Prevalence and molecular basis of resistance to echinocandins among clinical Candida glabrata isolates in Guangdong province, China

Abstract

Background

Infections caused by Candida glabrata have raised increasing concerns, particularly due to the increasing resistance to echinocandins.

Objectives

This study investigated echinocandins susceptibility trends in C. glabrata isolates and explored the mechanisms driving resistance.

Methods

We analyzed 418 strains of C. glabrata derived from hospitalized patients. Phenotypic resistance was assessed, and genotypic analysis was performed to identify mutations in the hotspot-1 and hotspot-2 regions of the FKS1 and FKS2 genes. Additionally, genotyping was conducted using multilocus sequence typing (MLST).

Results

The resistance rates to caspofungin, anidulafungin, and micafungin were 5.0%, 3.8%, and 4.0%, respectively, while fluconazole resistance was observed in 9.6% of the strains. Notably, 1.0% of the strains demonstrated resistance to both fluconazole and echinocandins. Mutations in the FKS genes were identified in 11 strains, predominantly in the FKS2-HS1 region. The most prevalent mutation was the F659 deletion (54.54%, 6/11), followed by S663F (18.18%, 2/11). Other mutations, including F659S, F659Y, and S663P, were also detected. These 11 mutated strains were classified into six distinct sequence types (STs), with ST208 being the most prevalent.

Conclusion

The resistance rate of C. glabrata to echinocandins has been increasing annually in Guangdong province. Echinocandin resistance is associated with mutations in the FKS2 gene.

Introduction

Candida species, particularly Candida glabrata (newly renamed as Nakaseomyces glabratus), have become an important cause of hospital-acquired infections. Over the past decades, the incidence of C. glabrata infections has risen progressively [1], posing a growing threat to patient safety. This yeast is particularly concerning due to its association with high mortality rates, especially among vulnerable patient populations, such as immunocompromised elderly individuals undergoing major surgery and neutropenic patients [2]. Invasive C. glabrata infections have a mortality rate of approximately 50% [3].

C. glabrata exhibits intrinsic reduced susceptibility to azole antifungals such as fluconazole [4], prompting a paradigm shift in clinical management. Consequently, echinocandins have emerged as first-line agents for C. glabrata infections [5, 6]. Their mechanism involves targeted inhibition of 1,3-β-D-glucan synthase, disrupting fungal cell wall integrity, ultimately inducing osmotic lysis and fungistatic activity.

The widespread use of echinocandins has shown a significant correlation with the emergence of drug resistance, particularly in C. glabrata [7]. Prior exposure to echinocandins is identified as the predominant risk factor for resistance development, as reported in the majority of clinical cases [8]. Molecular investigations demonstrate that clinical resistance in C. glabrata is strongly associated with specific amino acid substitutions in the hotspot regions of FKS1 and FKS2 genes, which encode subunits of the 1,3-β-D-glucan synthase complex [9–11]. These mutations modify the structure of the enzyme complex, thereby significantly diminishing its susceptibility to echinocandin inhibition.

Given the limited availability of antifungal treatment options and the high mortality rates associated with these infections [12, 13], the rising prevalence of echinocandins resistant C. glabrata strains highlights an emerging challenge in clinical antifungal management. In this context, a comprehensive understanding of local antifungal susceptibility patterns is crucial for optimizing patient management, particularly in the treatment of critically infected individuals. Regional surveillance data on antifungal resistance serve as a foundation for developing targeted therapeutic strategies, thereby improving clinical outcomes for patients with refractory infections.

Materials and methods

Isolates and identification

Between January 2020 and December 2023, a total of 418 unique C. glabrata isolates were collected from diverse clinical samples, including blood, urine, drainage fluid, abdominal fluid, and central venous catheter specimens. Isolates from the same patient were included only once to avoid duplication. All isolates were identified as C. glabrata by matrix-assisted laser desorption lonzation time of flight mass spectrometry (MALDI-TOF MS) (BioMérieux, France) with the IVD knowledge base V3.2 according to the manufacturer’s instructions.

Patient demographic and clinical data, such as gender, age, ward, underlying medical conditions, antifungal treatments, and dosages, were retrieved from the Hospital Information System. The study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University (Ethics Number: 2021 K-40).

