal mucosa samples from control individuals (n = 20) and AR patients (n = 20); C qRT-PCR analysis of RGS1 expression in IL-13-treated HNEpCs, n=3; D Western blot analysis of RGS1 expression in IL-13-treated HNEpCs, n=3. Data in panel. A–D were analyzed using an unpaired t-test. **P < 0.01, ***P < 0.001
RGS1 silencing protects HNEpCs from IL-13-induced barrier dysfunction
HNEpCs were infected with RGS1-interfering lentivirus and then induced by IL-13 treatment. qRT-PCR and western blot found RGS1-interfering lentivirus in HNEpCs can repress RGS1 expression (Fig. 3A, B, mRNA: FC = 0.57, P = 0.0004, Protein: FC = 0.51, P = 0.0213). Measurement on epithelial barrier integrity by TER and FD4 permeability assays demonstrated that IL-13 treatment can decrease TER by 63.5% (P < 0.001) and increase FD4 permeability (FC = 2.46, P = 0.0003), whereas TER was increased by 225% (P < 0.001) and FD4 permeability was decreased (FC = 0.46, P = 0.0015) in cells with RGS1 silencing (Fig. 3C, D). Detection on expressions of ZO-1, Occludin and Claudin-1 by Immunofluorescence and western blot found decreased ZO-1 (Immunofluorescence: FC = 0.22, P < 0.0001, Protein: FC = 0.19, P < 0.0001), Occludin (Immunofluorescence: FC = 0.41, P = 0.0009, Protein: FC = 0.22, P < 0.0001) and Claudin-1 (Immunofluorescence: FC = 0.31, P = 0.0002, Protein: FC = 0.38, P = 0.0008) expressions in response to IL-13 treatment, and those expressions were elevated after RGS1 silencing (Fig. 3E, F). The above results suggested that RGS1 silencing can protects HNEpCs from barrier dysfunction induced by IL-13 treatment.
Fig. 3.
RGS1 silencing can protects HNEpCs from barrier dysfunction induced by IL-13 treatment. HNEpCs were infected with RGS1-interfering lentivirus and induced by IL-13 treatment. A qRT-PCR detected RGS1 mRNA expression; B western blot detected RGS1 protein expression; C TER; D FD4permeability; E Immunofluorescence detected ZO-1, Occludin and Claudin-1 expression; F western blot detected ZO-1, Occludin and Claudin-1 protein levels. Panel A–F were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons test. *, P < 0.05, **, P < 0.01, ***, P < 0.001. n = 3
RGS1 silencing inhibits NF-κB signal pathway and increases AQP5 expression
We then examined the expression levels of p-p65/p65 and AQP5 in clinical AR samples. The results revealed that p-p65/p65 expression was significantly elevated (FC = 3.25, P < 0.0001), which is consistent with a previous study reporting activation of the NF-κB signaling pathway in AR (Yang et al. 2024). In agreement with a previous study by Jiang Y (Jiang et al. 2008), this study also found AQP5 expression was decreased in the nasal mucosa of AR patients compared to controls (FC = 0.28, P < 0.0001) (Fig. 4A). Additionally, we analyzed the expression of proteins related to NF-κB pathway and AQP5 in IL-13-treated or/and RGS1-silenced HNEpCs. The results demonstrated that IL-13 treatment increased p-p65/p65 expression (FC = 2.37, P = 0.0054) while reducing AQP5 expression (FC = 0.47, P = 0.0103), whereas RGS1 silencing suppressed p-p65/p65 expression (FC = 0.47, P = 0.01114) and restored AQP5 expression (FC = 2.18, P = 0.0135) (Fig. 4B). Collectively, these findings suggest that RGS1 silencing inhibits NF-κB signaling and upregulates AQP5 expression in IL-13-induced HNEpCs.
Fig. 4.
