Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2025 Aug 7;104(11):105650. doi: 10.1016/j.psj.2025.105650

FAdV-4 induces more severe inflammatory responses compared to FAdV-8b

Qinqin Sun a,b, Xingfen Lei a, Lianshun Zhang a, Zilong Cheng c, Sidang Liu d, Qiang Fu a,b,⁎
PMCID: PMC12362113  PMID: 40803222

Abstract

Multiple infections, either single or mixed, involving pathogens such as serotype 4 fowl adenovirus (FAdV-4) and serotype 8b fowl adenovirus (FAdV-8b), have been observed in numerous laying hens in China, leading to severe liver damage. Thus, fowl adenovirus (FAdVs) is speculated to cause and inflammatory response. In this study, single infections with FAdV-4 and FAdV-8b were confirmed through RT-PCR and Enzyme-linked Immunosorbent Assay (ELISA) in specific pathogen-free (SPF) chickens exhibiting severe liver damage. Following this, the two reference strains, FAdV-4 and FAdV-8b, were inoculated into cardiomyocytes (CM) and cardiac fibroblasts (CF) to assess their immune responses. Additionally, the replication dynamics of FAdV-4 and FAdV-8b, as well as the expression levels of immune-related cytokines, were evaluated. The results demonstrated that FAdV-4 significantly enhanced viral replication in the heart, CM, and CF cells. The transcriptional levels of IL-1β, TNFα, IL-6, and IL-8 were markedly increased in cells infected with either FAdV-4 or FAdV-8b. These findings confirmed the in vitro and in vivo infection of FAdV-4 and FAdV-8b, elucidating their pathogenic mechanisms and providing new insights into the viral interactions and immune responses.

Keywords: FAdV-4, FAdV-8b, Inflammatory response

Introduction

Fowl adenovirus (FAdVs) infections lead to a range of diseases in poultry, such as hydropericardium syndrome (HPS), inclusion body hepatitis (IBH), egg drop syndrome (EDS-76), and hemorrhagic enteritis (HE) in turkeys (Hou, et al., 2023; Ruan, et al., 2018). IBH causes hemorrhagic necrosis of the liver and the formation of inclusion bodies within the nucleus, with FAdV-8b being the primary pathogen responsible (Zhao, et al., 2015). HPS, also known as “Ankara disease,” was first reported in 1987 in Ankara, Pakistan. This disease is caused by fowl adenovirus serotype 4 (FAdV-4) from group I and is marked by symptoms including capsule-like or liquid effusion, hemorrhagic necrosis within the pericardial cavity, and the development of intranuclear inclusion bodies (Hess, 2000; Yu, et al., 2018). These pathogens cause significant economic losses and affect poultry industries across Asia, Europe, Africa, Australia, and North America (Hess, 2000; Kim, et al., 2025; Yu, Wang, Chen, Niu, Dou, Yang, Tang and Diao, 2018). Although FAdV has been active for 30 years, few studies have examined the effects of its virous on Inflammatory response.

Studies have shown that hepatocyte damage is closely related to the infiltration and abnormal activation of inflammatory cytokines (Wang, et al., 2025a; Wang, et al., 2025b). Additionally, the release of inflammatory factors due to oxidative stress exacerbates the extent of liver damage (Gao, et al., 2025; Zhang, et al., 2025). Besides directly damaging the liver and heart, the virus also worsens tissue damage by inducing the production of inflammatory factors (Sun, et al., 2025; Wang, et al., 2022). Related experiments have demonstrated that cytokines such as tumor necrosis factor alpha (TNFα), interleukin-1 beta (IL-1β), and interleukin-6 (IL-6) are involved in myocardial injury or perfusion injury (Li, et al., 2016; Maass, et al., 2002). Inflammatory factors act as polypeptide glycoproteins that mediate inflammatory immune responses. TNFα, IL-1β, IL-6, and interleukin-8(IL-8) are considered important factors in proinflammatory processes(Hoffmann, et al., 2002; Kasahara, et al., 1991),However, excessive inflammation can also damage tissues(Kolb, 2022; Mony, et al., 2023).

Previously, We performed in vivo infection studies to examine and compare the pathogenic characteristics of different FAdV phenotypes, which helped uncover the distinct infective features of FAdV infections (Sun, et al., 2024). However, the exact mechanism of single infections and their impact on viral replication are still not well understood. To address this, we compared and analyzed the viral replication titers and transcription levels of immune-related factors in cells infected solely with FAdV-4 and FAdV-8b.

