Capillary Electrophoresis Can Detect the Simultaneous Presence of Hairpins and Self‐Dimers in Non‐Symmetric, Single‐Stranded DNA Oligomers

ABSTRACT

Free solution capillary electrophoresis (CE) has been used to show that non‐symmetric, single‐stranded DNA oligomers containing 26 nucleotides can exhibit peaks in the electropherograms that correspond to the simultaneous presence of self‐dimers and hairpins in the solution. The overlapping hairpin and self‐dimer peaks were observed at temperatures close to 15°C in background electrolytes containing at least 80 mM Na⁺ ions. With increasing temperature, the self‐dimers were converted first into hairpins and then into random coils at still higher temperatures. The results suggest that hairpins can be an intermediary step in the pathway between DNA duplexes and single‐strands.

1. Introduction

Single‐stranded DNA oligomers often serve as intermediates in a variety of reactions in the cell, including replication, transcription, recombination, and protein binding. For this reason, the conformations and thermal stabilities of single‐ and double‐stranded DNA oligomers have been studied for many years, using a variety of experimental methods. Early studies of symmetric DNA dodecamers found that thermal denaturation occurred as a monophasic transition at high ionic strengths (≥100 mM Na⁺). However, at low Na⁺ ion concentrations (≤10 mM) and low oligomer concentrations, the duplexes were converted first into hairpins and then into random coils as the temperature was increased [1, 2]. Similar results were observed with fractionated dAT oligomers [3]. Hairpins were observed in solutions containing <10 mM [Na⁺]; duplexes were formed in solutions with higher [Na⁺]. The duplexes exhibited biphasic melting curves, suggesting that the duplexes were first converted into hairpins and then into random coils with increasing temperature.

Free solution capillary electrophoresis (CE) is an important method that can be used to characterize the conformations and thermal stabilities of single‐ and double‐stranded DNA oligomers in solution [4, 5, 6]. The electrophoretic mobility, µ, of a small DNA (or RNA) oligomer is determined by the ratio between its effective charge and its frictional coefficient [7, 8, 9, 10]. DNA duplexes migrate faster than hairpins of the same size because of the higher charge densities of the duplexes [5]. DNA hairpins migrate faster than random coils containing the same number of nucleotides because of the more compact conformations and smaller frictional coefficients of the hairpins [5].

Our previous CE studies have shown that the free solution mobilities of single‐ and double‐stranded DNAs increase with increasing molecular weight before leveling off at a constant value at high molecular weights [11, 12]. The mobilities are approximately independent of sequence [4, 5] unless the sequence contains A‐tracts, runs of consecutive adenine residues not interrupted by a thymine residue. The narrow minor grooves characteristic of DNA A‐tracts increase counterion binding, decreasing the effective charge of the oligomer and decreasing the observed mobility [4, 5, 6, 13, 14]. We have also investigated the hairpin/random‐coil transition by CE, using both temperature and chemical denaturants to destabilize the hairpins [4, 5, 6]. Denaturation occurs by fast exchange between the hairpin‐ and random‐coil conformations, because only a single peak is observed in the electropherograms at various temperatures and/or denaturant concentrations [4, 5, 6]. The mobility of this peak corresponds to the weighted average of the mobilities of the hairpin‐ and random‐coil conformations present in the solution at that temperature.

In this report, we have analyzed the electropherograms corresponding to two single‐stranded, non‐symmetric 26‐nucleotide (nt) DNA oligomers, each of which contained two A3T4 or A4T3 sequences. These oligomers were designed as part of a larger study on the effect of sequence on the thermal stability of small DNA hairpins. Unexpectedly, we found that two discrete peaks were observed in the electropherograms of both oligomers at temperatures close to 15°C, indicating that hairpins and self‐dimers were both present in the solution. With increasing temperature, the self‐dimer peaks decreased in area and merged with the hairpin peaks, which then were denatured into random coils at still higher temperatures. The results suggest that hairpin formation is an intermediary step between DNA duplexes and their single‐stranded components.

2. Materials and Methods

2.1. DNA Samples

The two 26‐nt DNA oligomers used in these studies, called A3T4 and A4T3 for brevity, contained 62% A + T and had the sequences: 5′‐CGCAAATTTTCGCAAATTTTCAGACG and 5′‐CGTCTGAAAATTTGCGAAAATTTGCG, respectively. A random‐sequence oligomer containing 16 thymine residues, called T16, was used as a control. The oligomers were synthesized by IDT (Integrated DNA Technologies, Coralville, IA), purified by polyacrylamide gel electrophoresis, and stored as concentrated stock solutions in 10 mM Tris buffer at 20°C, as described previously [9, 15]. The hairpin structures predicted for oligomers A3T4 and A4T3 by the popular structure‐prediction program DINAMelt [16, 17] are illustrated in Figure 1. The predicted A3T4 hairpin has a stem of six AT and TA bp, a four‐nucleotide loop closing the stem, and relatively long dangling ends. The predicted A4T3 hairpin has the same mixed A/T bp stem, lengthened by a mismatched AG base pair and a GC bp at the base of the stem. Mismatched AG and GA base pairs are known to be nearly as stable as normal GC bp [18].

FIGURE 1.

Hairpin structures predicted by DINAMelt [16, 17] for oligomers A3T4 (left) and A4T3 (right).

The self‐dimers are two‐stranded structures formed by two copies of the monomers. The self‐dimer structures predicted by DINAMelt [16, 17] for oligomers A3T4 and A4T3 are illustrated in Figure 2. The self‐dimers contain the same mixed A/T bp stems and central GC/CG base pairs. In addition, the A4T3 self‐dimer contains mismatched GA and AG bp in the middle of the structure, as well as AG and GC bp closing the stems at each end.

FIGURE 2.

Self‐dimer structures predicted by DINAMelt [16, 17] for oligomers A3T4 (left) and A4T3 (right).

2.2. Capillary Electrophoresis

Capillary zone electrophoresis measurements were carried out with a Beckman–Coulter (Fullerton, CA) P/ACE MDQ CE system, run in the reverse polarity mode (anode on the detector side) with UV detection at 254 nm, as described previously [9]. Migration times and peak profiles were analyzed using the 32 Karat software. The capillaries (Polymicro Technologies, Phoenix, AZ) were 30.9 ± 0.2 cm in length (20.6 ± 0.2 cm to the detector) and 75 µm in diameter, internally coated with linear polyacrylamide to minimize the electroosmotic flow (EOF) of the solvent. Previous studies have shown that internal polyacrylamide coatings do not affect the mobilities of small DNA oligomers in solution [11]. The capillaries were mounted in a liquid‐cooled cartridge for good temperature control.

The electric field strength ranged from 1.0 to 5.1 kV/cm, depending on the temperature and the Na⁺ ion concentration in the background electrolyte (BGE). The current was always less than 60 µA. Under such conditions, Joule heating is negligible and the mobilities are independent of the applied electric field [11]. The DNA samples were injected hydrodynamically at low pressure (0.5 psi, 0.0035 MPa); the injection volume occupied ∼2.6% of the capillary length.

The DNA concentration ranged from 10 to 50 ng/µL in various experiments. Previous studies have shown that the observed mobilities are independent of DNA concentration within this range [6]. All experiments were carried out in BGEs containing diethylmalonate as the anion and Na⁺ as the cation. Diethylmalonate is a useful buffer for CE measurements because the buffering ion is an anion; therefore, the cation can be changed at will without affecting the pH or buffering capacity of the solution. Stock solutions containing 200 mM diethylmalonic acid, [(CH₃CH₂)₂C(COOH)₂], were titrated to pH 7.3, the pK _a of the second carboxyl group, with NaOH. Because the second carboxyl group is half ionized at pH 7.3, each stock solution contained 300 mM Na⁺; the ionic strength was 400 mM. The actual [Na⁺] in each solution was calculated from the measured pH and the pK _a of diethylmalonic acid, using the Henderson–Hasselbalch equation. To avoid confusion, all BGEs are described by their [Na⁺] concentrations, not by the ionic strength of the solution.