RGS1 silencing inhibits NF-κB signal pathway and increases AQP5 expression. A the protein expressions of p-p65/p65 and AQP5 in clinical nasal mucosa from controls (n = 20) and AR patients (n = 20) were detected by western blot; B the protein expressions of p-p65/p65 and AQP5 in IL-13-treated and RGS1-silenced HNEpCs were detected by western blot. Panel A was analyzed using un-paired t test, while panel B was determined using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons test. *, P < 0.05, **, P < 0.01. n = 3
AQP5 silencing partially reverse the protective effect of RGS1 silencing against barrier dysfunction in HNEpCs
We further investigated the effects of RGS1 and/or AQP5 silencing on IL-13-induced barrier dysfunction in HNEpCs. qRT-PCR and western blot analyses demonstrated that, compared with the IL-13 + sh-RGS1 + sh-NC group, the IL-13 + sh-RGS1 + sh-AQP5 group exhibited no change in RGS1 expression, while AQP5 expression was significantly reduced (Fig. 5A, B). To further assess whether AQP5 silencing influences the protective effect of RGS1 silencing on HNEpC barrier function, we evaluated the key barrier integrity markers. The results showed that AQP5 and RGS1 silencing in HNEpCs led to a reduction in TER values (67 ± 3.5 vs. 29 ± 2.8, decreased by 56.72%, P = 0.0001) (Fig. 5C), an increase in FD4 permeability (1.12 ± 0.13 vs. 2.07 ± 0.27, increased by 84.82%) (Fig. 5D), and a decrease in the expression of the TJ proteins, ZO-1 (Immunofluorescence: FC = 0.25, P = 0.0003, Protein: FC = 0.36, P = 0.0001), Occludin (Immunofluorescence: FC = 0.49, P = 0.0115, Protein: FC = 0.18, P = 0.0003), and Claudin-1 (Immunofluorescence: FC = 0.33, P = 0.0041, Protein: FC = 0.28, P = 0.0027) (Fig. 5E, F). Collectively, these findings suggest that AQP5 silencing partially compromises the protective effects of RGS1 silencing on HNEpC barrier function.
Fig. 5.
AQP5 silencing compromises the protective effects of RGS1 silencing on HNEpC barrier function. HNEpCs were infected with RGS1 or/and AQP5 interfering lentivirus and then treated by IL-13. A the RGS1 and AQP5 expressions were detected by RT-PCR; B protein expressions of RGS1 and AQP5 were measured by western blot; C TER, D FD4 permeability; E Immunofluorescence detected ZO-1, Occludin and Claudin-1 expression; F western blot detected ZO-1, Occludin and Claudin-1 protein levels. Panel A–F were analyzed using un-paired t test. *, P < 0.05, **, P < 0.01, ***, P < 0.001. n = 3
Discussion
In this study, IL-13 was used to stimulate HNEpCs to establish an in vitro AR model. This approach is supported by previous studies (Ding et al. 2024; Liu et al. 2025; Qi 2025), in which IL-13-induced HNEpC models effectively recapitulated key pathological features of AR, including the disruption of epithelial barrier integrity and the induction of inflammatory responses (Liu et al. 2025; Qi 2025). The IL-13 stimulation model enables precise investigation of cytokine-induced molecular and cellular changes under controlled conditions and has been widely used to dissect relevant signaling pathways and explore potential therapeutic targets in AR. Thus, our findings based on this model provide mechanistic insights into IL-13-mediated epithelial dysfunction and support the rationale for targeting IL-13-associated pathways in the treatment of AR. The collective evidence from bioinformatic analysis, clinical data and cellular experiments validated RGS1 is up-regulated in AR and silencing of RGS1 can inhibit the activation of NF-κB signal pathway to increase AQP5 expression, thereby exerting a protective effect against barrier dysfunction in AR progression (see Fig. 6).
Fig. 6.