Materials and methods

Ethics statement

This research was carried out following the "Guidelines for Experimental Animals" provided by the Ministry of Science and Technology (Beijing, China) and was approved by the Animal Care and Use Committee of Shandong Agricultural University (approval number: SDAUA-2015-003). All chickens were handled in a humane manner in accordance with the established protocols.

Virus

The FAdV-4 and FAdV-8b strains utilized in this research were originally isolated from a liver sample of a broiler chicken during a recent HPS outbreak in China (Niu, et al., 2016). These viruses were cultured in the LMH chicken hepatocellular carcinoma cell line (ATCC CRL-2117) using DMEM/F-12 (Gibco) medium supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics (penicillin and streptomycin), and incubated at 37°C in a 5% CO2 environment. After 60 hours of incubation, both the supernatant and cells were collected, and the median tissue culture infectious dose (TCID50) of FAdV-4 and FAdV-8b in LMH cells was determined. The chicks were then inoculated with a viral dose of 10^7 TCID50 per 0.2 mL.

Isolation, culture and identification of CM and CF

Taking 11 or 12 days old SPF chicken embryos, After sterilizing the outer surface with iodine, use a pair of sterile scissors and tweezers to cut the apex into rice grains. After digested with collagenase at 4°C for 15-16 h, the digestion was terminated by adding 10% FBS in DMEM medium. After being filtered through a sterile cell strainer, the cells were resuspended and centrifuged at 800 rpm for 10 minutes at 4°C. The supernatant was discarded, and the pellet was resuspended evenly. The cells were then placed in a 37°C, 5% CO2 cell incubator for 50 minutes to 1 hour for differential incubation. The adherent was CF and cultured in DMEM high glucose medium containing 10% FBS and 1% double antibody. After the cell suspension was centrifuged again, the pellet was resuspended in DMEM medium containing 1% double antibody, 0.1 mmol/L 5-BrdU, and 10% FBS. The cells were sub-packaged in a 24-well cell culture plate for 1 to 2 days to experiment.

Animal trial

A total of ninety 6-day-old SPF chicks were randomly divided into three groups: the FAdV-4 infection group, the FAdV-8b infection group, and the control group. The chicks were housed in negative pressure isolators with ad libitum access to water and feed. One day after feeding, the chicks in the infection groups were given subcutaneous injections of 0.2 mL of a virus solution containing 10^7 TCID50 per chick at the neck. To fully evaluate the clinical pathogenic characteristics of FAdV-4 and FAdV-8b, assessments were carried out on days 1, 3, 5, 7, 9, 11, and 14 post-infection. Blood samples were collected from the wing vein, and necropsies were conducted on three randomly selected chicks from each group.

Viral DNA detection in tissues

At 1, 3, 5, 7, and 14 days post-infection (dpi), three chickens from each group (control, FAdV-4, and FAdV-8b) were selected for qPCR analysis to assess the distribution of the virus in tissues. Total DNA was extracted from 200 μL of homogenized tissue samples using Tris-phenol (Solarbio, Beijing, China) according to the manufacturer's instructions. The absolute quantity of FAdV-4 genomic material in the tissues was determined using specific primers: forward primer, 5′–GACGGCGGCGCAGGTGACGAAGATT–3′, and reverse primer, 5′–TGAGACTTGGCGAAGCGACCGAGCA–3′. The virions were detected as previously described (Niu, et al., 2017).

Hematoxylin-eosin staining

After fixation overnight in 10% neutral-buffered formalin, the sample underwent dehydration, was embedded in paraffin, and then sectioned into 4-μm slices. These sections were subsequently stained with hematoxylin and eosin. Additionally, a portion of the section was utilized for immunohistochemical staining (Niu, Sun, Zhang, Sun, Liu, Xiao, Shang and Liu, 2017).

Immune organ index determination

The immune organ index was determined on days 1, 3, 5, 7, 9, 11, and 14 post-infection. Three chickens were randomly selected from each group before feeding. They were carefully placed on a balance and weighed to avoid errors due to air circulation. After anatomical observation of various tissue and organ lesions, the bursa, thymus, and spleen were sequentially removed. The weight of each organ was measured and used to calculate its index using the formula: organ index = (organ weight / body weight) × 100%.