Susceptibility testing

The minimum inhibitory concentrations (MICs) of various antifungal agents, including fluconazole (FLU), itraconazole (IZ), voriconazole (VOR), micafungin (MIF), caspofungin (CAS), anidulafungin (ANI), amphotericin B (AMB), 5-flucytosine (5-FC), and posaconazole (POS), were determined using the Sensititre YeastOne™ YO10 methodology (Thermo Scientific, Cleveland, OH, USA). Following a 24-hour incubation period at 35 °C, the MICs were observed visuall. The interpretation of antifungal susceptibility was guided by the Clinical Laboratory Standards Institute (CLSI) supplement M27M44S Ed3 [14]. Quality control was performed with each test run using C. parapsilosis ATCC22019 and C. krusei ATCC6258.

Clinical isolates of C. glabrata that exhibited non-susceptible to any of the echinocandins (micafungin, anidulafungin and caspofungin) were retested using the broth microdilution method following CLSI standards. In the event of any discrepancies during re-evaluation, the results obtained from the CLSI broth microdilution method will be considered definitive.

Sequencing of resistance-associated mutations

Clinical isolates of C. glabrata that exhibited non-susceptible to any of the echinocandins (micafungin, anidulafungin and caspofungin) were selected for sequencing and analysis of the FKS genes. The definition of non-susceptibility (classified as intermediate or resistant according to CLSI standards) is: MIC ≥ 0.25 µg/ml for caspofungin, ≥ 0.12 µg/ml for micafungin, and ≥ 0.25 µg/ml for anidulafungin. Genomic DNA was extracted using the Yeast Genomic DNA Rapid Extraction Kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions.

Polymerase chain reaction (PCR) and sequencing of the FKS genes’ hotspot regions (HS1 and HS2 of FKS1, and HS1 and HS2 of FKS2) were carried out with primers as previously detailed [9]. The PCR products were subjected to Sanger sequencing (Sangon Biotech, China). Subsequent sequence assembly, alignment, and comparison with the reference sequences of the FKS1 gene (NCBI accession number: HM366440.1) and the FKS2 gene (NCBI accession number: HM366442.1) from the C. glabrata strain ATCC 90,030 were conducted using Mega 7.0 software. Primer details are detailed in Table 1.

Table 1.

List of primers used for PCR and sequencing of FKS genes

FKS gene	Hotspot	Primer	Sequence (5’−3’)	Annealing temperature
FKS1	HS1	Forward	GTTGCAGTCGCTACATTGCT	59.1℃
		Reverse	GTCAACTGGCAATGGTTCTG	59.1℃
		Seq (Forward)	ACGTCGCTTCTCAAACCTTC
	HS2	Forward	CGTGGTGGTCGTATTAAGCA	59.6℃
		Reverse	CAAGAAGAAGTCTTCCCAGG	56.5℃
		Seq (Forward)	GGTGCTGGTATGGGTGAA
FKS2	HS1	Forward	ATGCTGTAGCAGCTGTGACA	58.2℃
		Reverse	CAACTGGTAATGGTTCTGGC	58.1℃
		Seq (Forward)	TCTCAGACTTTCACCGCATC
	HS2	Forward	GATTGGTGCAGGTATGGG	57.2℃
		Reverse	GCTCTGTTAGCATCACCTGC	58.6℃
		Seq (Forward)	GCGCATCCTGGTTTCCAT

Genotyping by MLST

Multilocus sequence typing (MLST) analysis was performed according to the methodology described in a previous study [15]. The MLST scheme included six loci: FKS, LEU2, NMT1, TRP1, UGP1, and URA3. For each loci, sequences were obtained in both forward and reverse orientations using the primers that were also employed in the PCR amplifications. The sequence types (STs) were determined by consulting the MLST database available on the sequence-typing website (https://pubmlst.org/organisms/candida-glabrata). Phylogenetic analysis of the MLST data was conducted using the unweighted pair group method with arithmetic mean (UPGMA) clustering and the minimum spanning tree algorithm in MEGA 7.0 software, with bootstrap values calculated based on 1000 replicates.

Results

Demographic and clinical characteristics

Among the 418 patients, the median age was 60.0 years (range: 1-103 years). The majority of patients were admitted to the ICU (34.7%), followed by the medical ward. The female-to-male ratio was notably high at 2.03:1. The most common source of clinical specimens was urine (n = 254, 60.8%), followed by drainage fluid (n = 83, 19.9%), secretions (n = 26, 6.2%), and blood (n = 18, 4.3%). Detailed demographic and clinical characteristics are summarized in Table 2.