Mechanistic model of RGS1 induces nasal epithelial barrier dysfunction in allergic rhinitis by modulating NF-κB/AQP5 axis.The expression of RGS1 is upregulated in AR. Silencing RGS1 can protect HNEpCs cells from IL-13-induced barrier dysfunction. Mechanistically, silencing RGS1 can inhibit the NF-κB signaling pathway and upregulate the expression of AQP5. Silencing AQP5 in the context of silencing RGS1 can inhibit the protective effect of silencing RGS1 on the barrier function of HNEpCs cells
Notably, our enrichment analysis revealed that upregulated genes in AR were associated with the ERK1/2 signaling pathway, while downregulated genes were enriched in the broader MAPK pathway. Given that ERK1/2 is a major sub-branch of the MAPK family, this observation may appear paradoxical at first glance. However, it likely reflects a complex regulatory framework. ERK1/2 signaling has been implicated in the promotion of inflammatory responses in AR, including the upregulation of cytokines such as TNF-α, IL-6, and IL-8 (Ishimaru et al. 2017). The IL-33/ST2 axis has also been shown to activate ERK1/2 in nasal epithelial cells, contributing to mucosal inflammation (Li et al. 2020). Inhibition of this pathway has demonstrated therapeutic potential in both animal and cellular models of AR (Chen et al. 2015). On the other hand, the downregulation of genes in the overall MAPK pathway may reflect a compensatory feedback mechanism aimed at restraining excessive immune activation. Prior studies suggest that overactivation of inflammatory signaling can trigger suppression of specific MAPK components to mitigate tissue damage (Sultonov et al. 2022). Thus, the contrasting enrichment patterns of ERK1/2 and MAPK-related genes may highlight a dynamic interplay between inflammation and self-regulation during AR pathogenesis. Further mechanistic studies are warranted to dissect these interactions more precisely.
RGS1, a member of the G protein signaling regulatory family, inhibits the signal transduction of GPCR by enhancing the intrinsic GTPase activity of G proteins (Shengnan et al. 2025). Increasing evidence reported the abnormal expression of RGS1 in several cancers, including breast cancer, ovarian cancer and melanoma (D. Huang et al. 2021a, b; Shengnan et al. 2025; Y. Wang et al. 2019a, b). It has been demonstrated that in melanoma, RGS1 promotes tumor development by regulating Gαs-mediated phosphorylation of AKT and ERK. Interestingly, this regulatory mechanism is independent of the GTP hydrolysis process in GPCR signaling, indicating that RGS1 exerts a non-GAP function (Sun et al. 2018). In addition to that, RGS1 functions as a negative regulator of chemokine receptor signaling, thereby influencing the migration of B and T lymphocytes in autoimmune diseases (Feng et al. 2021). In current study, the bioinformatics analysis and clinical detection consistently identified RGS1 as a up-regulated gene in AR. An cellular AR model was established to further explore the possible effect of RGS1 on AR progression. Functional impairment of the epithelial barrier is considered a contributing factor in the development of various diseases, including allergies and autoimmune disorders (Celebi Sozener et al. 2022). Current results shown that suppression of RGS1 expression can protect HNEpCs from IL-13-induced barrier dysfunction, evidenced by increased TER, decreased FD4 permeability and elevated expression of TJs, ZO-1, Occludin and Claudin-1. The nasal epithelial barrier consists of cell junctions, including TJs, adherens junctions, desmosomes, and hemidesmosomes. Dysfunction of TJ proteins contributes significantly to the pathogenesis of AR (Li et al. 2022; Nur Husna et al. 2021). A previous study documented that local epithelial damage to the skin and mucosal barriers triggers type 2 inflammation in tissues, contributing to allergic conditions, such as AR (Celebi Sozener et al. 2022). These results indicate the mediation of RGS1 expression on nasal epithelial barrier in AR. Different from above studies which focused on cancer development or progression, this study explored the possible effect of RGS1 on AR, aim to elucidate the possible mechanism of RGS1 regulation on AR.