Tissue RNA extraction and quantitative real-time PCR

Total RNA was extracted using TRIzol, reverse-transcribed into cDNA, and then analyzed by real-time PCR with SYBR Green on a Light Cycler 480 system. The primers used for real-time PCR were as follows:

  • (1) TNFα: F: 5ʹ-TACTCAGGACAGCCTATGCCAACA-3ʹ, R: 5ʹ-CCTCCGCAGCAGTTTGGTCAT-3ʹ;

  • (2) IL-1β: F: 5ʹ-CAGAAGAAGCCTCGCCTGGATTC-3ʹ, R: 5ʹ-CCTCCGCAGCAGTTTGGTCAT-3ʹ;

  • (3) IL-6: F: 5ʹ-CCAGAAATCCCTCCTCGCCAATC-3ʹ, R: 5ʹ-GCCCTCACGGTCTTCTCCATAAAC-3ʹ;

  • (4) IL-8: F: 5ʹ-GCTCTGTCGCAAGGTAGGA-3ʹ, R: 5ʹ-TGGCGTCAGCTTCACATCT-3.

Statistical analysis

The experiments were conducted independently at least three times (n ≥ 3), and the results shown represent the mean ± standard deviation. Statistical analyses were performed using either an unpaired Student’s t-test or Spearman rank correlation. P-values were computed using GraphPad Prism 8 software, with significance denoted by asterisks as follows: *P < 0.05, **P < 0.01,***P < 0.005,****P < 0.0001.

Results

FAdV-4 causes severe damage to the immune organs

To systematically understand the immunopathological changes caused by FAdV-4 and FAdV-8b, we infected SPF chickens with FAdV-4 and FAdV-8b respectively, pathological observations were conducted on the thymus, spleen, and bursa of Fabricius. FAdV-4 infection induced varying degrees of lymphocyte necrosis and degeneration in the bursa of Fabricius, thymus, and spleen, accompanied by severe edema and congestion. In contrast, FAdV-8b infection in SPF chickens results in milder induction of these symptoms(Fig. 1A,B,D,E,G,H). Compared with the control group, FAdV-8b also induced damage to the thymus, spleen, and bursa of Fabricius.

Fig. 1.

Fig 1

Open in a new tab

Pathological manifestations of the bursa, thymus, and spleen: A, B, C represent the bursa (HE × 200); D, E, F show the thymus (HE × 200); G, H, I depict the spleen (HE × 200).

After infected with FAdV-4 and FAdV-8b, the Index of immune-related organs showed significant differences

After infected SPF chickens with FAdV serotypes, the immune organ indexes were determined as follows: From the 1st to the 7th day post-infection, the thymus and bursa organ indexes in both FAdV-4 and FAdV-8b infected groups were significantly lower than those in the control group. From the 9th to the 21st day, the organ indexes of these two organs in the infected groups showed an increasing trend compared to the control group, with FAdV-4 showing a significantly higher trend than FAdV-8b (Fig. 2A, B). During the infection test, the spleen organ index in the FAdV-8b infected group differed significantly from the control group only on the 7th day. In the FAdV-4 infected group, the spleen organ index increased after the 5th day of infection, which was significantly different from the control group (Fig. 2C).

Fig. 2.

Fig 2

Open in a new tab

Immune organ index test: A represents the thymus; B represents the bursa of Fabricius; C represents the spleen. (Red * indicates the difference between FAdV-8b and control, Green * indicates the difference between FAdV-4 and control).

FAdV-4 and FAdV-8b induce inflammation in the liver and LMH cells

To investigate the inflammatory responses induced by FAdV-4 and FAdV-8b viruses in the livers of SPF chickens, mRNA expression levels of four inflammatory factors (IL-1β, TNFα, IL-6, and IL-8) were assessed using qPCR. Significant differences were observed between the virus-infected groups and the control group throughout the infection process. The expression of IL-1β mRNA in the FAdV-8b infected group was higher than that in the FAdV-4 group, reaching its peak on the 3rd day post-infection. Subsequently, IL-1β mRNA expression gradually decreased over time, with significant differences observed (Fig. 3A). On the 5th day, the expression level of TNFα mRNA in the FAdV-8b infected group was higher than that in the FAdV-4 group, showing significant up-regulation from the first to the fifth day post-infection. Significant differences in TNFα mRNA expression between the FAdV-8b and FAdV-4 groups were also observed from the 5th to the 7th day post-infection (Fig. 3B). The mRNA expression levels of IL-6 and IL-8 were higher in the FAdV-4 infected group compared to FAdV-8b throughout the entire infection process, peaking on the 3rd day post-infection. The qPCR results indicated that the mRNA expression levels of IL-6 and IL-8 were initially up-regulated and subsequently decreased after infection with both viruses (Fig. 3C, D).

Fig. 3.

Fig 3

Open in a new tab

mRNA levels of inflammatory factors in the liver after infection of chicks with FAdV-4 and FAdV-8b, respectively. A: IL-1β; B: TNFα; C: IL-6; D: IL-8. The mean mRNA expression, normalized to the housekeeping gene Actin, is presented as the mean ± SD, with n = 3 biological replicates. *P < 0.05, **P < 0.01, ***P < 0.005.