Table 2.

Demographic and clinical characteristics of 418 patients

Variables	Number (cases)	Percentage (%)
Female	280	67.0
Male	138	33.0
Department Distribution
ICU	145	34.7
Medical Ward	133	31.8
Surgical ward	93	22.2
Emergency ward	17	4.1
Maternity ward	16	3.8
Other	14	3.3
Distribution of specimen types
Urine	254	60.8
Drainage fluid	83	19.9
Secretion	26	6.2
Blood	18	4.3
Pus	8	1.9
Aspirate	8	1.9
Abdominal fluid	6	1.4
Bile	6	1.4
Catheter	5	1.2
Tissue	4	1.0

In vitro susceptibility testing analysis

The resistance rates to the three echinocandins were as follows: caspofungin, 5.0%; micafungin, 4.0%; and anidulafungin, 3.8%. In contrast, a higher resistance rate of 9.6% was observed for fluconazole. Notably, approximately 1.0% of the strains exhibited resistance to both fluconazole and echinocandins. The wild-type strain percentages for amphotericin B, posaconazole, voriconazole, and itraconazole were 100%, 82.7%, 65.7%, and 96.8%. The susceptibility profiles of various antifungal agents are summarized in Table 3.

Table 3.

MIC of 418 C. glabrata isolates against 8 antifungal drugs

	CAS	MIF	ANI	FLU	POS	VOR	AMB	IZ
S%	90.2	94.8	94.5
I%	4.8	1.2	1.7
SDD%				90.4
R%	5.0	4.0	3.8	9.6
WT%					82.7	65.7	100	96.8
NWT%					17.3	34.3	0	3.2
MIC50	0.06	0.016	0.03	4	1	0.25	0.5	0.5
MIC90	0.25	0.03	0.125	32	2	2	1	1
GM	0.062	0.02	0.034	6.195	0.642	0.243	0.557	0.414
Range	0.008–16	0.008–1	0.015–1	0.12–256	0.008–8	0.008–8	0.06–8	0.015–16

MIC50 MIC at which 50% of test isolates were inhibited, MIC90 MIC at which 50% of test isolates were inhibited, GM geometric mean MICs

A total of 17 isolates that were nonsusceptible to any of the echinocandins were retested using CLSI BMD. The categorical agreement between Sensititre YeastOne™ YO10 and CLSI BMD was 100% for micafungin and anidulafungin, and 93.8% for caspofungin. The essential agreement (within 2 dilutions) between the reference and colorimetric MICs for micafungin, anidulafungin, and caspofungin was 93.8%, 93.8% and 87.5%.

From 2020 to 2023, there was a notable increase in the non-susceptibility rates of C. glabrata to echinocandins (Fig. 1). The non-susceptibility rates for micafungin, caspofungin, and anidulafungin increased from 0 to 8.6%, from 2.8 to 10.5%, and from 2.7 to 8.6%. There was a high level of concordance in the results between micafungin and anidulafungin. However, the non-susceptibility rate for caspofungin was higher compared to micafungin and anidulafungin. During the same period, despite the generally low minimum inhibitory concentration (MIC) values for the three echinocandins, a year-by-year increase in MIC values was observed overall (Fig. 2).

Fig. 1.

The trend of non-susceptibility of C. glabrata to echinocandins from 2020 to 2023

Fig. 2.

The MIC distribution results for micafungin of C. glabrata from 2020 to 2023

FKS mutation analysis

17 strains of C. glabrata exhibiting intermediate or resistant profiles to any of the echinocandin drugs were screened for mutations in the FKS genes. All sequences have been submitted to the NCBI database, and the corresponding GenBank accession numbers are PV785493 to PV785560. No mutation sites were detected in the FKS1 gene. A total of 11 strains were identified with FKS gene mutations, all located in the FKS2-HS1 region. Of the eleven isolates, ten were obtained from patients in the ICU, with urine being the most common specimen type, accounting for 90.9% of the samples. Among these patients, three had previously been exposed to echinocandin drugs. Unfortunately, one patient died, four patients discontinued their treatment, while six patients recovered and were discharged from the hospital.