In recent studies, IL-13 has been recognized as a key cytokine involved in the pathogenesis of AR (Jung et al. 2023). Upon allergen exposure (e.g., pollen or dust mites), IL-13 is released from activated immune cells and contributes to AR progression through multiple mechanisms, including activation of the NOD-like receptor family pyrin domain-containing 3 (NLRP3) inflammasome, thereby promoting nasal mucosal inflammation, oxidative stress, and epithelial cell apoptosis (Ding et al. 2024). Moreover, IL-13 has been shown to disrupt TJs and compromise the epithelial barrier in HNEpCs, further exacerbating mucosal vulnerability (Huang et al. 2020). Importantly, the JAK/STAT signaling pathway is critically involved in this process. Specifically, IL-13 binds to its receptor and activates JAK2, leading to phosphorylation and nuclear translocation of STAT3, which in turn enhances the expression of downstream inflammatory genes such as IL-4, IL-5, and TNF-α, amplifying the inflammatory response (H. Huang et al. 2021a, b; Jia et al. 2024). Although direct evidence linking IL-13 and RGS1 remains limited, our findings of elevated RGS1 expression in AR, together with the known role of IL-13 in activating JAK2/STAT3 signaling, suggest a possible connection wherein IL-13-induced inflammation may upregulate RGS1 expression. Further research is warranted to elucidate the mechanistic interactions among IL-13, RGS1, and AR.
A previous transcriptomic analysis support the involvement of NF-κB signaling in RGS1-mediated regulation (Shengnan et al. 2025). But currently, there is no evidence reporting the direct molecular interaction between RGS1 and NF-κB signal pathway in HNEpCs. In current study, the detection on AR clinical samples and IL-13-treated HNEpCs found elevated p-p65/p65 expression, which was consistently with a previous study highlighting the activation of NF-κB signal pathway in AR (Jiang et al. 2008). In addition to that, silencing of RGS1 led to decreased p-p65/p65 expression, suggesting the possible regulation of RGS1 on NF-κB signal pathway. One plausible mechanism is that RGS1 may exert its effects through modulation of upstream GPCR signaling. As a negative regulator of Gα subunits, RGS1 can inhibit GPCR-mediated downstream pathways (Moratz et al. 2004a, 2004b). This aligns with the well-established role of GPCRs in initiating pro-inflammatory signaling cascades via NF-κB (Fraser 2008; Yang et al. 2021). Further studies employing Co-Immunoprecipitation to examine RGS1-Gα interactions and pharmacological modulation of GPCRs may help elucidate this regulatory axis.
Moreover, this study further found the downstream target of RGS1 in AR. AQP5 belongs to a conserved family of transmembrane proteins expressed in various organs and systems (Chen et al. 2021). Humans have 13 aquaporins (AQP0-AQP12), among which AQP1, AQP3, AQP4, and AQP5 are expressed in the respiratory system (Yadav et al. 2020). Notably, AQP5 plays a role in pulmonary hyperresponsiveness and airway inflammation associated with asthma (Krane et al. 2009). The detection of this study revealed AQP5 expression was reduced in AR cell models. Furthermore, AQP5 expression was increased and NF-κB signal pathway was inhibited in response to RGS1 silencing in IL-13-treated HNEpCs. Rescue experiments on HNEpCs further validated that suppression on AQP5 can reverse the protective effect of RGS1 silencing on HNEpC barrier function. This observation was supported by a previous study stated that airway epithelial dysfunction in asthma and upper airway diseases occurs as a result of disrupted TJ formation (Hellings and Steelant 2020). These results collectively indicated that the mediation of RGS1 on NF-κB signal pathway to affect nasal epithelial barrier in AR via regulating AQP5 expression.
This study has several limitations. First, the relatively small sample size of the GSE43523 dataset may have limited the statistical power, potentially leading to the omission of certain DEGs. Second, although the study integrates bioinformatics analysis, clinical validation, and cellular experiments to investigate the role of RGS1 in AR, the underlying mechanisms remain only partially elucidated. Given the complexity of allergen-induced immune responses and the multifactorial nature of AR pathogenesis, further studies involving larger clinical cohorts and in vivo experiments are needed. Moreover, the incorporation of multi-omics approaches, including transcriptomics, proteomics, and metabolomics, may provide a more comprehensive and systems-level understanding of RGS1-mediated regulation in AR.