To investigate the mechanism of inflammasome activation induced by FAdV-4 and FAdV-8b, we analyzed the inflammatory responses at the gene level. After infecting LMH cell lines with FAdV-4 and FAdV-8b in vitro, gene expression of inflammatory factors was evaluated, revealing significant differences between the infected and control groups. Within 24-48 hours post-infection, the FAdV-8b infected group exhibited higher levels of IL-1β and TNFα compared to the FAdV-4 infected group (Fig. 4A, B). However, as the infection progressed, the FAdV-4 infected group showed elevated expression of IL-6 and IL-8 mRNA compared to the FAdV-8b group (Fig. 4C, D). These findings from the in vitro infection assay were consistent with those observed in vivo, though the inflammatory factor expression in LMH cells was generally lower than in the liver.

Fig. 4.

Fig 4

Open in a new tab

mRNA levels of inflammatory factors in LMH cells after infection with FAdV-4 and FAdV-8b, respectively. A: IL-1β; B: TNFα; C: IL-6; D: IL-8. (Green * denotes the difference between FAdV-4 and the control, red * highlights the difference between FAdV-8b and the control, and black * represents the difference between FAdV-4 and FAdV-8b.).

FAdV-8b induces a weaker inflammatory response compared to FAdV-4

FAdV-4 induced heart gelatinous exudate, whereas FAdV-8b elicited minimal cardiac response. Therefore, SPF chicks were separately infected with these two viruses for 1-14 days, and mRNA levels of four inflammatory factors (IL-1β, TNFα, IL-6, and IL-8) in the heart were assessed by q-PCR. Significant differences were observed between the infected groups and controls. Specifically, compared to FAdV-8b infection, FAdV-4 infection resulted in higher mRNA expression levels of these factors in the heart. In the FAdV-4 infected group, mRNA expression of IL-1β and TNFα peaked significantly on the 3rd day post-infection (Fig. 5A, B). Conversely, in the FAdV-8b infected group, IL-8 and IL-6 mRNA levels were consistently upregulated throughout the infection period. IL-8 and IL-6 mRNA levels began increasing from the 1st day post-FAdV-4 infection and peaked on the 3rd day (Fig. 5C, D). Overall, the cardiac inflammatory response was weaker in the FAdV-8b infected group compared to FAdV-4.

Fig. 5.

Fig 5

Open in a new tab

The expression levels of inflammation-related genes in the heart were measured at 1, 3, 5, 7, 9, 11, and 14 days following FAdV-4 and FAdV-8b infection. A: IL-1β; B: TNFα; C: IL-6; D: IL-8. The results are presented as mean mRNA expression, normalized to the housekeeping gene Actin, with the data shown as mean ± SD, based on n = 3 biological replicates. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.005. (Green * shows the difference between FAdV-4 and control, red * indicates the difference between FAdV-8b and control, and black * reflects the difference between FAdV-4 and FAdV-8b).

Finally, after infecting primary cardiomyocytes (CM) with FAdV-4 and FAdV-8b for 12, 24, 36, and 48 hours, we measured the mRNA expression levels of the four inflammatory factors (IL-1β, TNFα, IL-6, and IL-8). The results showed no significant differences in the mRNA levels of these factors between the FAdV-4 and FAdV-8b infected groups. Additionally, when compared to the control group, no significant changes in inflammatory factor mRNA expression were observed in CM infected with either of the viruses (Fig. 6A-D).

Fig. 6.

Fig 6

Open in a new tab

Following infection of primary myocardial cells with FAdV-4 and FAdV-8b, the mRNA expression of key inflammatory factors was measured, including IL-1β (A), TNFα (B), IL-6 (C), and IL-8 (D). Results are presented as mean ± SD, with normalization to the housekeeping gene Actin, and n = 3 biological replicates. Statistical significance is marked as *P < 0.05. (Red * denotes differences between FAdV-8b and the control, while black * indicates differences between FAdV-4 and FAdV-8b).