Thermal melting studies were carried out by measuring the mobility of oligomer A3T4 or A4T3 and the mobility of T16, injected into the capillary at the same time in the same solution. The temperature ranged from 15°C to 60°C, the range available on the CE instrument. The capillary was allowed to equilibrate at each temperature for 3 min before each measurement; previous studies have shown that a 3 min wait time is sufficient to reach temperature equilibrium [4, 5, 6]. Mobility ratios were calculated by dividing the mobility of the oligomer by the mobility of T16 at each temperature.

Plots of the mobility ratios, µ _oligo /µ _T16, as a function of temperature are called melting curves for brevity. The melting curves were analyzed by fitting the data to a four‐parameter sigmoid using the algorithms given in SigmaPlot, as described previously [19]. The midpoints of the thermal transitions, called the melting temperatures (T _m), were determined from the fits. The mobility ratios were very reproducible; the average day‐to‐day variation was ±0.3%. The melting temperatures, measured on the same day or on different days, were reproducible within ±1°C.

3. Results and Discussion

3.1. Simultaneous Presence of Self‐Dimers and Hairpins in the Electropherograms of Oligomers A3T4 and A4T3

Typical electropherograms observed at low temperatures for solutions containing oligomers A3T4 (overlapping peaks on the left) and T16 (single peak on the right) in 150 mM Na⁺ are illustrated in Figure 3. At 15°C (lowest trace), two overlapping peaks with similar amplitudes were observed for oligomer A3T4, suggesting that self‐dimers and hairpins were both present in the solution. The faster migrating peak can be attributed to self‐dimers, which would have had a higher charge density than the hairpins and would have migrated faster in the electric field [5]. Increasing the temperature to 20°C (middle trace) caused the two A3T4 peaks to move closer together and begin to merge, suggesting that the self‐dimers were gradually being converted into hairpins. Only a single peak was observed for oligomer A3T4 at 25°C (highest trace), indicating that the self‐dimers had been completely converted into hairpins at this temperature. The midpoint of the self‐dimer ↔ hairpin transition therefore appears to be between 20°C and 25°C in these solutions. By contrast, the peak observed for T16 on the right‐hand side of each trace was relatively sharp and nearly Gaussian in shape, as expected for a random coil at different temperatures [5, 9].

FIGURE 3.

Electropherograms observed as a function of temperature for oligomers A3T4 (peaks on the left side of each trace) and T16 (peaks on the right side) in BGEs containing 150 mM Na⁺. The temperatures were as follows: 25°C (top trace), 20°C (middle trace), and 15°C (lowest trace). In this and other electropherograms, the absorbance in arbitrary units is plotted as a function of the time after the sample was injected into the capillary.

Similar results were observed for oligomer A4T3 in 150 mM Na⁺, as shown in Figure 4. Two overlapping peaks with approximately equal amplitudes were observed at temperatures ranging from 15°C to 25°C (peaks on the left sides of the three lowest traces), suggesting that the self‐dimers and hairpins were present in approximately equal concentrations in these solutions. At 30°C, the two peaks moved closer together and were beginning to merge, as expected if the self‐dimers were being converted into hairpins and the two conformations were in fast exchange. Only a single symmetric peak was observed for oligomer A4T3 at 35°C, suggesting that the self‐dimers had been converted completely into hairpins at this temperature. The midpoint of the self‐dimer ↔ hairpin transition therefore appears to be between 25°C and 35°C in these solutions, somewhat higher than observed for the A3T4 self‐dimers. Although the A3T4 and A4T3 self‐dimers contained the same total numbers of AT and TA bp, the A4T3 self‐dimer contained two additional GC and CG bp in the middle of the structure as well as and four AG and GA bp at the ends of the mixed A/T stems (see Figure 2).

FIGURE 4.

Electropherograms observed for oligomers A4T3 (overlapping peaks on the left) and T16 (single peaks on the right) in BGEs containing 150 mM Na⁺. The different traces correspond to temperatures of 35°C, 30°C, 25°C, 20°C, and 15°C, reading from top to bottom.

Previous studies of the thermal stabilities of small symmetric DNA duplexes suggested that the duplexes were first converted into hairpins and then into random coils with increasing temperature [1, 2, 3]. Figures 3 and 4 show that the same behavior is observed for the self‐dimers of oligomers A3T4 and A4T3 in solutions containing 150 mM Na⁺. With increasing temperature, the self‐dimer and hairpin peaks began to merge, suggesting that the self‐dimers and hairpins were in equilibrium with each other. At higher temperatures, the hairpins were gradually denatured into random coils, as will be described in the next section. The combined results suggest that the thermal denaturation of oligomers A3T4 and A4T3 occurs in two stages: self‐dimer ↔ hairpin at temperatures below 25°C (A3T4 oligomers) or 35°C (A4T3 oligomers), and hairpin ↔ random coil at higher temperatures. The rate of exchange between the self‐dimer and hairpin conformations at low temperatures was apparently slow enough that both conformers could be observed as discrete peaks in the electropherograms. The approximately equal amplitudes of the self‐dimer and hairpin peaks observed at low temperatures imply that the two conformations were nearly equally populated at these temperatures.

The simultaneous observation of self‐dimers and hairpins in solutions containing oligomers A3T4 and A4T3 depended not only on the temperature but also on the [Na⁺] in the solution. At 15°C, oligomer A3T4 exhibited discrete self‐dimer and hairpin peaks in BGEs with [Na⁺] ranging from 80 to 300 mM. For oligomer A4T3 at 15°C, discrete self‐dimer and hairpin peaks were observed in BGEs containing 90 to 300 mM Na⁺; only a single symmetric peak was observed at 60 mM Na⁺. The results therefore suggest that self‐dimer formation is enhanced and/or stabilized in solutions containing at least 80 mM [Na⁺]. Other studies [20] have also shown that small single‐stranded DNA oligomers form hairpins at low [Na⁺] and bimolecular duplexes at high [Na⁺], presumably because larger numbers of counterions are needed to stabilize the duplex conformation.

3.2. Hairpin Denaturation

At temperatures above 25°C for oligomer A3T4 and 35°C for oligomer A4T3, the oligomers were completely in the hairpin conformation, as judged by the presence of symmetric Gaussian‐shaped peaks in the electropherograms (not shown). The thermal stabilities of the A3T4 and A4T3 hairpins were analyzed by measuring the mobility ratios, µ _hairpin /µ _T16, as a function of temperature. As described previously [5, 9, 19], mobility ratios automatically correct the observed mobilities for changes in the viscosity and dielectric constant of water with temperature. A typical melting curve observed for oligomer A3T4 in a BGE containing 88 mM Na⁺ is illustrated in Figure 5. The mobility ratio was approximately constant at low temperatures, decreased at temperatures above ∼30°C as the hairpin began to denature into a random coil, and reached a limiting low mobility at temperatures near 60°C. The hairpin and random‐coil conformations were in rapid exchange during the transition, because only a single peak was observed in the electropherograms at each temperature. The mobility of this peak depended on the weighted mobilities of the hairpin and random‐coil conformations present in the solution at that temperature.

FIGURE 5.

Melting curve observed for the A3T4 hairpin in a BGE containing 88 mM Na⁺ ions. The mobility ratio, µ _hairpin/µ _T16, is plotted as a function of temperature.

The melting temperatures observed for the A3T4 and A4T3 hairpins in BGEs containing various concentrations of Na⁺ ions are shown in Tables 1 and 2, along with the melting temperatures predicted for the hairpins by DINAMelt [16, 17]. The melting temperatures observed for the A3T4 hairpins as a function of [Na⁺] were reasonably close to the predicted values, as shown in Table 1. Hence, the nearest neighbor approximation used to calculate the predicted melting temperatures [16, 17] at various [Na⁺] describes the thermal stability of the A3T4 hairpins very well.

TABLE 1.

Comparison of the measured and predicted melting temperatures of the A3T4 hairpins in background electrolytes (BGEs) containing various [Na⁺].

A3T4 hairpins
[Na±], mM	a Meas. T m	b Pred. T m
75	36	38
88	37	41
100	42	42
150	c 46	44
300	47	48

^a Taken from individual melting curves.

^b Predicted by DINAMelt [16, 17].

^c Calculated [19] from global fits of the melting curves at various [Na⁺].

TABLE 2.

Comparison of the measured and predicted melting temperatures of the A4T3 hairpins in background electrolytes (BGEs) containing various [Na⁺].

A4T3 hairpins
[Na+], mM	a Meas. T m	b Pred. T m (A/T stem)	b Pred. T m (+AG, GC bp)
60	44	52	39
75	47	53	40
88	51	56	44
100	c 56	57	44
150	c 57	59	47

^a Taken from individual melting curves.

^b Predicted by DINAMelt [16, 17].

^c Calculated [19] from global fits of the melting curves at various [Na⁺].

Interestingly, two different sets of melting temperatures were predicted for the A4T3 hairpins by DINAMelt [16, 17], as shown in Table 2. A relatively high T _m was predicted for hairpins containing just the mixed A/T bp stems; a lower T _m was predicted for hairpins containing the mixed A/T bp stems plus the additional AG and GC base pairs at the base of the stem (see Figure 1). The observed melting temperatures of the A4T3 hairpins were between the two predicted values at low [Na⁺], suggesting that the two conformations were in rapid exchange under these conditions. However, at high [Na⁺], the observed melting temperatures were close to the predicted high T _m values, suggesting that the conformation containing just the mixed A/T bp stem was favored at high [Na⁺]. The results therefore suggest that the additional AG and GC bp at the base of the mixed A/T bp stem in the A4T3 hairpins caused some curvature and/or flexibility of the backbone at low [Na⁺], decreasing the thermal stability of the A4T3 hairpins. Importantly, an NMR study of a curved, double‐stranded RNA oligomer showed that increasing the [Na⁺] decreased the curvature of the backbone [21]. A similar effect seems to have been occurring with the A4T3 hairpins. Increasing the [Na⁺] appears to have decreased the bending and/or flexibility of the backbone caused by the AG and GC bp at the base of the mixed A/T bp stems. As a result, the thermal stability of the A4T3 hairpins reflected primarily the stability of the mixed A/T bp stems at high [Na⁺].

3.3. Comparison With Other Results

Cisse et al. [22] have studied the kinetics of annealing small DNA oligomers to form a duplex, using single‐stranded oligomers containing 9 nucleotides as the tested sequences. Seven sequential base pairs were found to be necessary for rapid, stable duplex formation, giving rise to a “rule of seven” for DNA duplex formation [22]. The thermal stability of the duplexes increased with increasing ionic strength, primarily because of an increase in k _on. Single mismatches at various positions within the sequence decreased duplex stability, primarily because of an increase in k _off. Interestingly, oligomers A3T4 and A4T3 each contained seven consecutive AT or TA bp in their sequences, thus appearing to follow the “rule of seven” for duplex formation. However, only six AT and TA bp were actually included in the hairpin stems (see Figure 1), suggesting that the “rule of seven” does not apply to the hairpins formed by oligomers A3T4 and A4T3.

Our CE studies of hairpin formation in 26‐nt single‐stranded DNAs containing 38%–81% A + T [5] showed that stable hairpins could be formed with stems containing two pairs of GC bp that could combine to form short GC:CG stems. Such hairpins generally had relatively small loops and long dangling ends. Hairpins with short GC:AT stems were not stable unless a second AT or TA bp was added to the stem. The thermal stabilities of such hairpins were highly variable, depending on the size of the loop, the length of the stem, and the specific residues in the stem. A 26‐nt oligomer containing 81% A + T formed a stable hairpin with seven AT and TA bp in the stem, in agreement with the proposed “rule of seven” [22]. However, the variability of the sizes and shapes of the different hairpins formed by these 26‐nt oligomers makes it difficult to believe that a single relationship can be devised to predict hairpin formation in small, non‐symmetric single‐stranded DNA oligomers. Instead, sequence‐dependent effects appear to dominate hairpin formation in such oligomers.

Similar conclusions have been reached by others. Fluorescence correlation spectroscopy studies have shown that the rate‐limiting step in DNA hairpin formation is the interaction between stem and loop nucleotides, not loop dynamics or mismatched nucleotides in the stem [23]. Studies with fractionated d(TA) oligomers have shown that electrostatic interactions that extend beyond nearest neighbors must be taken into account to understand DNA hairpin formation [24]. NMR, optical melting, and T‐jump experiments have shown that base stacking interactions determine the stability of nucleic acid conformations [3, 25]. As a result, DNA duplexes can be transformed into hairpins by stacking 2–3 bases on the 3′‐side of the stem and bridging the gap by adding one or two residues from the remaining stem [25]. Because the solution structures of single‐stranded DNA oligomers contribute significantly to the thermodynamics of duplex formation [26], base stacking on the 3′‐side of a duplex stem could form the basis of a direct duplex ↔ hairpin transition without needing to postulate the presence of a random‐coil intermediate between the two conformations.

4. Concluding Remarks

The results described here have shown that CE can detect the simultaneous presence of hairpins and self‐dimers in non‐symmetric, single‐stranded DNA oligomers in solution. The electropherograms observed at 15°C for oligomers A3T4 and A4T3 exhibited two peaks of approximately equal amplitudes in BGEs containing 150 mM Na⁺, suggesting that the hairpins and self‐dimers were about equally populated under these conditions. The faster migrating peak in each electropherogram can be attributed to the self‐dimers, which would have had higher charge densities than the hairpins and would have migrated faster in the electric field. With increasing temperature, the self‐dimer and hairpin peaks moved closer together until merging into a single peak, indicating that the self‐dimers were gradually being converted into hairpins. At still higher temperatures, the hairpins were denatured into random coils, as observed in previous studies [5, 19].

The melting temperatures of the self‐dimers and hairpins of oligomer A4T3 were similar to those of oligomer A3T4, which is not surprising because both oligomers contained 62% A + T and had the same numbers of AT and TA bp. Moderate concentrations of Na⁺ ions (≥80 mM) were also required for self‐dimer formation, most likely because DNA duplexes are preferentially stabilized by high concentrations of Na⁺ ions in the solution [3, 20, 24]. More extensive studies would be needed to determine the melting temperatures of the self‐dimers more exactly, as well as and the thermodynamics of the conformational transitions between the self‐dimers and hairpins.

Other studies in the literature have shown that symmetric single‐stranded DNA oligomers, at constant temperature, form hairpins first and then self‐dimers as the [Na⁺] is increased [1, 2, 20]. The present study has focused on the opposite reaction. At constant [Na⁺] and using temperature as the variable, DNA self‐dimers were found to be converted first into hairpins and then into random coils as the temperature was increased. The forward and reverse reactions would be expected to occur by similar mechanisms, because nanomechanical studies have shown that the folding and unfolding of DNA hairpins is characterized by a single transition state [27]. This transition state appears to involve the stacking of 2–3 nucleotides on the 3′‐side of a duplex and then dissociating 1–2 additional base pairs from the stem to fill the remaining gap [3, 24, 25]. This scenario provides a direct mechanism for transforming a DNA duplex into a hairpin without needing to form a random‐coil intermediate between the two structures.

The simultaneous appearance of hairpins and self‐dimers in the electropherograms of non‐symmetric single‐stranded DNA oligomers appears to be relatively rare, most likely because the self‐dimers of most oligomers are thermodynamically unstable. Although we have studied many symmetric and asymmetric 26‐nt DNAs by CE, we have found only one other oligomer with electropherograms that exhibited the simultaneous presence of self‐dimers and hairpins. This oligomer, called A5T5 for brevity, contained 46% A + T and had the sequence 5′‐CGGTGCGGAAAAACGAGCTTTTTGCG. Oligomer A5T5 exhibited both hairpins and self‐dimers in BGEs containing 30–100 mM Na⁺ or 300–500 mM NH₄ ⁺. Further studies will be needed to characterize the thermal stabilities of the hairpins and self‐dimers formed by oligomer A5T5 in these two very different BGEs. These results, together with the results described above, could lead to greater insights into the role played by single‐stranded DNA oligomers in various reactions in the cell, many of which are not well understood [27, 28].

Conflicts of Interest

The authors declare no conflicts of interest.

Stellwagen E. and Stellwagen N. C., “Capillary Electrophoresis Can Detect the Simultaneous Presence of Hairpins and Self‐Dimers in Non‐Symmetric, Single‐Stranded DNA Oligomers.” ELECTROPHORESIS 46, no. 11–12 (2025): 46, 679–686. 10.1002/elps.70005

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.