In summary, our study demonstrates that RGS1 is upregulated in both AR clinical samples and IL-13-induced HNEpCs. RGS1 silencing can suppress NF-κB signal pathway to increase AQP5 expression, thereby enhancing tight junction integrity and epithelial barrier function in HNEpCs. These findings provide new insights into the molecular mechanisms underlying nasal epithelial barrier disruption in AR and suggest that targeting the RGS1/NF-κB/AQP5 pathway may represent a promising therapeutic strategy for restoring mucosal barrier function in AR.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to give our sincere gratitude to the reviewers for their constructive comments.
Author contributions
Wenchuan Chang finished the study design, Yan He finished the experimental studies, Liang Liu finished the data analysis, Wenchuan Chang finished manuscript editing. All authors read and approved the final version of the manuscript.
Funding
This study was supported by Suzhou Municipal Applied Basic Research (Healthcare) Science and Technology Innovation Project/Suzhou Municipal Applied Basic Research (Healthcare) Youth Project(SYW2025111), the 2024 Gusu Talent Research Project (No. RC202411), 2021 Doctoral Research Initiation Program (No. RC202124) and 2024 Basic Science (Natural Science) Research Program of Higher Education Institutions in Jiangsu Province (No. 24KJB320017).
Data availability
The experimental data used to support the findings of this study are available from the corresponding author upon request.
Declarations
Conflict of interest
The authors declare no competing interests.
Ethical approval
Written informed consent was obtained from all participants, and the study protocol was approved by the Medical Ethics Committee of Children’s Hospital of Soochow University (Approval No.:2023C2113).
Consent for publication
The participant has consented to the submission of the case report to the journal.
Informed consent
Informed consent was obtained from all individual participants included in the study.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Wenchuan Chang and Yan He have contributed equally to this work.
References
- Bousquet J, Anto JM, Bachert C et al (2020) Allergic rhinitis. Nat Rev Dis Primers 6:95 [DOI] [PubMed] [Google Scholar]
- Celebi Sozener Z, Ozdel Ozturk B, Cerci P et al (2022) Epithelial barrier hypothesis: effect of the external exposome on the microbiome and epithelial barriers in allergic disease. Allergy 77:1418–1449 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang YL, Lin CS, Wang HW et al (2017) Chlorpheniramine attenuates histamine-mediated aquaporin 5 downregulation in human nasal epithelial cells via suppression of NF-kappaB activation. Int J Med Sci 14:1268–1275 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen M, Xu S, Zhou P et al (2015) Desloratadine citrate disodium injection, a potent histamine H(1) receptor antagonist, inhibits chemokine production in ovalbumin-induced allergic rhinitis guinea pig model and histamine-induced human nasal epithelial cells via inhibiting the ERK1/2 and NF-kappa B signal cascades. Eur J Pharmacol 767:98–107 [DOI] [PubMed] [Google Scholar]
- Chen J, Nadar VS, Rosen BP (2021) Aquaglyceroporin AqpS from Sinorhizobium meliloti conducts both trivalent and pentavalent methylarsenicals. Chemosphere 270:129379 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Z, Liu B, Zhang S et al (2022) RGS1 serves as an antitumor target to inhibit proliferation of NICN87-DR cells and tumor growth in the gastric cancer mouse model. Turk J Biol 46:277–287 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding H, Lu X, Wang H et al (2024) NLRP3 inflammasome deficiency alleviates inflammation and oxidative stress by promoting PINK1/Parkin-mediated mitophagy in allergic rhinitis mice and