Detection of cytokine levels induced by FAdV-4 and FAdV-8b infectionsTo confirm that FAdV-4 and FAdV-8b induce inflammasome activation, serum samples were collected at different time points after infection with FAdV-4 and FAdV-8b in SPF chicks, and the levels of mature IL-1β and mature TNFα were measured. Both cytokines showed increased levels following infection with FAdV-4 and FAdV-8b (Fig. 7A, B). The secretion of IL-1β was assessed using enzyme-linked immunosorbent assay (ELISA), revealing similar increases in both the FAdV-4 and FAdV-8b infection groups. To further explore whether FAdV-4 and FAdV-8b trigger inflammasome activation during viral infection, primary infections with wild-type FAdV-4 and FAdV-8b were established in LMH cells. After infection, supernatants were analyzed for inflammasome activation. Levels of mature IL-1β were increased in both serum and supernatants from FAdV-4 and FAdV-8b infected cells compared to those from WT cells (Fig. 7G, H). These results confirm that FAdV-4 and FAdV-8b induce the activation of inflammasomes during viral infection.

Fig. 7.

Fig 7

Open in a new tab

Cytokine levels were detected using enzyme-linked immunosorbent assay (ELISA) following FAdV-4 and FAdV-8b infection. A, B: Serum; C, D: LMH cells; E, F: CM cells; G, H: CF cells. Data are expressed as the mean ± SD, with n = 3 biological replicates. Statistical significance is indicated as *P < 0.05, **P < 0.01.(Green* indicates the difference between FAdV-4 and control, red* indicates the difference between FAdV-8b and control).

To confirm that FAdV-4 and FAdV-8b induce inflammasome activation, CM and CF cells were infected with WT or viruses. And the levels of secreted IL-1β in the CM supernatant were greatly induced in the presence of FAdV-4 and FAdV-8b, enzyme-linked immunosorbent assay (ELISA) further confirmed that the secretion of IL-1β from CM cells was induced by viral infection (Fig. 7E). In addition, FAdV-4 and FAdV-8b induced inflammasome-related genes (IL-1β) but not the expression of interferon and interferon-stimulated genes (TNFα) in CM and CF cells (Fig. 7E,F,G and H). These results suggest that FAdV-4 and FAdV-8b suppress HSV-1-induced inflammasome activation and antiviral innate immune responses.

Proliferation of two viruses in heart, CM and CF

Having previously assessed the proliferation of FAdV-4 and FAdV-8b in liver cells(Sun, Li, Huang, Li, Fu and Liu, 2024), we proceeded to investigate their proliferation in SPF chicks following respective infections. Quantitative PCR (q-PCR) was employed to monitor viral proliferation in the heart over time. It was observed that the proliferation rate of FAdV-4 accelerated, reaching its peak on the 5th day post-infection, showing significant disparity compared to FAdV-8b (Fig. 8A). Subsequently, q-PCR was utilized to examine the proliferation characteristics of both viruses in CM and CF. Results indicated detectable levels of both viruses in CM at 0, 6, 12, 24, 36, 48, and 72 hours post-infection, albeit with modest replication efficiency. Significantly divergent proliferation patterns were noted between FAdV-4 and FAdV-8b throughout the infection process, with FAdV-4 demonstrating superior replication efficiency (Fig. 8B). Conversely, minimal proliferation was observed in CF for both FAdV-4 and FAdV-8b, with noticeable differences between the two (Fig. 8C).

Fig. 8.

Fig 8

Open in a new tab

The viral replication dynamics of FAdV-4 and FAdV-8b in cardiac-related cells were analyzed. A: In SPF chicks infected with FAdV-4 and FAdV-8b, viral replication in the heart was monitored at 1, 3, 5, 7, 9, 11, and 14 days post-infection. B: For CM and C: CF cells infected with FAdV-4 and FAdV-8b, viral replication was measured at 12, 24, 36, 48, and 60 hours post-infection. Results are expressed as mean ± SD. *, P < 0.01; **, P < 0.05; ***, P < 0.001.

Discussion

To explore the roles of FAdV-4 and FAdV-8b, we investigated the expression of inflammatory factors of these two viruses through in vivo and in vitro experiments. We have shown that FAdV-4 causes severe damage to immune organs and induces inflammation in the liver and LMH cells. As a consequence, we observed that the pathogenicity of the two viruses to heart and CM infections is significantly different and FAdV-4 has a strong pathogenic ability to heart and CM.