The most common mutation was the F659 deletion (54.54%, 6/11), followed by S663F (18.18%, 2/11). Other mutations, including F659S, F659Y, and S663P, were observed in single strains. Notably, strains with the F659 deletion or F659Y mutations exhibited high resistance to all three echinocandins. In contrast, the S663F and S663P were specifically associated with lower MIC_S of echinocandins. Among the six strains that demonstrated intermediate to caspofungin but susceptible to micafungin and anidulafungin, no FKS gene mutations were detected.

Multi-locus sequence typing

Multilocus sequence typing (MLST) was conducted on 17 strains of C. glabrata that showed intermediate or resistant phenotypes to any echinocandin drugs. A total of 9 sequence types (STs) were identified, with ST-7 being the most common. The 11 strains harboring FKS gene mutations were categorized into six distinct sequence types (STs). The predominant sequence type was ST-208, represented by three strains, followed by ST-15 and ST-55, each with two strains. Additionally, one strain each was identified as ST-3, ST-7, ST-19, and ST-182. Among the six strains that showed intermediate sensitivity to caspofungin and were susceptible to both micafungin and anidulafungin, four were classified as sequence type ST-7, one as ST-43, and another as ST-264. No clear correlation was observed between the specific types of FKS gene mutations and the sequence types (STs). The UPGMA cluster tree was constructed based on the multi-site sequences, along with their corresponding drug susceptibility and mutation detection results, as shown in Fig. 3.

Fig. 3.

Drug susceptibility, FKS gene mutation sites, and sequence types of 17 C. glabrata strains

Discussion

C. glabrata is a significant non-albicans Candida species, capable of manifesting as colonization, isolated candidemia, invasive candidiasis, or a combination of these conditions [16]. In the United States, it is the second most common cause of candidemia, accounting for one-third of all fungal bloodstream infections [17]. Surveillance data from the National China Hospital Invasive Fungal Surveillance Net (CHIF-NET) over five years reveal that C. glabrata has an isolation rate of 10.8%, making it the fourth most commonly isolated Candida species [18].

C. glabrata is notable for its reduced susceptibility to azole antifungal drugs, leading to the recommendation of echinocandins as the preferred first-line treatment for invasive infections caused by this species. In the global guideline for the diagnosis and management of candidiasis, echinocandins are strongly recommended as first-line treatment of candidaemia [5]. Echinocandins, such as anidulafungin, caspofungin, and micafungin, are favored for their low toxicity, broad-spectrum antimicrobial activity, and effectiveness against azole-resistant strains. These lipopeptide echinocandin drugs target glucan synthase, a key enzyme in cell wall biosynthesis [19], and are the recommended therapeutic agents for a wide range of patients with candidiasis. Over the past decade, increased use of echinocandins has raised concerns about antimicrobial resistance.

Large-scale surveillance studies show that resistance in Candida albicans is generally less than 1%, with most Candida species maintaining susceptibility at or below this level [20]. However, C. glabrata is an exception, with echinocandins resistance rates ranging from 3 to 5% in population-based studies and up to 10–15% in some centers [21]. Alarmingly, nearly one-third of echinocandins resistant C. glabrata isolates also exhibit non-susceptibility to triazoles, severely limiting treatment options [22]. The emergence of multidrug-resistant C. glabrata strains, particularly those resistant to both echinocandins and azoles, poses a significant global threat and underscores the need to understand their prevalence, molecular mechanisms of resistance, and genotypes [23].

In our study, resistance rates of clinically isolated C. glabrata to caspofungin, micafungin, and anidulafungin were 4.3%, 3.6%, and 3.6%, respectively. These rates are higher than those reported in other Chinese studies (0.8–2.5%) [24, 25]. Additionally, 1.0% of isolates in our study were multidrug-resistant, showing resistance to both fluconazole and echinocandins, a figure significantly lower than in other reports [26, 27]. These discrepancies may be attributed to geographic strain distribution, variations in echinocandin usage patterns across hospitals, and patient-specific health conditions. The observed increase in C. glabrata resistance to both echinocandins and azoles may explain the rising prevalence of multidrug-resistant strains, posing significant therapeutic challenges due to limited antifungal options [28].