nasal epithelial cells. J Asthma Allergy 17:717–731 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng Z, Zhou J, Liu Y et al (2021) Epithelium- and endothelium-derived exosomes regulate the alveolar macrophages by targeting RGS1 mediated calcium signaling-dependent immune response. Cell Death Differ 28:2238–2256 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng D, Yu J, Bao L et al (2022) Inhibiting RGS1 attenuates secondary inflammation response and tissue degradation via the TLR/TRIF/NF-kappaB pathway in macrophage post spinal cord injury. Neurosci Lett 768:136374 [DOI] [PubMed] [Google Scholar]
- Fraser CC (2008) G protein-coupled receptor connectivity to NF-kappaB in inflammation and cancer. Int Rev Immunol 27:320–350 [DOI] [PubMed] [Google Scholar]
- Gelardi M, Giancaspro R, Boni E et al (2025) Rhinitis in the geriatric population: epidemiological and cytological aspects. Geriatrics. 10.3390/geriatrics10020050 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gohy S, Hupin C, Ladjemi MZ et al (2020) Key role of the epithelium in chronic upper airways diseases. Clin Exp Allergy 50:135–146 [DOI] [PubMed] [Google Scholar]
- Gori A, Brindisi G, Anania C et al (2025) Synergic efficacy of a multicomponent nutraceutical add-on therapy in seasonal allergic rhinitis in children: a prospective, randomized, parallel-group study. J Clin Med. 10.3390/jcm14051517 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hellings PW, Steelant B (2020) Epithelial barriers in allergy and asthma. J Allergy Clin Immunol 145:1499–1509 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Honeybrook A, Ellison M, Puscas L et al (2018) Otolaryngologist adherence to the AAO-HNSF allergic rhinitis clinical practice guideline. Int Forum Allergy Rhinol 8:741–750 [DOI] [PubMed] [Google Scholar]
- Huang ZQ, Liu J, Ong HH et al (2020) Interleukin-13 alters tight junction proteins expression thereby compromising barrier function and dampens rhinovirus induced immune responses in nasal epithelium. Front Cell Dev Biol 8:572749 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang D, Chen X, Zeng X et al (2021a) Targeting regulator of G protein signaling 1 in tumor-specific T cells enhances their trafficking to breast cancer. Nat Immunol 22:865–879 [DOI] [PubMed] [Google Scholar]
- Huang H, Ren Y, Liang H et al (2021b) Mechanism of TCONS_00147848 regulating apoptosis of nasal mucosa cells and alleviating allergic rhinitis through FOSL2-mediated JAK/STAT3 signaling pathway. Sci Rep 11:15991 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ishimaru Y, Sumino A, Kajioka D et al (2017) Apelin protects against NMDA-induced retinal neuronal death via an APJ receptor by activating Akt and ERK1/2, and suppressing TNF-alpha expression in mice. J Pharmacol Sci 133:34–41 [DOI] [PubMed] [Google Scholar]
- Jia QJ, Liu Z, Wang C et al (2024) Protective effect of platycodin D on allergic rhinitis in mice through DPP4/JAK2/STAT3 pathway inhibition. Curr Mol Pharmacol 17:e18761429345310 [DOI] [PubMed] [Google Scholar]
- Jiang Y, Yu C, Shen X et al (2008) Expression and its significance of aquaporin 5 in nasal polyps with or without allergic rhinitis. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 22:842–845 [PubMed] [Google Scholar]
- Jing Y, Xie J, Long S et al (2025) MiR-126-5p down-regulation alleviates the inflammatory response of allergic rhinitis in children via inhibiting HIPK2/NF-kappaB signaling pathway. J Inflamm Res 18:3981–3992 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jung DH, Lee A, Hwang YH et al (2023) Therapeutic effects of Pulsatilla koreana Nakai extract on ovalbumin-induced allergic rhinitis by inhibition of Th2 cell activation and differentiation via the IL-4/STAT6/GATA3 pathway. Biomed Pharmacother 162:114730 [DOI] [PubMed] [Google Scholar]
- Krane CM, Deng B, Mutyam V et al (2009) Altered regulation of aquaporin gene expression in allergen and IL-13-induced mouse models of asthma. Cytokine 46:111–118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li YQ, Zhong Y, Xiao XP et al (2020) IL-33/ST2 axis promotes the inflammatory response of nasal mucosal epithelial cells through inducing the ERK1/2 pathway. Innate Immun 26:505–513 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Sun L, Zhang Y (2022) Programmed cell death in the epithelial cells of the nasal mucosa in allergic rhinitis. Int Immunopharmacol 112:109252 [DOI] [PubMed] [Google Scholar]
- Li L, Zhang Y, Wang J et al (2025) GZMA silencing inhibits JAK2/STAT1 pathway and improves allergic rhinitis. Gen Physiol Biophys 44:93–106 [DOI] [PubMed] [Google Scholar]
- Liu S, Wu J, Meng L et al (2025) Piezo1-induced nasal epithelial barrier dysfunction in allergic rhinitis. Inflammation. 10.1007/s10753-024-02234-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moratz C, Harrison K, Kehrl JH (2004a) Regulation of chemokine-induced lymphocyte migration by RGS proteins. Methods Enzymol 389:15–32 [DOI] [PubMed] [Google Scholar]
- Moratz C, Harrison K, Kehrl JH (2004b) Role of RGS proteins in regulating the migration of B lymphocytes. Arch Immunol Ther Exp (Warsz) 52:27–35 [PubMed] [Google Scholar]
- Mullol J (2009) A survey of the burden of allergic rhinitis in Spain. J Investig Allergol Clin Immunol 19:27–34 [PubMed] [Google Scholar]
- Nur Husna SM, Tan HT, Md Shukri N et al (2021) Nasal epithelial barrier integrity and tight junctions disruption in allergic rhinitis: overview and pathogenic insights. Front Immunol 12:663626 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pang K, Li G, Li M et al (2022) Prevalence and risk factors for allergic rhinitis in China: a systematic review and meta-analysis. Evid Based Complement Alternat Med 2022:7165627 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qi S (2025) Inhibition of FABP4 ameliorates IL-13-induced inflammatory response and barrier dysfunction in nasal mucosal epithelial cells through the regulation of ferroptosis. Cell Biochem Biophys 83:977–987 [DOI] [PubMed] [Google Scholar]
- Sha J, Yang M, Lei Y et al (2025) Interaction between nasal epithelial cells and tregs in allergic rhinitis responses to allergen via CCL1/CCR8. Front Immunol 16:1526081 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shengnan L, Jiayan X, Meng S et al (2025) Regulator of G protein signaling-1 facilitates ovarian cancer development by modulating NF-kB signal pathway. Sci Rep 15:864 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Siddiqui ZA, Walker A, Pirwani MM et al (2022) Allergic rhinitis: diagnosis and management. Br J Hosp Med (Lond) 83:1–9 [DOI] [PubMed] [Google Scholar]
- Subspecialty Group of Rhinology, Subspecialty Group of Rhinology et al (2022) Chinese guideline for diagnosis and treatment of allergic rhinitis (2022, revision). Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 57:106–129 [DOI] [PubMed] [Google Scholar]
- Sultonov D, Kim YH, Park H et al (2022) Intermittent hypoxia on the attenuation of induced nasal allergy and allergic asthma by MAPK signaling pathway downregulation in a mice animal model. Int J Mol Sci. 10.3390/ijms23169235 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun MY, Wang Y, Zhu J et al (2018) Critical role for non-GAP function of galphas in RGS1-mediated promotion of melanoma progression through AKT and ERK phosphorylation. Oncol Rep 39:2673–2680 [DOI] [PubMed] [Google Scholar]
- Wang J, Zhao Z, Zhang Y et al (2019a) Asthma, allergic rhinitis and eczema among parents of preschool children in relation to climate, and dampness and mold in dwellings in China. Environ Int 130:104910 [DOI] [PubMed] [Google Scholar]
- Wang Y, Liu G, Ren L et al (2019b) Long non-coding RNA TUG1 recruits miR-29c-3p from its target gene RGS1 to promote proliferation and metastasis of melanoma cells. Int J Oncol 54:1317–1326 [DOI] [PubMed] [Google Scholar]
- Wang M, She W, Yang J et al (2021) Gene expression analysis by real-time PCR in nasal brushings of adult patients with allergic rhinitis, suspected allergic rhinitis, and nonallergic rhinitis. Int Arch Allergy Immunol 182:301–310 [DOI] [PubMed] [Google Scholar]
- Wang C, Bao Y, Chen J et al (2022) Chinese guideline on allergen immunotherapy for allergic rhinitis: the 2022 update. Allergy Asthma Immunol Res 14:604–652 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang B, Jiang B, Du L et al (2023) Tumor-intrinsic RGS1 potentiates checkpoint blockade response via ATF3-IFNGR1 axis. Oncoimmunology 12:2279800 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang M, Fu L, Wang H et al (2025) Hotspots and trends in allergic rhinitis nasal mucosa studies: a bibliometric analysis (2010–2024). J Asthma Allergy 18:417–435 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu J, Bing L, Jin H et al (2009) Gene expression profiles of nasal polyps associated with allergic rhinitis. Am J Otolaryngol 30:24–32 [DOI] [PubMed] [Google Scholar]
- Wu M, Xu X, Yang C et al (2024) Regulator of G protein signaling 1 is a potential target in gastric cancer and impacts tumor-associated macrophages. Cancer Sci 115:1085–1101 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie Z, Chan EC, Druey KM (2016) R4 regulator of G protein signaling (RGS) proteins in inflammation and immunity. AAPS J 18:294–304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xue W, He W, Yan M et al (2023) Exploring shared biomarkers of myocardial infarction and Alzheimer’s disease via single-cell/nucleus sequencing and bioinformatics analysis. J Alzheimers Dis 96:705–723 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yadav E, Yadav N, Hus A et al (2020) Aquaporins in lung health and disease: emerging roles, regulation, and clinical implications. Respir Med 174:106193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang LK, Lu L, Yue J et al (2021) Activation of microglial G-protein-coupled receptor 30 protects neurons against excitotoxicity through NF-kappaB/MAPK pathways. Brain Res Bull 172:22–30 [DOI] [PubMed] [Google Scholar]
- Yang Y, Li S, Xu H (2024) BPIFA1 alleviates allergic rhinitis by regulating the NF-kappaB signaling pathway and Treg/Th17 balance. Int J Rheum Dis 27:e15372 [DOI] [PubMed] [Google Scholar]
- Zhan J, Yang J, Zheng J et al (2023) CircMIRLET7BHG, upregulated in an m6A-dependent manner, induces the nasal epithelial barrier dysfunction in allergic rhinitis pathogenesis. Int Immunopharmacol 125:111162 [DOI] [PubMed] [Google Scholar]
- Zhang Y, Zhang L (2019) Increasing prevalence of allergic rhinitis in China. Allergy Asthma Immunol Res 11:156–169 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang S, Wang H, Liu J et al (2022) RGS1 and related genes as potential targets for immunotherapy in cervical cancer: computational biology and experimental validation. J Transl Med 20:334 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang R, Zhang L, Li P et al (2023) Epithelial barrier in the nasal mucosa, related risk factors and diseases. Int Arch Allergy Immunol 184:481–501 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao W, Kong L, Wang X et al (2025) Efficacy and safety of Chinese patent medicines for allergic rhinitis based on 2020 Chinese Pharmacopoeia: a protocol for systematic review and meta-analysis of randomized controlled trials. Syst Rev 14:69 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The experimental data used to support the findings of this study are available from the corresponding author upon request.