Through in vivo experiments and in vitro infection of LMH cells, it can be seen that both viruses proliferated in the liver and LMH cells. However, the proliferation and replication of the FAdV-4 isolate was stronger, indicating that the liver is indeed the target organ of FAdV-I(Sun, Li, Huang, Li, Fu and Liu, 2024). Another study located viruses in the liver by indirect immunofluorescence (Wang, et al., 2021). Then the liver is not the first place to reach the virus after entering the body or there is a receptor suitable for FAdV in the liver, and this problem needs further study. At the same time, it can be seen that the proliferation of the two viruses in the heart, CM and CF, respectively, the proliferated efficiency was not very good, FAdV-8b hardly proliferated. This situation can be explained by the fact that FAdV-4 produced pericardial effusion or that there is residual pericardial effusion during sampling, so viruses can be detected in heart tissue. Through previous studies, some studies found that there is a significant difference (De Luca, et al., 2022; Niu, et al., 2019; Wang, et al., 2023). This also explains the inability of both viruses to proliferate in CM and CF in vitro. In cardiac tissue, CM are parenchymal cells that play a major role. CF are also important tissue components of the heart (Kajstura, et al., 2010; Savi, et al., 2016), which are distributed throughout the heart muscle fibers and are capable of producing and secreting the viral content in the pericardial effusion and the viral content in the heart. Since neither of these viruses, especially FAdV-4, can proliferate well on cardiomyocytes, this suggests that the heart is not the primary target organ of FAdV.

To compare the similarities and differences between the two serotypes in the inflammatory response of the liver, four inflammatory factors (IL-1β, TNFα, IL-6, and IL-8) were tested for expression by in vivo and in vitro assays. The mRNA expression levels of IL-1β and TNFα were relatively high after FAdV-8b infection. IL-1β and TNFα act as pro-inflammatory cytokines, and their appearance can cascade cytokines. Test data indicate that hepatocyte injury is closely related to the infiltration and abnormal activation of inflammatory cytokines (Pasare, et al., 2025; Usatiuc, et al., 2025). The four cytokines in the FAdV-4 infected group were up-regulated at the peak of the disease. As for the difference in inflammatory response caused by the two viruses, further research is needed. The study found that the inflammatory response of the two viruses in the heart and CM is not strong, but it can be seen that FAdV-4 caused the up-regulation of cytokine mRNA expression more than FAdV-8b. IL-1β is up-regulated by the release of cells and then causes HLAM-1 and ICAM-1 expression to accumulate on the surface of adhesion molecules, causing tissue damage(Duan, et al., 2022{Zhang, 2023 #656{Zhang, 2023 #656). IL-6 enhances the adhesion of cardiomyocytes to neutrophils, aggravates the damage of cardiomyocytes, and also induces the production of plasma fibrin{Ricci, 2023 #657. These four inflammatory factors are associated with myocardial damage, and the other side supports FAdV-4, which causes pericardial effusion.

In conclusion, we reveal that the four inflammatory factors, IL-1β, TNFα, IL-6 and IL-8, can cause myocardial injury, and FAdV-4 causes a strong inflammatory response, which verifies from the side that FAdV-4 can cause pericardial effusion. The infectious pathogenicity of FAdV-4 and FAdV-8b to the heart and CM respectively is significantly different. FAdV-4 has a strong pathogenic ability to the heart and CM. Our studies not only reveal the importance of FAdV-4 and FAdV-8b in causing of pericardial cavity effusion, but also provide a promising clue to develop control for HPS and IBH.

CRediT authorship contribution statement

Qinqin Sun: Conceptualization, Data curation, Formal analysis, Funding acquisition, Validation, Visualization, Writing – original draft, Writing – review & editing. Xingfen Lei: Conceptualization, Data curation. Lianshun Zhang: Investigation, Methodology, Project administration, Software. Zilong Cheng: Data curation, Project administration, Resources, Software. Sidang Liu: Investigation, Methodology, Resources, Validation, Visualization, Writing – original draft, Writing – review & editing. Qiang Fu: Funding acquisition, Visualization, Writing – original draft, Writing – review & editing.

Disclosures

The authors declare that no commercial or financial relationships exist that could be interpreted as a potential conflict of interest in the conduct of this research.

Acknowledgments

The authors apologize to those whose work was not cited due to limited space and time. This work was supported by the National Natural Science Foundation of China [grant numbers 32402837, 32473024], National Natural Science Foundation of Guangdong Province [grant number 2023A1515110264]; Exploring and Overturning Innovation Program of Jiangsu Academy of Agricultural Sciences, [grant number ZX(21)1218]; Project of Department of Education of Guangdong Province [grant number 2022ZDJS036]; Project of Science and Technology of Guangdong Province [grant number KTP20240768].