Echinocandin resistance in Candida species is primarily driven by mutations in the FKS genes, which encode the catalytic subunits of glucan synthase. Our findings align with other studies, indicating that FKS2 mutations are more prevalent than FKS1 mutations among echinocandins-resistant C. glabrata isolates [29–31]. Specifically, mutations such as F659 deletion and F659Y in the FKS2 gene led to higher minimum inhibitory concentrations (MICs) than S663F and S663P. This is consistent with reports that FKS mutations do not always result in uniform resistance levels [9, 32]. In addition, phenotypic methods for echinocandin susceptibility testing, especially for caspofungin, can be complicated by the “paradoxical growth effect” (PGE, also known as the Eagle effect). This phenomenon is characterized by reduced fungicidal activity at antifungal concentrations above the MIC, meaning that certain fungal isolates may grow in media containing high concentrations of echinocandins while remaining fully susceptible (i.e., showing no growth) at lower concentrations [33]. Although this phenomenon was not observed in our study, it is an important consideration that should be taken into account. Furthermore, some isolates with FKS mutations may exhibit low echinocandin MICs, highlighting the limitations of phenotypic in vitro testing [34]. According to various factors, the European Committee on Antimicrobial Susceptibility Testing (EUCAST) advises FKS mutation testing for isolates with elevated echinocandin MICs to rule out testing artifacts [35]. Current research indicates that detection of FKS mutations is superior to MIC values alone in predicting treatment response and is associated with poorer clinical outcomes [11, 36].

In our study, six strains showed intermediate to caspofungin but were sensitive to micafungin and anidulafungin, with no detectable FKS mutations. Similar findings have been reported elsewhere [37]. Both CLSI and EUCAST acknowledge inter-laboratory variability in caspofungin MICs for Candida species [38]. CLSI recommends ancillary testing (e.g., micafungin or anidulafungin testing, or FKS sequencing) for isolates that appear caspofungin resistant [39], whereas EUCAST lacks breakpoints for caspofungin and instead infers susceptibility from micafungin and anidulafungin results [40]. Furthermore, the results of this study demonstrated good categorical agreement between Sensititre YeastOne™ YO10 and the CLSI BMD method for the detection of echinocandins.

Genotyping of C. glabrata is crucial for identifying new clones and correlating genotypes with virulence, mortality rates, and resistance profiles [12, 41, 42]. Certain sequence types (STs) may have a higher propensity to acquire resistance following antifungal exposure [43, 44]. In China, ST-7 and ST-3 are predominant [24]. Our study revealed that among strains lacking detectable FKS mutations, ST-7 was most common. In contrast, among the 11 strains with FKS mutations, six distinct STs were identified, with ST-55 and ST-208 being most prevalent and only one strain belonging to ST7. These findings suggest: (1) diversity among echinocandins-resistant strains, and (2) differences in the primary STs of strains with and without FKS mutations.

While our study provides insights into the prevalence and molecular mechanisms of echinocandin resistance in C. glabrata isolates, it has limitations. The relatively small sample size may affect generalizability and representativeness. Additionally, depending exclusively on MLST typing and FKS gene sequencing has inherent limitations when studying the molecular epidemiology and drug resistance mechanisms. Future large-scale, multicenter studies are needed to further elucidate the molecular mechanisms underlying echinocandin resistance in C. glabrata.

Abbreviations

MLST

Multilocus sequence typing

STs

Sequence types

MALDI-TOF MS

Matrix-assisted laser desorption lonzation time of flight mass spectrometry

MIC

Minimum inhibitory concentration

PCR

Polymerase chain reaction

EUCAST

European committee on antimicrobial susceptibility testing

CLSI

Clinical laboratory standards institute

CHIF-NET

National China Hospital Invasive Fungal Surveillance Net

Authors’ contributions

GP and LW participated in research design and data analysis. GP and LW participated in the writing of the manuscript and data analysis. PY and XB performed the experiments. FJ and YJ participated in the collection of strains. All authors contributed to the article and approved the submitted version.

Funding

The study was supported by Guangzhou Science and Technology Bureau Municipal School (Institute) Co-funded Project (202201020443).

Data availability

All sequences of the FKS gene obtained from the strains in the current study have been deposited in the GenBank database under the accession numbers PV785493-PV785560.

Declarations

Ethics approval and consent to participate

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Guangzhou Medical University Affiliated First Hospital (Ethics Numbers:2021 K-40). Strains were collected as part of the routine clinical management of patients, according to the national guidelines in China. Therefore, informed consent was not sought, and an informed consent waiver was approved by the institutional ethical committee of Guangzhou Medical University Affiliated First Hospital.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.