References

  1. De Luca C., Schachner A., Heidl S., Hess M., Liebhart D., Mitra T. Local cellular immune response plays a key role in protecting chickens against hepatitis-hydropericardium syndrome (HHS) by vaccination with a recombinant fowl adenovirus (FAdV) chimeric fiber protein. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.1026233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Duan Y., Pan X., Luo J., Xiao X., Li J., Bestman P.L., Luo M. Association of inflammatory cytokines with non-alcoholic fatty liver disease. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.880298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Gao S., Li F., Wu D., Ma R., Li Y., Zhang Y., Han Z., He Q., Li J., Liu C., Zeng J., Zhang L., Dai Q., Lu Y. Poly(Ethylene Glycol)-modified catalase blocking reactive oxygen species for the treatment of hepatic ischemia. Macromol. Rapid. Commun. 2025 doi: 10.1002/marc.202500367. [DOI] [PubMed] [Google Scholar]
  4. Hess M. Detection and differentiation of avian adenoviruses: a review. Avian Pathol. 2000;29:195–206. doi: 10.1080/03079450050045440. [DOI] [PubMed] [Google Scholar]
  5. Hoffmann E., Dittrich-Breiholz O., Holtmann H., Kracht M. Multiple control of interleukin-8 gene expression. J. Leukoc. Biol. 2002;72:847–855. [PubMed] [Google Scholar]
  6. Hou L., Wang W., Chi Z., Zhang Y., Zou Z., Zhao P. FAdV-4 promotes expression of multiple cytokines and inhibits the proliferation of aHEV in LMH cells. Viruses. 2023;15:2072. doi: 10.3390/v15102072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kajstura J., Urbanek K., Perl S., Hosoda T., Zheng H., Ogórek B., Ferreira-Martins J., Goichberg P., Rondon-Clavo C., Sanada F., D'Amario D., Rota M., Del Monte F., Orlic D., Tisdale J., Leri A., Anversa P. Cardiomyogenesis in the adult human heart. Circ. Res. 2010;107:305–315. doi: 10.1161/circresaha.110.223024. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  8. Kasahara T., Mukaida N., Yamashita K., Yagisawa H., Akahoshi T., Matsushima K. IL-1 and TNF-alpha induction of IL-8 and monocyte chemotactic and activating factor (MCAF) mRNA expression in a human astrocytoma cell line. Immunology. 1991;74:60–67. [PMC free article] [PubMed] [Google Scholar]
  9. Kim H.R., Song H.S., Jang I., Thai T.N., Kim H.S., Kwon Y.K., Her M. Nationwide surveillance of fowl Adenovirus infection and coinfection with other diseases on slaughter broiler in South Korea. Transbound. Emerg. Dis. 2025;2025 doi: 10.1155/tbed/9353432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kolb H. Obese visceral fat tissue inflammation: from protective to detrimental? BMC. Med. 2022;20:494. doi: 10.1186/s12916-022-02672-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Li Y., Li J., Hou Z., Yu Y., Yu B. KLF5 overexpression attenuates cardiomyocyte inflammation induced by oxygen-glucose deprivation/reperfusion through the pparγ/PGC-1α/TNF-α signaling pathway. Biomed. Pharmac. Other. 2016;84:940–946. doi: 10.1016/j.biopha.2016.09.100. [DOI] [PubMed] [Google Scholar]
  12. Maass D.L., White J., Horton J.W. IL-1beta and IL-6 act synergistically with TNF-alpha to alter cardiac contractile function after burn trauma. Shock. 2002;18:360–366. doi: 10.1097/00024382-200210000-00012. [DOI] [PubMed] [Google Scholar]
  13. Mony M.P., Harmon K.A., Hess R., Dorafshar A.H., Shafikhani S.H. An updated review of hypertrophic scarring. Cells. 2023;12:678. doi: 10.3390/cells12050678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Niu Y., Sun Q., Liu X., Liu S. Mechanism of fowl adenovirus serotype 4-induced heart damage and formation of pericardial effusion. Poult. Sci. 2019;98:1134–1145. doi: 10.3382/ps/pey485. [DOI] [PubMed] [Google Scholar]
  15. Niu Y., Sun Q., Zhang G., Sun W., Liu X., Xiao Y., Shang Y., Liu S. Pathogenicity and immunosuppressive potential of fowl adenovirus in specific pathogen free chickens. Poult. Sci. 2017;96:3885–3892. doi: 10.3382/ps/pex206. [DOI] [PubMed] [Google Scholar]
  16. Niu Y.J., Sun W., Zhang G.H., Qu Y.J., Wang P.F., Sun H.L., Xiao Y.H., Liu S.D. Hydropericardium syndrome outbreak caused by fowl adenovirus serotype 4 in China in 2015. J. Gen. Virol. 2016;97:2684–2690. doi: 10.1099/jgv.0.000567. [DOI] [PubMed] [Google Scholar]
  17. Pasare M.A., Prepeliuc C.S., Grigoriu M.G., Miftode I.L., Miftode E.G. Biomarkers as beacons: illuminating sepsis-associated hepato-renal injury. Int. J. Mol. Sci. 2025;26:4825. doi: 10.3390/ijms26104825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ruan S., Zhao J., He Z., Yang H., Zhang G. Analysis of pathogenicity and immune efficacy of fowl adenovirus serotype 4 isolates. Poult. Sci. 2018;97:2647–2653. doi: 10.3382/ps/pey113. [DOI] [PubMed] [Google Scholar]
  19. Savi M., Bocchi L., Sala R., Frati C., Lagrasta C., Madeddu D., Falco A., Pollino S., Bresciani L., Miragoli M., Zaniboni M., Quaini F., Del Rio D., Stilli D. Parenchymal and stromal cells contribute to pro-inflammatory myocardial environment at early stages of diabetes: protective role of resveratrol. Nutrients. 2016;8:729. doi: 10.3390/nu8110729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Sun J., Cao X., Li Y., Yu K., Cong Y., Pan Q., Yin Y., Wang J. Oxidative stress in the liver of chicken during fowl adenovirus serotype 4 infection. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Sun Q., Li Y., Huang Y., Li S., Fu Q., Liu S. FAdV-4 can cause more noticeable clinical symptoms compared to FAdV-8b after infecting specific pathogen free chickens. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.104006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Usatiuc L.O., Pop R.M., Adrian S., Pârvu M., Țicolea M., Uifălean A., Vălean D., Gavrilaș L.I., Csilla-Enikő S., Leopold L.F., Ranga F., Cătoi F.A., Pârvu A.E. Multitargeted effects of Plantago ovata ethanol extract in experimental rat streptozotocin-induced diabetes mellitus and letrozole-induced polycystic ovary syndrome. Int. J. Mol. Sci. 2025;26:4712. doi: 10.3390/ijms26104712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wang B., Guo H., Qiao Q., Huang Q., Yang P., Song C., Song M., Wang Z., Li Y., Miao Y., Zhao J. Hypervirulent FAdV-4 infection induces activation of the NLRP3 inflammasome in chicken macrophages. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wang C., Dong D., Zhao N., Zhao S., Hua J., Bai C., Cui R., Zhao T., Ji N., Li H., Liu Y., Li Y. Hepatocyte-specific C-C motif chemokine ligand 9 signaling promotes liver fibrosis progression in mice. Hepatology. 2025 doi: 10.1097/hep.0000000000001393. [DOI] [PubMed] [Google Scholar]
  25. Wang L., Zheng L., Jiang S., Li X., Lu C., Zhang L., Ren W., Li C., Tian X., Li F., Yan M. Isolation, identification and genetic characterization analysis of a fowl aviadenovirus serotype 4 strain from Tianjin, China. Infect. Genet. Evol. 2021;96 doi: 10.1016/j.meegid.2021.105078. [DOI] [PubMed] [Google Scholar]
  26. Wang T., Wang L., Li W., Hou X., Chang W., Wen B., Han S., Chen Y., Qi X., Wang J. Fowl adenovirus serotype 4 enters leghorn male hepatocellular cells via the clathrin-mediated endocytosis pathway. Vet. Res. 2023;54:24. doi: 10.1186/s13567-023-01155-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wang X., Ling W., Zhu Y., Ji C., An X., Qi Y., Li S., Zhang C., Tong R., Jiang D., Kang B. Spermidine alleviates copper-induced oxidative stress, inflammation and cuproptosis in the liver. FASEB J. 2025;39 doi: 10.1096/fj.202403002R. [DOI] [PubMed] [Google Scholar]
  28. Yu X., Wang Z., Chen H., Niu X., Dou Y., Yang J., Tang Y., Diao Y. Serological and pathogenic analyses of fowl Adenovirus serotype 4 (FAdV-4) strain in Muscovy ducks. Front. Microbiol. 2018;9:1163. doi: 10.3389/fmicb.2018.01163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhang J., Li Y., Wang Y., Li Z., Li X., Bao H., Li J., Zhou D. Transcriptome sequencing and metabolite analysis revealed the single and combined effects of microplastics and di-(2-ethylhexyl) phthalate on mouse liver. Int. J. Mol. Sci. 2025;26:4943. doi: 10.3390/ijms26104943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhao J., Zhong Q., Zhao Y., Hu Y.X., Zhang G.Z. Pathogenicity and complete genome characterization of fowl adenoviruses isolated from chickens associated with inclusion body Hepatitis and hydropericardium syndrome in China. PLoS. One. 2015;10 doi: 10.1371/journal.pone.0133073. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES