ABSTRACT
The presence of neuronal Lewy bodies mainly composed of SNCA/α-synuclein aggregations is a pathological feature of Parkinson disease (PD), whereas reducing SNCA protein levels may slow the progression of this disease. We hypothesized that compounds enhancing SNCA’s interaction with MAP1LC3/LC3 May increase its macroautophagic/autophagic degradation. Here, we conducted small molecule microarray (SMM)-based screening to identify such compounds and revealed that the compound R406 could decrease SNCA protein levels in an autophagy-dependent manner. We further validated the proposed mechanism, in which knockdown of essential gene ATG5 for autophagy formation and using the autophagy inhibitor chloroquine (CQ) blocked the effect of R406. Additionally, R406 also reduced the levels of phosphorylated serine 129 of SNCA (p-S129-SNCA) in SNCA preformed fibrils (PFFs)-induced cellular models and rescued neuron degeneration. Importantly, we confirmed that R406 could alleviate PD-relevant disease phenotypes in human SNCA PFFs-induced cellular models and PD patient-derived organoid models. Taken together, we demonstrated the possibility of lowering SNCA levels by enhancing its autophagic degradation by compounds increasing SNCA-LC3 interactions.
Abbreviations: ATTEC: autophagy-tethering compounds; BafA1: bafilomycin A1; BiFC: bimolecular fluorescence complementation; CQ: chloroquine; hMOs: human midbrain organoids; iPSC: induced pluripotent stem cells; MBP: maltose-binding protein; mHTT: mutant huntingtin; OI-RD: oblique-incidence reflectivity difference; PFFs: preformed fibrils; p-S129-SNCA: phosphorylated serine 129 of SNCA; PD: Parkinson disease; ROS: reactive oxygen species; siRNA: small interfering RNA; SMM: small molecule microarray; SNCA: synuclein alpha; SYK: spleen associated tyrosine kinase.
KEYWORDS: Autophagic degradation, parkinson disease, small molecule compounds, SNCA/synuclein alpha, midbrain organoid
Introduction
PD is a common neurodegenerative disorder, with an incidence rate of approximately 1% among individuals over 65 years old [1]. In the past two decades, the incidence rate of PD has rapidly increased, driven by the aging global population and advancements in diagnostic techniques [2]. The clinical symptoms of PD are primarily characterized by motor issues such as resting tremors, limb stiffness, bradykinesia, and impaired voluntary movement. Additionally, non-motor symptoms include cognitive impairment, anosmia, anxiety, depression, and sleep disorders [3,4]. The typical pathological feature of PD is the formation of Lewy bodies/LBs in the central nervous system, mainly composed of insoluble aggregates of SNCA/α-syn (synuclein alpha), ultimately leading to progressive death and loss of dopaminergic neurons in the substantia nigra and also other regions, including the locus coeruleus, the dorsal raphe nucleus and the dorsal motor nucleus of the vagus [5,6].
SNCA is a small molecule protein (15 kDa) composed of 140 amino acids, with high conservation and certain neural specificity [7,8]. Under physiological conditions, SNCA exists in an intrinsically disordered conformation, primarily localized in the presynaptic and perinuclear regions of the central nervous system. Its abundant proline content and the negatively charged residues in its carboxyl-terminal structure are crucial for maintaining the protein’s solubility [9]. Currently, the exact physiological function of SNCA is not well understood. However, it is known to play a role in releasing synaptic vesicles from the presynaptic membrane in the neuron [10]. The aggregation of pathological SNCA is considered a critical pathogenic factor in PD, which can cause mitochondrial damage, increase cellular oxidative stress, and ultimately lead to the death and loss of dopaminergic neurons [11]. Studies have shown that doubling the copy number of the SNCA gene can lead to PD. In cases of SNCA copy number duplication, triploids exhibit more severe disease symptoms than diploids, indicating a positive correlation between SNCA expression levels and the severity of PD [12–14].
Currently, the primary medications used for initial therapy in PD include levodopa preparations, dopamine receptor agonists, monoamine oxidase type B inhibitors/MAOB-I, and catechol-O-methyltransferase inhibitors/COMT-I [15–18]. These treatments primarily focus on dopamine replacement therapy strategies. As time progresses, patients develop drug resistance, and after developing resistance, methods such as deep brain stimulation are also used for the treatment of PD [19]. However, these therapies can only alleviate the symptoms of the disease but do not modify the progression of PD.
To date, research has primarily focused on gene therapy to reduce SNCA levels. For instance, techniques like RNA interference/RNAi or antisense oligonucleotides/ASOs can effectively silence mRNA of the SNCA gene, leading to a significant reduction in SNCA levels and alleviating the disease phenotype in model animals [20–22]. Research has also reported that by fusing inactivated Cas9 protein/dCas9 with DNMT3A (DNA methyltransferase 3 alpha), effective small guide RNAs/sgRNAs targeting the SNCA intron 1 region. Cell experiments have confirmed that using CRISPR interference/CRISPRi technology enhances the methylation levels of CpG dinucleotides in the intron 1 region of SNCA In vitro, effectively reducing the transcription levels of the SNCA gene [23]. However, these gene therapies still face difficulties in drug delivery, expensive treatment costs, and other issues that need to be optimized. Therefore, small molecule compounds that can reduce SNCA protein are more likely to cross the blood-brain barrier, are cost-effective, and have low immunogenicity.
Autophagy is a crucial cellular “cleaning” system that degrades misfolded proteins and damaged organelles [24], and SNCA has been recognized as a substrate undergoing degradation via the autophagic pathway [25,26]. Studies have reported that small molecule compounds such as hederagenin and α-redonin can enhance the clearance of SNCA by promoting overall autophagy. Additionally, these compounds have been shown to improve behavioral defects in mice with PD induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine/MPTP [27]. However, due to undesired proteins and other biomolecules degraded by cellular autophagy, directly increasing autophagy levels may lead to complex and unintended consequences.
We previously proposed a novel strategy autophagy-tethering compound (ATTEC), which tether the target protein to the autophagosome protein LC3 and selectively degrade the target protein without influencing the overall autophagy. We successfully applied this strategy to the degradation of mutant HTT protein, which causes Huntington disease [28,29]. In this study, we tested whether this approach is expandable to other proteins, such as the critical target protein SNCA, and carried out small molecule microarray (SMM)-based screening to identify such compounds.
Results
Identification of potential SNCA-LC3B binding compounds
To identify small molecule compounds that can bind to both SNCA and LC3B proteins, we conducted a high-throughput screening of small molecules. First, we utilized a nucleophile-isocyanate reaction to stamp 3,375 compounds onto isocyanate-functionalized glass slides in duplicate, fabricating SMMs. This library included 1,527 Food and Drug Administration/FDA-approved drugs, 795 known target inhibitors, and 1,053 natural products, with covalent bonds forming between the compounds and the glass slides [30,31]. Next, we purified the LC3B protein, SNCA protein, and MBP (maltose-binding protein) protein (Figure S1A-C), which were then passed sequentially over the SMMs [32]. The formation of the SNCA-compound-LC3B ternary complex can be detected using an oblique-incidence reflectivity difference (OI-RD) microscope, a label-free detection method for microarrays. OI-RD offers information about the thickness or surface mass density of biomolecules immobilized on the microarray substrate by measuring the reflectivity change differences of polarized light reflected off the microarrays. With the integration of two-dimensional scanning, OI-RD enables imaging of microarrays with a size of 2 cm × 4 cm, accommodating approximately 10,000 biomolecular spots, thereby facilitating high-throughput measurement of biomolecular interactions without the need for biomolecule labeling (Figure 1A). For drug screening, OI-RD images are captured before and after the incubation step for each protein to track the thickness at each spot. The changes in thickness observed in the OI-RD images (post-incubation image minus pre-incubation image) serves as an indicator of compounds that have bound to the target proteins. Through screening, we identified ten hits, which could bind to both SNCA and LC3B, but not to MBP simultaneously (Figure 1B). We tested the effects of these compounds on SNCA in HEK293 cells and found that one of the compounds, R406, could reduce SNCA (Figure S1D,E). The 2D structure of R406 is presented in (Figure S1F).
Figure 1.

Discovery of SNCA-LC3B binding molecule compounds. (A) Diagram of screening design. The SMM was stamped in duplicate onto isocyanate functionalized glass slides. OI-RD screenings were performed by flowing through the indicated recombinant purified proteins, including LC3B, SNCA and MBP. Flowing of buffer was applied before and after flowing through of each tested protein to wash out nonspecific binding. The compounds binding to each protein could be identified in the difference image obtained by subtracting the image before flowing the test protein from the image after flowing the test protein, as illustrated by the bright circles. Compounds that exhibit positive signals in both difference images of LC3B and SNCA but not MBP were selected as hits. (B) Representative screening results (from two replicated SMM chips) showing the ten positive hits (in solid red rectangles). The compounds were annotated by their positions in the microplates used to print SMMs.
R406 increased the binding between SNCA protein and LC3B protein
To further clarify the interaction between SNCA and R406, we carried out bimolecular fluorescence complementation (BiFC) experiments. We first constructed the plasmid of SNCA-VN155-internal ribosome entry site/IRES-LC3B-VC155. When these two proteins bound together, they emitted a yellow fluorescent signal [33] (Figure 2A). After transfecting the plasmid into cells, we added bafilomycin A1 (BafA1), a V-ATPase inhibitor, that inhibits autophagy by blocking the fusion of autophagosomes with lysosomes, thereby preventing the degradation of proteins via the autophagic pathway. As a result, we observed that R406 significantly increased the fluorescent signal for SNCA-VN155 and LC3B-VC155 (Figure 2B,C), but not for VN155 with VC155 or VN155 with LC3B-VC155 (Figure 2D). We also detected that the levels of SQSTM1/p62 (sequestosome 1) protein did not change (Figure S2). Moreover, using OI-RD experiments, we found that R406 was capable of binding to both SNCA and LC3B proteins independently (Figure 2E,F). The data also indicated that without R406 incubation, the OI-RD signal amplitude was too small for protein-protein interactions, reflecting that the endogenous SNCA-LC3B interaction without R406 was too weak for accurate Kon and Koff measurements in this assay (Figure 2G). With the R406 incubation, the OI-RD binding signal amplitude was much larger, allowing accurate curve fitting and indicating obviously increased SNCA-LC3B interactions (Figure 2H). Additionally, we conducted an MBP affinity-isolation experiment using purified MBP-LC3B and SNCA proteins (Figure S1B,C,G). The results showed that R406 significantly enhanced the binding between SNCA and LC3B in a concentration-dependent manner (Figure 2I). We further verified that R406 also increased the binding between SNCA and LC3B proteins in cells (Figure 2J). These findings indicated that R406 enhanced the binding between SNCA and LC3B, thereby increasing the likelihood of SNCA degradation via autophagy.
Figure 2.

R406 increased the interaction between SNCA and LC3B. (A). Schematic diagram of the BiFC assay. (B–D) BiFC assay detection (scale bar: 100 μm) showing that R406 treatment significantly increased the interaction of SNCA-VN155 and LC3B-VC155 but not the control VN155 and VC155 or VN155 and LC3B-VC155 with bafilomycin A1 (BafA1, 50 nM, 24 h), the two-tailed unpaired t-test. ****p < 0.0001. (E and F) Association – dissociation curves of surface-immobilized compounds R406 with LC3B (E) or SNCA (F) At the indicated purified protein concentrations. In association – dissociation curves, vertical dashed lines mark the start of the association and dissociation phases of the binding events. The red dashed curves are global fits by a Langmuir reaction model with the fitting parameters listed at the bottom of each plot. (G and H) Association – dissociation curves of surface-immobilized protein LC3B with SNCA or SNCA and R406 at the different purified protein concentrations. In association – dissociation curves, vertical dashed lines mark the start of the association and dissociation phases of the binding events. The red dashed curves are global fits by a Langmuir reaction model with the fitting parameters listed at the bottom of each plot. (I) Representative in vitro affinity-isolation experiments (from 3) showed that R406 clearly enhanced LC3B-SNCA interactions. (J) Representative co-immunoprecipitation experiments (from 3) showing that R406 obviously enhanced LC3B-SNCA interactions in HEK293 cells. For all panels, n indicates the number of independently plated wells from different batches; data are the mean ± SEM. Statistical parameters are shown in the figure.
R406 reduced SNCA protein levels at the cellular level via a syk-independent post-transcriptional mechanism
To evaluate the effect of R406 on SNCA protein levels, we first tested R406’s effect in HEK293 cells, and the data indicated that R406 significantly reduced SNCA levels. Additionally, we evaluated the levels of the key autophagy substrate protein SQSTM1/p62 along with LC3-I/II, and observed that their levels remained unchanged (Figure 3A–C). We then confirmed similar results in primary cultured rat cortical neurons at days in vitro 7/DIV7, where R406 also significantly lowered SNCA levels but did not affect autophagy (Figure 3D,E). These results indicated that R406 could reduce SNCA levels in different cellular models.
Figure 3.

R406 reduced SNCA protein levels at the cellular level via syk-independent post-transcriptional mechanisms. (A–C) Representative western blots and quantification of SNCA, SQSTM1/p62 and LC3-I/II in HEK293 cells treated with R406. one-way ANOVA and Dunnett’s post hoc tests; **p < 0.05, ****p < 0.01. (D and E) Representative western blots and quantification of SNCA, SQSTM1/p62 and LC3-I/II in primary cultured neurons treated with R406. (F) q-pcr measurements of the SNCA mRNA levels in the primary cultured neurons treated with DMSO or R406. One-way ANOVA with Dunnett’s post hoc tests. (G) Cell viability measurement of primary cultured neurons measured by the CellTiter-glo assay. No toxicity was observed within the concentration range presented in Figure 3A–E. One-way ANOVA with Dunnett’s post hoc tests. (H) Representative western blots and quantification of SNCA in SYK knockdown HEK293 cells. Two-tailed unpaired t-tests. ****p < 0.0001. (I) Representative western blots and quantification of SNCA levels in primary cultured neurons treated with the SYK antagonist p505–15 at the indicated concentrations, which did not affect the SNCA level. One-way ANOVA with Dunnett’s post hoc tests. (J) Representative western blots and quantifications of SNCA in R406-treated cultured primary neurons with or without the proteasome inhibitor lactacystin (4 μM). Two-tailed unpaired t-tests. ***p < 0.001. For all panels, n indicates the number of independently plated wells from different batches. Data are the mean ± SEM and analyzed by two-tail unpaired t-test or one-way ANOVA and Dunnett’s post hoc tests.
To demonstrate the mechanism by which R406 affects SNCA, we assessed the expression of the SNCA gene. We tested SNCA mRNA levels under various concentrations of R406 treatment. The q-PCR results indicated that R406 did not affect SNCA mRNA transcription levels (Figure 3F). We also evaluated different concentrations of R406 and found no toxic effects on neurons (Figure 3G). Given that R406 is known to inhibit SYK (spleen associated tyrosine kinase), which is a non-receptor protein tyrosine kinase, expressed in various cells such as T cells, B cells, epithelial cells, fibroblasts, vascular endothelial cells, and platelets [34]. We further investigated the role of SYK by knocking down the SYK gene using small interfering RNA (siRNA) to reduce SYK protein expression, simulating the inhibitory effect of R406. Our findings showed that the knockdown of SYK protein levels did not alter SNCA levels (Figure 3H). Additionally, treatment with the SYK inhibitor p505–15 did not reduce SNCA protein levels (Figure 3I). Therefore, these data indicated that the reduction of SNCA protein levels by R406 is independent on SYK kinase inhibition. Given SNCA can be degraded by the proteasome [35], to rule out whether R406 affects SNCA degradation via the proteasome pathway, we used the proteasome inhibitor lactacystin and found that it did not block R406’s effect on SNCA degradation (Figure 3J). The data indicated that R406’s degradation of SNCA was not through the proteasome pathway.
Degradation of SNCA by R406 was dependent on autophagy
Furthermore, we employed the autophagy inhibitor chloroquine (CQ) to effectively block autophagy. Upon administration of CQ, we observed a significant increase in the levels of SQSTM1/p62 and LC3-II, indicating successful inhibition of autophagy. Additionally, the data demonstrated that CQ hindered the degradation of SNCA induced by R406 treatment in cultured primary neurons and HEK293 cells (Figure 4A,B and Figure S3A,B). This suggested that the mechanism may operate through the autophagy pathway. To further elucidate the role of autophagy, we knocked down the ATG5 (autophagy related 5) gene, a key upstream regulator of autophagosome formation. We observed that knocking down the ATG5 gene reduced the formation of LC3B-II proteins and inhibited the reduction of SNCA levels by R406 significantly (Figure 4C,D and Figure S3C,D), but did not affect the mRNA levels of SNCA (Figure S3E). Additionally, we treated the cells with serum-free EBSS or rapamycin, both of which promote autophagosome formation after 6 h, as evidenced by the detection of SQSTM1/p62 and LC3-II levels (Figure 4E and Figure S3F). Subsequently, we discontinued the EBSS and rapamycin treatments and collected samples 18 h later for the analysis of SNCA levels. We found that the degradation of SNCA by R406 was further increased under conditions of enhanced autophagy (Figure 4F and Figure S3G). We also confirmed that rapamycin inhibited the MTOR pathway by assessing MTOR (mechanistic target of rapamycin kinase), p-MTOR (Ser2448), RPS6KB/p70S6K and p-RPS6KB/p70S6K (Figure S3H). Furthermore, to confirm R406-mediated localization of SNCA into autophagosomes [36–38], we conducted confocal immunochemical experiments, and the data showed that the colocalization of SNCA and LC3B increased with R406 treatment. However, immunocytochemical analysis showed no significant changes in the LC3B+ puncta numbers (Figure 4G). Importantly, we assessed the autophagic flux dependence of R406-induced SNCA degradation by using chloroquine (CQ), which increased the SNCA-LC3B complexes. In contrast, treatment with rapamycin decreased this signal (Figure S4A,B). These data suggested that R406 likely degrades SNCA via the autophagy pathway.
Figure 4.

Degradation of SNCA by R406 is dependent on autophagy. (A) Representative western blots and quantifications of SNCA in R406-treated cultured primary neurons with or without the autophagy inhibitor CQ. Two-tailed unpaired t-tests. ****p < 0.0001. (B) Representative western blots and quantifications of SQSTM1/p62 and LC3-I/II in R406-treated cultured primary neurons with or without the autophagy inhibitor CQ. Two-way ANOVA and Dunnett’s post hoc tests; ****p < 0.0001. (C) Representative western blots and quantification of SNCA and SQSTM1/p62 in ATG5 knockdown cultured primary neurons. Two-tailed unpaired t-tests. ****p < 0.0001. (D) Representative western blots and quantification of ATG5 and LC3-I/II in ATG5 knockdown cultured primary neurons. Left, two-tailed unpaired t-tests. right, two-way ANOVA and Dunnett’s post hoc tests; *p < 0.05, ****p < 0.0001. (E) Representative western blots and quantifications of SQSTM1/p62 and LC3-I/II in R406-treated HEK293 cells with the autophagy activator EBSS treatment 6 h. Two-way ANOVA and Dunnett’s post hoc tests; ***p < 0.001. (F) Representative western blots and quantifications of SNCA in R406-treated HEK293 cells with the autophagy activator EBSS treatment 6 h. Two-tailed unpaired t-tests. ****p < 0.0001. (G) Representative images (scale bar: 10 μm) and quantification of the co-localization between SNCA and autophagosomes in HEK293 cells treated with DMSO or R406 (4 h). Two-tailed unpaired t-tests. ****p < 0.0001. For all panels, n indicates the number of independently plated wells from different batches; data are the mean ± SEM. Statistical parameters are shown in the figure.
R406 decreased p-S129-snca and significantly alleviated the disease phenotype in a PFFs-induced PD cellular model
To further explore the impact of R406 on PD cells, we constructed a PD cell model using PFFs (Figure 5A). Immunofluorescence experiments revealed that PFFs treatment induced the production of the more toxic p-S129-SNCA protein. At the same time, treatment with R406 significantly reduced the level of p-S129-SNCA (Figure 5B,C). We also analyzed the morphology of the neurons and found that R406 significantly rescued the degeneration of neuron (Figure 5D). These data indicated that R406 alleviated the PD cell phenotype by promoting the degradation of p-S129-SNCA protein.
Figure 5.

R406 decreased p-S129-snca and significantly alleviated the disease phenotype in a PFFs-induced PD cellular model. (A) Representative electron microscopy image of PFFs (scale bar: 200 nm). (B and C) Representative DAPI staining and immunostaining of p-S129-SNCA and MAPT/tau, showing PFFs-induced p-S129-snca could be decreased by R406 (scale bar: 100 μm), one-way ANOVA and Dunnett’s post hoc tests; **p < 0.01. (D) Representative image of PFFs-induced primary neuron with R406 treatment or DMSO (scale bar: 50 μm). Two-way ANOVA and Dunnett’s post hoc tests; ****p < 0.0001. For all panels, n indicates the number of independently plated wells from different batches; data are the mean ± SEM. Statistical parameters are shown in the figure.
The analogs of R406 also reduced the levels of SNCA
Based on the molecular structure of R406, we identified two structural analogs, R406-AN1 and R406-AN2, which were found to lower SNCA levels in both HEK293 cells and primary cultured neurons (Figure S5A–D). The 2D structures of R406-AN1 and R406-AN2 are presented in (Figure S5E,F).
R406 decreased SNCA and alleviated pd-relevant phenotype in a midbrain organoid model derived from a PD patient
To assess the potential effects of R406 on PD-relevant phenotypes, we constructed a midbrain organoid model containing dopaminergic neurons derived from induced pluripotent stem cells (iPSCs) of the PD patient (Figure 6A,B). After incubating the organoids with R406, we observed that the compound significantly reduced SNCA levels, as demonstrated by immunofluorescence experiments (Figure 6C). Previous research has indicated that reactive oxygen species (ROS) was generated in the neurons of PD patients [39], we also measured the ROS levels in the organoid model. The results indicated that ROS levels significantly declined after treatment with R406 in the iPSC-derived organoids compared to the DMSO treatment, suggesting a protective effect of the compound on neurons (Figure 6D). Additionally, we observed a significant reduction in the loss of dopamine neurons following incubation with R406 (Figure 6E). These findings suggested that the small molecule compound R406 could effectively alleviate PD-relevant phenotypes in the organoid models.
Figure 6.

R406 decreased SNCA and alleviated pd-relevant phenotype in a midbrain organoid model derived from the PD patient. (A) hiPSC were induced to differentiate into midbrain organoids as described in methods. (B) The slices of midbrain organoids in WT and PD groups were immunostained with SOX2, DCX, FOXA2, and NES antibodies (scale bar: 20 μm). HO, hoechst 33,342. (C) Representative image of midbrain organoid showed that R406 lowered SNCA levels (scale bar: 20 μm). The two-tailed unpaired t-test; **p < 0.05. (D) Representative image of midbrain organoid showed that R406 decreased the ROS levels (scale bar: 10 μm). The two-tailed unpaired t-test; ****p < 0.01. (E) Representative th-staining image of midbrain organoid showed R406 rescued the loss of dopamine neuron (scale bar: 20 μm). The two-tailed unpaired t-test; *p < 0.01. For all panels, n indicates the number of independently plated wells from different batches; data are the mean ± SEM. Statistical parameters are shown in the figure.
Discussion
In this study, we identified the small molecule compound R406 from a library of 3,375 candidate drugs through small molecule microarray based unbiased screening. This compound R406 could simultaneously bind to both SNCA and autophagy protein LC3B, which could potentially enhance the tethering of SNCA to the autophagosomes for autophagic degradation. Our data showed that R406 effectively reduced levels of SNCA and p-S129-SNCA at nanomolar concentrations in HEK293 cells, primary cultured neurons and PD patient derived iPSC-induced midbrain organoid models. Finally, we found that R406 could mitigate the disease phenotypes of PD cells in PFFs-induced PD cell and organoid models.
The compounds identified in this study mostly likely function by enhancing the LC3-SNCA interaction, as demonstrated by BiFC, OI-RD, MBP affinity isolation, and co-immunoprecipitation (Figure 2). We applied similar approaches for another pathogenic protein, the mutant HTT protein (mHTT), and identified degrader compounds of it (mHTT-ATTECs) [28]. Some of the HTT-ATTECs were later discovered to be able to engage the ubiquitin-proteasome system/UPS pathway for targeted degradation when connect to target ligands such as JQ1 [40,41]. Meanwhile, the mHTT degradation by these compounds is ubiquitin-proteasome system independent [42]. A likely explanation is that these compounds may engage different pathways for degradation of different targets in different cellular context. While the mechanism of action of the compounds identified in this study is similar to the ones degrading mutant HTT, they were discovered completely independently and share no structural similarity to mHTT-ATTECs. The target and screening design of this study are also different from the previous study: we flew through LC3 and SNCA sequentially, whereas the other study flew through mHTT, wild-type HTT, and LC3 separately.
ATTEC has broad potential for application and has been extensively developed since the concept was introduced [43–48]. This technology provides the possibility for targeting some “undruggable targets”, which are “yet not be targeted” using traditional approach, such as pathogenic proteins associated with neurodegenerative diseases. Importantly, these small molecules, due to their low molecular weight, can easily cross the blood-brain barrier, which is particularly advantageous for the treatment of neurodegenerative disorders. However, Compounds that boost autophagy or act on other targets to degrade SNCA may cause unwanted global effects due to increased autophagy flux [49–53].
R406 could only reduce the level of SNCA protein to about 60%. The compound working concentration was relatively high, in the range of 300 nM-1 μM, and the compound was also reported as the inhibitor of SYK. SYK is known to have an essential role in adaptive immune receptor signaling, innate immune recognition, indirect activation, and blood vessel growth [54–57]. When it is inhibited by R406, may causing severe consequences. Therefore, we will next conduct modification of R406, improve and enhance its binding with LC3B and SNCA protein, increase the degradation efficiency of SNCA protein, and avoid its inhibitory activity on SYK. However, our data indicated that the impact of R406 on the degradation levels of SNCA exhibited variability within a specific range across different experimental conditions. The observed differences in SNCA reduction levels between the two figures may be attributed to cultured neurons derived from P7 rats generated by female rats of varying ages and individual backgrounds. These physiological differences inherent to neurons from distinct individuals or age groups are challenging to control and likely contributed to the aforementioned discrepancies in results.
We validated the autophagy-dependent of R406 on the reduction of SNCA by knocking down the critical gene ATG5 involved in autophagy formation and blocking autophagy with the autophagy inhibitor CQ (Figure 4C,D and Figure S3A-E). We also validated the enhanced binding between SNCA protein and LC3B protein by R406 using BiFC, MBP affinity isolation, and OI-RD experiments (Figure 2). However, we still lack structural biology evidence to elucidate the binding site between compound R406 and two proteins. In the future, we need to analyze the direct binding mode and structure-activity relationship between the compound and protein.
The degradation of targets, particularly in the context of neurodegenerative diseases, represents a promising therapeutic strategy. Numerous researchers globally have made substantial contributions to this domain, investigating various methodologies that harness the autophagy pathway for target degradation. Notably, Lee et al. developed Autophagy Targeting Chimera/AUTOTAC, a macroautophagy-based platform for targeted protein degradation/TPD. They synthesized Autophagy Targeting Chimera compounds that simultaneously bind SNCA aggregates and SQSTM1, an autophagic receptor, facilitating the degradation of SNCA aggregates both in vitro and in vivo [58]. Furthermore, Jiang et al. introduced a series of autophagy receptor-inspired targeting chimeras/AceTACs, engineered through three generations of antibody-fusion degraders. These chimeras effectively induce targeted degradation of aggregation-prone proteins, protein aggregates, and organelles [59]. In contrast, our approach involves a compound with a sufficiently low molecular weight, which presents a notable advantage in drug development. This compound is amenable to modification, offering potential for the oral treatment of Parkinson disease.
In summary, we have identified a positive candidate compound R406 and its two structure compounds, which could lower SNCA in an autophagy-dependent manner, and we also clarified the compound R406 could alleviate PD-relative phenotype in PFFs-induced cell models and organoid models derived from PD-patient (Figure 7). This will provide a potential new avenue for the treatment of PD.
Figure 7.

Schematic diagram of R406 promoting SNCA protein degradation through the autophagic pathway to rescue the disease phenotype of PD neurons.
Materials and methods
Compound stamping on the microarray
The high-throughput screening was conducted to identify binders for LC3B and SNCA using SMMs. The microarrays consisted of 3,375 compounds, including 1,053 natural compounds from Traditional Chinese Medicine, 1,527 drugs approved by the Food and Drug Administration and 795 known inhibitors. Each compound was printed twice in a vertical direction on homemade glass slides functionalized with phenyl-isocyanate using a contact microarray printer (SmartArrayer 136, CapitalBio Corporation, Beijing, China). The compounds dissolved in DMSO at a concentration of 10 mm. Biotin-BSA at a concentration of 7.6 μM in 1× PBS (Cytiva, SH30256.01) and biotin-(PEG)2-NH2 at a concentration of 5 mm in DMSO were also printed as the inner and the outer borders of SMMs to serve as position markers and positive controls. Following printing, the microarrays were dried at 45°C for 24 h to promote the covalent binding of the nucleophilic groups of the small molecules of the isocyanate groups on the functionalized slides. Finally, the microarrays stored in a −20°C freezer.
SMM screening for potential binding compounds
To facilitate the high-throughput screening of target proteins, a fluidic cartridge was utilized to house a SMM. The SMM was then washed in situ with 1× PBS to remove any excess unbound small molecules. After the wash step, the SMM was scanned using a label-free OI-RD scanning microscope, allowing for the visualization of small molecules immobilized on glass slides. Prior to screening, the SMM was blocked with 7.6 μM BSA (Merck, V900933) in 1× PBS for 30 min. The SMM was then incubated with LC3B at a concentration of 680 nM, followed by SNCA monomer at 690 nM, with each incubation lasting 2 h. Another SMM was incubated with the control protein MBP at a concentration of 500 nM for 2 h. OI-RD images were captured before and after the incubation process for each protein. The obtained OI-RD difference images (image after incubation minus image before incubation) were then subjected to analysis. Vertical bright doublet spots on the difference images indicated compounds that bound to the target proteins.
Compound-protein binary binding kinetics measured by OI-RD
To measure the binding kinetics between compound R406 and target proteins, SMM microarrays with six identical sub-microarrays were prepared by printing compound R406 (10 mm in DMSO) on isocyanate functionalized glass slides with a contact microarray printerCapitalBio Corporation, SmartArrayer 136). The glass slide was assembled into a fluidic cartridge with a separate fluidic chamber for each sub-microarray. Before the binding reaction, the slide was washed in situ with HEPES to remove any excess unbound samples. The slide was blocked with 7.6 μM BSA in HEPES for 10 min. To measure the binding kinetics, HEPES flowed through the microarray for 10 min. After that, the HEPES was replaced with the probe solution for 30 min to initiate the association phase of the reaction. Following this, the target solution was replaced with HEPES again to allow for the dissociation of the probe for 30 min. The concentrations of LC3B used were 1, 2, and 4 μM, and the concentration of the control protein MBP was 4 μM. The concentrations of SNCA were 0.2, 0.4, and 0.8 μM, and the control protein MBP was 0.8 μM. The binding curves of the compound with the target protein were obtained on separate fresh sub-microarrays and were recorded by the OI-RD microscope. The reaction kinetic rate constants were extracted by globally fitting the binding curves using the one-to-one Langmuir reaction model.
Ternary binding kinetics measured by OI-RD
The binding kinetics of LC3 with SNCA were studied in the presence or absence of compound R406 using a protein microarray. The microarray consisted of MBP-LC3 and BSA, printed at concentrations of 9.2 μM and 7.6 μM, respectively. Each glass slide contained six identical protein sub-microarrays, with each protein printed 18 times in a single sub-microarray. The printed protein microarray was assembled into a fluidic cartridge, and the slide was washed in situ with HEPES to remove excess unbound samples. This was followed by blocking with 7.6 μM BSA in HEPES for 10 min. For the binary binding kinetics measurement, three concentrations of SUMO-SNCA (1 μM, 2 μM, and 4 μM) and a control protein sumo at a concentration of 4 μM were flowed over four separate fresh sub-microarrays. In the ternary binding experiment, three concentrations of sumo-SNCA (1, 2, and 4 μM) and a control protein sumo at a concentration of 4 μM were pre-incubated with 40 μM R406 for 2 h and then flown over four separate fresh protein microarrays. Both binary and ternary binding kinetics were recorded using a scanning OI-RD microscope. The reaction kinetic rate constants were extracted by fitting the binding curves globally using the one-to-one Langmuir reaction model.
Recombinant proteins expression and purification
The coding sequences of LC3B and SNCA were commercially synthesized and favored by Escherichia coli. Cloned the sequence into a pMal-C2×-derived vector, HMHT (New England Biolabs, E8200), and a pGEX-6P1-derived vector, pGHT (Cytiva 28,954,648). HMHT contains a His8 tag, a MBP tag and a TEV protease cleavage site, pGHT contains a His8 tag, a GST tag and a TEV protease cleavage site. After sequence validation, the plasmids (MBP-LC3B, MBP-SNCA, GHT-LC3B, GHT-SNCA) were transformed into E. coli BL21 (DE3) pLsyS for expression. Added isopropylthio-β-galactoside/IPTG (Sangon Biotech, A600168) to induce expression when the OD600 of bacteria reached 0.8. The protein expressed under 200 rpm/min and 18°C for 18 h. The cells were harvested by centrifugation at 17,000 × g for 50 min and resuspended in NiA buffer (150 mmol/L NaCl, 5% glycerol, 20 mmol/L imidazole [Sangon Biotech, A600277] and 50 mmol/L Tris buffer, pH 7.5). The cells were ruptured using high pressure and centrifuged for protein collection. After centrifugation, the supernatants were gently mixed with Ni-NTA resin (Cytiva 17,371,202). The resin was washed with NiC buffer (1 mol/L NaCl, 5% glycerol, 20 mmol/L imidazole and 50 mmol/L Tris buffer, pH 7.5) and was eluted with NiB buffer (150 mmol/L NaCl, 5% glycerol, 300 mmol/L imidazole and 50 mmol/L Tris buffer, pH 7.5). The eluted samples were purified by size exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva 28,990,944). To get the tag-free proteins, the NiB-eluted proteins were first cleaved by TEV protease and then reloaded onto the Ni-NTA resin. The tag-free proteins were eluted by NiA buffer and were further purified by size exclusion chromatography.
Bimolecular fluorescence complementation (BiFC)
The Venus protein was split into two fragments, the N-terminal (VN155) and the C-terminal (VC155). These two fluorescent fragments possess the ability to self-assemble when in close proximity, resulting in the emission of a yellow fluorescent signal. The fusion expression sequence of SNCA with VN155 (SNCA-VN155) and the fusion expression sequence of LC3B with VC155 (LC3B-VC155) were synthesized, between which an internal ribosome entry site (IRES) was used to connect. The sequence was cloned into eukaryotic expression vector and overexpressed in HEK293T cells for 24 h, then treated with 10 μM R406 and the autophagy inhibitor bafilomycin A1 (BafA1, 50 nM) for 24 h.
Cell culture and transfection
HEK293 cells were initially obtained from the American Type Culture Collection/ATCC (CRL-1573) and stably expressing the SNCA were cultured in a 37°C, 5% CO2 humidified incubator. The cell culture medium consisted of DMEM (Thermo Fisher Scientific 11,995,065) supplemented with 10% (vol:vol) fetal bovine serum (Thermo Fisher Scientific 10,082–147) and 1% penicillin-streptomycin (Thermo Fisher Scientific 15,140,122). Following the manufacturer’s instructions, the cells were transfected with plasmids or siRNAs using the Lipofectamine 3000 reagent (Thermo Fisher Scientific, L3000015). SYK siRNA target sequence: GCAGCTAGTCGAGCATTATTCTTAT, ATG5 siRNA target sequence: CCTGAACAGAATCATCCTTAA.
Differentiation of human pluripotent stem cells/hPSCs into midbrain organoids
The iPSC line (PD52) was derived from a male patient with young-onset Parkinson disease/YOPD, who was diagnosed at 23 years old with a PINK1 gene mutation. The iPSC line was created at age 26 from peripheral blood mononuclear cells/PBMCs, the cells were reprogrammed using Sendai virus vectors (Thermo Fisher Scientific, A16517). The human sample was collected with informed consent and received full ethical approval from the ethics committee at Nanjing Medical University ([2019] No.485) [60]. The iPSC lines before passage 60 were employed to form human midbrain organoids (hMOs). The iPSCs were first dissociated from intact colonies into smaller pieces using EDTA (STEMCELL 07,174) and subsequently cultured in Essential 8 medium (Gibco, A15169–01) for one day. Then the medium was changed to neuronal induction medium containing DMEM/F12 (Gibco, C11330500BT), 1× N2 supplement (Thermo Fisher Scientific 17,502,001), 1× B27 without vitamin A (Thermo Fisher Scientific 12,587,010), 1% minimum essential media-nonessential amino acid (NEAA; Gibco 11,140), supplemented with SB431542 (10 μM; Torcris, 1614), DMH1 (10 mm; Torcris, 4126), SHH (C25II, 500 ng/ml; R&D Systems, 464-SH) and CHIR99021(TOCRIS 4423/10). On day 9, epithelial colonies were formed and would be floated. At this point, the supplemental factors were changed into SAG (2 µM; Calbiochem 566,660), SHH (C25II, 100 ng/ml), CHIR99021 (0.4 µM) and 100 ng/ml FGD8/FGF8b (PeproTech, 100–25). After 4 days culture with the above medium, SHH and CHIR99021 were removed. The cells continued to be cultured for an additional 6 days. On day 19, SAG was changed to SHH and kept culturing hMOs for 15 days. The plates contained the final differentiation media, which consisted of DMEM/F12, N2, B27, NEAA, BDNF (brain derived neurotrophic factor; 10 ng/ml; PeproTech, 450-02-100), GDNF (glial derived neurotrophic factor; 10 ng/ml; PeproTech, 450–10), ascorbic acid (200 µM; Sigma, A8960), cAMP (1 µM; Sigma, D0260), TGFB3 (1 ng/ml; R&D Systems, 243-B3) and compound E (1 µM; Calbiochem 530,509).
Primary neuron culture
Primary neurons were isolated from newborn rats and mice within 24 h of birth. The cerebral cortex and hippocampal tissues were dissected from the animals. The tissues were then digested using trypsin (Sigma, T1005). The enzymatic digestion was terminated by the addition of DMEM culture medium (Thermo Fisher Scientific 11,965) supplemented with fetal bovine serum. The cells were then filtered through a cell strainer (Merck, SLGP033NS) and seeded onto poly-L-lysine hydrobromide (Sigma, P2636)-coated culture plates. Three hours later, the culture medium was replaced with fresh neuronal culture medium A which contained 2% B27 supplement (Thermo Fisher Scientific 17,504,044), 1% penicillin-streptomycin, and 1% glutamine solution (Thermo Fisher Scientific 35,050,061). Semi-change the neuronal medium every other day.
Preparation of SNCA preformed fibrils (PFFs)
The purified SNCA protein was transferred to PBS buffer (137 mmol/L NaCl, 2.7 mmol/L KCl, 10 mmol/L Na2HPO4 and 1.8 mmol/L KH2PO4, pH 7.4) via dialysis. The protein was then concentrated using a 10 kDa Ultra Centrifugal Filter (Millipore, UFC9010) to achieve a final concentration of 5 mg/ml. The sample was placed on an orbital shaker at 37°C and agitated at 1000 rpm for seven days to generate preformed fibrils (PFFs).
Electron microscopy
SNCA PFFs samples were added to a copper grid coated with a carbon film. Samples were left on the copper mesh for 3–5 min. The excess liquid was absorbed through the filter paper. Then the copper grid was stained with 2% phosphotungstic acid for 2 min. Finally, the samples were dried at room temperature and photographs were taken using Thermo Fisher Scientific Talos L120C transmission electron microscopy.
Protein extraction and western blots
The cells were collected and lysed in a buffer containing PBS, 1% Triton X-100 (Merck, T9284), and 1× Complete protease inhibitor (Sigma-Aldrich 11,697,498,001) by vortexing on ice. After lysis, the cell lysate was collected and centrifuged at 13,523 × g for 15 min at 4°C. The supernatant was transferred to a new microcentrifuge tube, and the protein concentration was determined using a BCA protein quantification assay (Beyotime, P0012). The remaining supernatant samples were mixed with 4× NuPAGE™ LDS Sample Buffer (Thermo Fisher Scientific, NP0007) and 10× DTT (Millipore 233,155). The mixture was then heated at 75°C for 10 min to prepare the samples for loading.
For the western blot analysis, the protein samples were separated using a 5% stacking gel and a 12% resolving gel. After electrophoresis, the separated proteins were transferred from the gel to nitrocellulose membranes (Thermo Fisher Scientific, IB23001). The membrane was blocked with 10% milk for 1 h and incubated with the primary antibody overnight at 4°C. The following day, the membrane was washed with TBST (20 mmol/L Tris-HCl, 150 mmol/L NaCl, 0.1% Tween20 [Sangon Biotech, A100777], pH 7.4) and then incubated with the HRP-conjugated secondary antibodies (Beyotime, A0208 and A0216). Finally, the membrane was developed using ECL reagent (LabLead, E1050) and imaged via a protein gel imaging system (Bio-Rad, Gel Doc XR+ Gel Documentation System). The following primary antibodies were used: anti-SNCA/α-syn (Abcam, ab138501), anti-SNCA/α-syn (Proteintech 10,842–1-AP), anti-TUBB (Abcam, ab6046), anti-SYK (Abcam, ab40781), anti-phospho-SNCA/α-syn (Ser129; Abcam, ab51253), anti-ATG5 (Boster, BM4603), anti-SQSTM1/p62 (Abcam, ab56416), anti-LC3B (Abcam, ab192890), anti-MTOR (Cell Signaling Technology, 2983), anti-phospho-MTOR (Ser2448; Cell Signaling Technology, 5536), anti-RPS6KB/p70 S6 kinase (Cell Signaling Technology, 2708), anti-phospho-RPS6KB/p70 S6 kinase (Thr389; Cell Signaling Technology, 9234).
Quantitative real-time PCR
Cells and primary neurons were collected and lysed on ice for 45 min. Total cellular RNA was extracted using the Rapure Total RNA Micro Kit (Magen, R4012–03) according to the standard operating procedures. The concentration of RNA in the different samples was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, NanoDrop One/OneC). Based on the measured RNA concentrations, the RNA samples were diluted to the same concentration across different samples. Using the FastKing RT Kit (Tiangen Biotech, KR116), the standardized RNA samples were reverse into cDNA according to the manufacturer’s instructions. The SYBR® qPCR Mix (Toyobo, QPX-201) was combined with the gene-specific primers and the cDNA templates. The qPCR reaction was performed on a qPCR system (Agilent Technologies, Mx3000P) using the following program: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s. Data were collected by using AriaMx software. Primers used was as followed: SNCA forward primer: GCCAAGGAGGGAGTTGTGGCTGC, reverse primer: CTGTTGCCACACCATGCACCACTCC; HPRT forward primer: CCTGGCGTCGTGATTAGTG, reverse primer: TGATTAATAAACACCCTTTCCA. Human TUBB qPCR primer pair was purchased (Beyotime, QH00089).
Compound treatment in cells
All compounds used in this study were commercially available and quality-controlled by the suppliers using LS-MASS and NMR. The compounds included R406 (Selleck, S1533), fostamatinib (R788) (Selleck, S2625), fostamatinib (R788) disodium (Selleck, S2206), dofetilide (Selleck, S1658), resminostat (Selleck, S2693), erythromycin (Selleck, S1635), UPF 1069 (Selleck, S8038), travogen (Selleck, S2534), piceatannol (Selleck, S3026), OSU-03012 (Selleck, S1106), pimobendan (Selleck, S1550), KU-60019 (Selleck, S1570), chloroquine (Cell Signaling Technology 14,774), bafilomycin A1 (Baf-A1; Selleck, S1413), rapamycin (Selleck, S1039) and lactacystin (MedChemExpress, HY-16594). The compounds were first dissolved in DMSO (Sigma, D8418) to create stock solutions at concentrations of 10–50 mmol/L, which were then diluted to 1000 times the working concentrations. The drugs were added to the cell culture to achieve a final DMSO concentration of 0.1% in the medium. For the human midbrain organoids, R406 treatment was treated on day 24 of induction. After two weeks of treatment, samples were collected for immunofluorescence analysis.
In vitro affinity-isolation assays
Purified MBP-LC3B (120 µg) protein and 120 μg of MBP protein were each incubated with 60 μL of BeyoMag™ Anti-MBP Magnetic Beads (Beyotime, P2123). The binding reaction was performed at 4°C for 1 h to ensure the proteins were bound to the beads. The beads were cleaned with PBST (137 mmol/L NaCL, 2.7 mmol/L KCl, l0 mmol/L Na2HPO4, 1.8 mmol/L KH2PO4 and 0.1% Tween20, pH 7.4) and evenly distributed into 6 individual 1.5-ml microcentrifuge tubes. The corresponding small molecule stock solutions were added to each tube to achieve final concentrations of 0 nM, 50 nM, 500 nM, 5 μM, and 50 μM. After incubating the protein and small molecules at room temperature for 1 h, 20 μg of purified SNCA protein was added to the samples. The samples were then placed at 4°C and rotated overnight to thoroughly mix. The complexes were taken out the next day and washed with PBST buffer. They were then combined with 1× loading buffer and vortexed. Afterward, the mixture was heated at 95°C for 10 min to fully dissolve the proteins that had been bound to the magnetic beads within the 1× loading buffer. The sample was then centrifuged at 13,523 × g for 15 min at 4°C. The supernatant was collected and used for western blot analysis.
Cell imaging by IncuCyte
After 7 days of primary neuron culture, PFFs and drug treatments were added, and the samples were placed in an incubator for interval imaging using IncuCyte technology (Essen Bioscience, IncuCyte ZOOM). In the phase-contrast setting, each well was divided into 16 fields of view, which were imaged every 6 h. The changes in axonal length for each well were analyzed using the Neurotrack software, which identifies neuronal cell bodies and axons, allowing assessment of axonal damage based on the ratio of axonal length to cell body size. Changes in this ratio over time were plotted to compare the treated and control groups, determining whether the drug had a neuroprotective effect.
Immunofluorescence and imaging
Primary neurons or HEK293 cells were cultured on round coverslips (Biosharp, BS-20-RC) coated with poly-L-lysine (Merck, P2636). Immunocytochemistry staining was performed after primary neurons were treated with PFFs and drugs for 8 days or R406 treatment with CQ or rapamycin at different time points. The samples were fixed with 4% paraformaldehyde (Biotend, RE202001) for 15 min, followed by blocking and permeabilization with 2% BSA (Sigma, V900933) and 1% Triton X-100 for 30 min. The liquid on the coverslip surface was removed, and primary antibodies anti-phospho-SNCA (Ser129; Abcam, ab51253), anti-MAPT/tau (Cell Signaling Technology, 4019T), anti-LC3B (Thermo Fisher Scientific, PA1–16930), anti-SNCA/α-syn (BD Transduction Laboratories™, AB_398107) and anti-SQSTM1/p62 (Proteintech 18,420–1-AP) were added. The samples were incubated overnight at 4°C. The following day, the coverslips were removed and washed three times with PBS. A mixed secondary antibody solution of Alexa Fluor 488 (Abcam, Ab150073 or Thermo Fisher Scientific, A-11008), Alexa Fluor 594 (Abcam, Ab150080 or Thermo Fisher Scientific, A-11032) were applied and incubated in the dark for 1 h. After staining with DAPI (Beyotime, C1005) for 15 min, the samples were mounted and imaged. Fluorescent imaging of the coverslips was performed using the Zeiss LSM 880 and High-Content Screening (PerkinElmer, Operetta CLS). Based on the imaging results, ImageJ was used to quantify and analyze the p-S129-SNCA levels in different samples.
Cells were washed with cold PBS and 4% paraformaldehyde for 20 min followed by staining with DAPI and photographed using a confocal laser microscope.For the organoids, hMOs were washed three times with 1× PBS, followed by fixation in 4% paraformaldehyde (Beyotime Biotechnology, P0099) for 4 h. After washing with PBS to remove the paraformaldehyde, the samples were treated overnight at 4°C with a 30% (wt:vol) sucrose solution for dehydration. Subsequently, the tissues were stored in optimal cutting temperature (O.C.T.) compound (Sakura, 4583), and each section was cut to a thickness of 12 µm for immunostaining. Standard procedures were executed for tissue cryosections to perform immunostaining. The cryosections were washed three times with 1× PBS. Then, the cryosections were blocked with a solution of 5% donkey serum (Millipore, S30-KC) and 1% Triton X-100 in 1× PBS for one hour. Following this, the primary antibody was incubated overnight at 4°C. The next day, cryosections were washed with 1× PBS three times, followed by secondary antibody at room temperature for 1 h and stained with Hochest (Life, H1399) for 10 min. Commercially purchased antibodies included anti-TH (Pel-Freez, P40101), anti-SOX2 (Bio-Techne, AF2018), anti-DCX (Cell Signaling Technology, 4604), anti-OTX2 (R&D Systems, AF1979), anti-FOXA2 (Santa Cruz Biotechnology, sc -374,376), anti-NES/nestin (Santa Cruz Biotechnology, sc -21,247), anti-CORIN (R&D Systems, MABA2209), anti-TH, (Pel-Freez, P40101), anti-SNCA/α-syn (Abcam, ab138501), CellROX™ Green (Thermo Fisher Scientific, C10444). Fluorescent secondary antibodies included Donkey anti-Mouse IgG (H+L) Highly Cross (Thermo Fisher Scientific, A-21202), Goat anti-Rabbit IgG (H+L) Highly Cross (Thermo Fisher Scientific, A11037) and Anti-Mouse (Thermo Fisher Scientific, A21202), Anti-Rat (Thermo Fisher Scientific, A48270), Anti-Rabbit (Thermo Fisher Scientific, A10040), Anti-Goat (Thermo Fisher Scientific, AOPO1105).
Immunoprecipitation
HEK293T cells were cultured in a 10-cm dish, transfected with plasmid SNCA and LC3B-HA, then added R406 and 50 nM BafA1 (blocking protein degradation in autophagy). After 24 h, cells were washed three times with cold 1×PBS. Triton X-100 (1%) was added to the cells and lysed at 4°C for 45 min. The soluble component is obtained by centrifugation at 13,523 × g at 4°C for 15 min. 50 μL anti-magnetic beads were added to the centrifuge supernatant and incubated overnight at 4°C in constant rotation. The pellet was washed 3 times with a wash buffer containing 50 mm Tris-HCl, 150 mm NaCl, 2 mm EDTA, 0.5% Tween-20 (pH 7.2). The immunoprecipitated proteins were eluted with 50 μL 1× SDS-loading Buffer at 95°C for 5 min. SDS-PAGE test was performed.
Statistical analysis
To ensure a statistical power greater than 0.8, power analyses for each assay were conducted using estimated values from PASS 16 (https://www.ncss.com/software/pass/) prior to the experiments. Statistical comparisons between two groups were performed using unpaired two-tailed t-tests. For comparisons among multiple groups, one-way ANOVA was used, followed by post hoc tests for specific comparisons: Dunnett’s test for comparisons with a single control and Bonferroni’s test for comparisons among different groups. Two-way ANOVA was used in statistical comparisons for data collected at different time points. GraphPad Prism 7 and Microsoft Excel 2021were used to perform data analysis.
Supplementary Material
Acknowledgements
We thank the following for funding support: National Natural Science Foundation of China (32200797, 81925012, 82450901, 32271510, 82030106).
Funding Statement
The work was supported by the National Natural Science Foundation of China [32200797]; National Natural Science Foundation of China [81925012]; National Natural Science Foundation of China [82450901]; National Natural Science Foundation of China [32271510]; National Natural Science Foundation of China [82030106].
Disclosure statement
No potential conflict of interest was reported by the author(s).
Data availability statement
The data that support the findings of this study are available from the corresponding authors upon reasonable request.
Supplementary material
Supplemental data for this article can be accessed online at https://doi.org/10.1080/15548627.2025.2483886
References
- [1].Farrer MJ. Genetics of parkinson disease: paradigm shifts and future prospects. Nat Rev Genet. 2006;7(4):306–318. doi: 10.1038/nrg1831 [DOI] [PubMed] [Google Scholar]
- [2].Feigin VL, Abajobir AA, Abate KH, et al. Global, regional, and national burden of neurological disorders during 1990–2015: a systematic analysis for the global burden of disease study 2015. Lancet Neurol. 2017;16(11):877–897. doi: 10.1016/S1474-4422(17)30299-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Raza C, Anjum R, Shakeel NU. Parkinson’s disease: mechanisms, translational models and management strategies. Life Sci. 2019;226:77–90. [DOI] [PubMed] [Google Scholar]
- [4].Jankovic J. Parkinson’s disease: clinical features and diagnosis. J Neurol Neurosur Ps. 2008;79(4):368–376. doi: 10.1136/jnnp.2007.131045 [DOI] [PubMed] [Google Scholar]
- [5].Giguère N, Nanni SB, Trudeau LE. On cell loss and selective vulnerability of neuronal populations in Parkinson’s disease. Front Neurol. 2018;9. doi: 10.3389/fneur.2018.00455 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Kalia LV, Lang AE. Parkinson’s disease. Lancet. 2015;386(9996):896–912. doi: 10.1016/S0140-6736(14)61393-3 [DOI] [PubMed] [Google Scholar]
- [7].Ueda K, Fukushima H, Masliah E, et al. Molecular cloning of cDNA encoding an unrecognized component of amyloid in alzheimer disease. Proc Natl Acad Sci USA. 1993;90(23):11282–11286. doi: 10.1073/pnas.90.23.11282 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Lashuel HA, Overk CR, Oueslati A, et al. The many faces of α-synuclein: from structure and toxicity to therapeutic target. Nat Rev Neurosci. 2013;14(1):38–48. doi: 10.1038/nrn3406 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Wang CC, Zhao CY, Li D, et al. Versatile structures of α-synuclein. Front Mol Neurosci. 2016;9. doi: 10.3389/fnmol.2016.00048 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Lees AJ, Hardy J, Revesz T. Parkinson’s disease. Lancet. 2009;374(9691):684–684. [Google Scholar]
- [11].Chau KY, Ching HL, Schapira AHV, et al. Relationship between alpha synuclein phosphorylation, proteasomal inhibition and cell death: relevance to Parkinson’s disease pathogenesis. J Neurochem. 2009;110(3):1005–1013. doi: 10.1111/j.1471-4159.2009.06191.x [DOI] [PubMed] [Google Scholar]
- [12].Singleton AB, Farrer M, Johnson J, et al. α-synuclein locus triplication causes Parkinson’s disease. Science. 2003;302(5646):841–841. doi: 10.1126/science.1090278 [DOI] [PubMed] [Google Scholar]
- [13].Chartier-Harlin MC, Kachergus J, Roumier C, et al. α-synuclein locus duplication as a cause of familial Parkinson’s disease. Lancet. 2004;364(9440):1167–1169. doi: 10.1016/S0140-6736(04)17103-1 [DOI] [PubMed] [Google Scholar]
- [14].Majbour NK, Vaikath NN, van Dijk KD, et al. Oligomeric and phosphorylated alpha-synuclein as potential CSF biomarkers for Parkinson’s disease. Mol Neurodegener. 2016;11(1):11. doi: 10.1186/s13024-016-0072-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].LeWitt PA, Hauser RA, Pahwa R. Safety and efficacy of CVT-301 (levodopa inhalation powder) on motor function during off periods in patients with Parkinson’s disease: a randomised, double-blind, placebocontrolled phase 3 trial. Lancet Neurol. 2019;18(3):E2–E2. [DOI] [PubMed] [Google Scholar]
- [16].Fox SH, Katzenschlager R, Lim S, et al. International parkinson and movement disorder society evidence-based medicine review: update on treatments for the motor symptoms of Parkinson’s disease. Mov Disord. 2018;33(8):1992–1992. doi: 10.1002/mds.27372 [DOI] [PubMed] [Google Scholar]
- [17].Gray R, Ives N, Rick C, et al. Long-term effectiveness of dopamine agonists and monoamine oxidase B inhibitors compared with levodopa as initial treatment for Parkinson’s disease (PD MED): a large, open-label, pragmatic randomised. Lancet. 2014;384(9949):1196–1205. doi: 10.1016/S0140-6736(14)60683-8 [DOI] [PubMed] [Google Scholar]
- [18].Fabbri M, Ferreira JJ, Rascol O. COMT inhibitors in the management of Parkinson’s disease. CNS Drugs. 2022;36(3):261–282. doi: 10.1007/s40263-021-00888-9 [DOI] [PubMed] [Google Scholar]
- [19].Fasano A, Aquino CC, Krauss JK, et al. Axial disability and deep brain stimulation in patients with parkinson disease. Nat Rev Neurol. 2015;11(2):98–110. doi: 10.1038/nrneurol.2014.252 [DOI] [PubMed] [Google Scholar]
- [20].Niu SQ, Zhang LK, Zhang L, et al. Inhibition by multifunctional magnetic nanoparticles loaded with alpha-synuclein RNAi plasmid in a Parkinson’s disease model. Theranostics. 2017;7(2):344–356. doi: 10.7150/thno.16562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Uehara T, Choong CJ, Nakamori M, et al. Amido-bridged nucleic acid (AmNA)-modified antisense oligonucleotides targeting α-synuclein as a novel therapy for Parkinson’s disease. Sci Rep-Uk. 2019;9(1). doi: 10.1038/s41598-019-43772-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Zharikov A, Bai Q, De Miranda BR, et al. Long-term RNAi knockdown of α-synuclein in the adult rat substantia nigra without neurodegeneration. Neurobiol Dis. 2019;125:146–153. doi: 10.1016/j.nbd.2019.01.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Kantor B, Tagliafierro L, Gu J, et al. Downregulation of SNCA expression by targeted editing of DNA methylation: a potential strategy for precision therapy in PD. Mol Ther. 2018;26(11):2638–2649. doi: 10.1016/j.ymthe.2018.08.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Nixon RA. The role of autophagy in neurodegenerative disease. Nat Med. 2013;19(8):983–997. doi: 10.1038/nm.3232 [DOI] [PubMed] [Google Scholar]
- [25].Webb JL, Ravikumar B, Atkins J, et al. α-Synuclein is degraded by both autophagy and the proteasome. J Biol Chem. 2003;278(27):25009–25013. doi: 10.1074/jbc.M300227200 [DOI] [PubMed] [Google Scholar]
- [26].Klucken J, Poehler AM, Ebrahimi-Fakhari D, et al. Alpha-synuclein aggregation involves a bafilomycin a 1-sensitive autophagy pathway. Autophagy. 2012;8(5):754–766. doi: 10.4161/auto.19371 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Wu AG, Zeng W, Wong VKW, et al. Hederagenin and α-hederin promote degradation of proteins in neurodegenerative diseases and improve motor deficits in mptp-mice. Pharmacol Res. 2017;115:25–44. doi: 10.1016/j.phrs.2016.11.002 [DOI] [PubMed] [Google Scholar]
- [28].Li Z, Wang C, Wang Z, et al. Allele-selective lowering of mutant HTT protein by HTT–LC3 linker compounds. Nature. 2019;575(7781):203–209. doi: 10.1038/s41586-019-1722-1 [DOI] [PubMed] [Google Scholar]
- [29].Li ZY, Zhu CG, Ding Y, et al. ATTEC: a potential new approach to target proteinopathies. Autophagy. 2020;16(1):185–187. doi: 10.1080/15548627.2019.1688556 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Zhu CG, Zhu XD, Landry JP, et al. Developing an efficient and general strategy for immobilization of small molecules onto microarrays using isocyanate chemistry. Sensors-Basel. 2016;16(3):378. doi: 10.3390/s16030378 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Fei YY, Landry JP, Sun YS, et al. Screening small-molecule compound microarrays for protein ligands without fluorescence labeling with a high-throughput scanning microscope. J Biomed Opt. 2010;15(1):16018. doi: 10.1117/1.3309743 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Kabeya Y, Mizushima N, Ueno T, et al. LC3, a mammalian homolog of yeast Apg8p, is localized in autophagosome membranes after processing. Embo J. 2003;22(17):4577–4577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Kodama Y, Hu CD. An improved bimolecular fluorescence complementation assay with a high signal-to-noise ratio. Biotechniques. 2010;49(5):793–805. doi: 10.2144/000113519 [DOI] [PubMed] [Google Scholar]
- [34].Pamuk ON, Tsokos GC. Spleen tyrosine kinase inhibition in the treatment of autoimmune, allergic and autoinflammatory diseases. Arthritis Res Ther. 2010;12(6):222. doi: 10.1186/ar3198 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].Bennett MC, Bishop JF, Leng Y, et al. Degradation of α-synuclein by proteasome. J Biol Chem. 1999;274(48):33855–33858. doi: 10.1074/jbc.274.48.33855 [DOI] [PubMed] [Google Scholar]
- [36].Klionsky DJ, Abdalla FC, Abeliovich H, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy. 2012;8(4):445–544. doi: 10.4161/auto.19496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Hanson HH, Kang S, Fernandez-Monreal M, et al. LC3-dependent intracellular membrane tubules induced by γ-protocadherins A3 and B2. J Biol Chem. 2010;285(27):20982–20992. doi: 10.1074/jbc.M109.092031 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [38].Sanjuan MA, Dillon CP, Tait SW, et al. Toll-like receptor signalling in macrophages links the autophagy pathway to phagocytosis. Nature. 2007;450(7173):1253–1257. doi: 10.1038/nature06421 [DOI] [PubMed] [Google Scholar]
- [39].Dias V, Junn E, Mouradian MM. The role of oxidative stress in Parkinson’s disease. J Parkinson’s Disease. 2013;3(4):461–491. doi: 10.3233/JPD-130230 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [40].Wang Y, Wei TZ, Zhao M, et al. Alkenyl oxindole is a novel PROTAC moiety that recruits the CRL4 E3 ubiquitin ligase complex for targeted protein degradation. PLOS Biol. 2024;22(5):e3002550. doi: 10.1371/journal.pbio.3002550 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Xue G, Xie J, Hinterndorfer M, et al. Discovery of a drug-like, natural product-inspired DCAF11 ligand chemotype. Nat Commun. 2023;14(1):7908. doi: 10.1038/s41467-023-43657-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [42].Zhong C, Wang Z, Li Z, et al. Mechanisms mediating arylidene-indolinones induced degradation: thoughts on “discovery of a drug-like, natural product-inspired, DCAF11 ligand chemotype”. 2024.
- [43].Liao XF, Qin G, Liu ZQ, et al. Bioorthogonal aptamer-attec conjugates for degradation of alpha-synuclein via Autophagy-Lysosomal Pathway. Small. 2024;20(8). [DOI] [PubMed] [Google Scholar]
- [44].Pei JP, Pan XL, Wang AX, et al. Developing potent LC3-targeting AUTAC tools for protein degradation with selective autophagy. Chem Commun. 2021;57(97):13194–13197. doi: 10.1039/D1CC04661F [DOI] [PubMed] [Google Scholar]
- [45].Dong GQ, Wu Y, Cheng JF, et al. Ispinesib as an effective warhead for the design of autophagosome-tethering chimeras: discovery of potent degraders of nicotinamide phosphoribosyltransferase (NAMPT). J Med Chem. 2022;65(11):7619–7628. [DOI] [PubMed] [Google Scholar]
- [46].Zeng YP, Xiao J, Xu YX, et al. Degradation of cyclin-dependent kinase 9/Cyclin T1 by optimized microtubule-associated protein 1 light chain 3 beta-recruiting coumarin analogs. J Med Chem. 2023;66(18):12877–12893. doi: 10.1021/acs.jmedchem.3c00828 [DOI] [PubMed] [Google Scholar]
- [47].Bao JY, Chen ZQ, Li Y, et al. Discovery of novel PDEδ autophagic degraders: a case study of autophagy-tethering compound (ATTEC). ACS Med Chem Lett. 2023;15(1):29–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [48].Ouyang ZR, Ma MY, Zhang ZW, et al. Targeted degradation of PCSK9 in vivo by autophagy-tethering compounds. J Med Chem. 2023;67(1):433–449. doi: 10.1021/acs.jmedchem.3c01634 [DOI] [PubMed] [Google Scholar]
- [49].Date Y, Sasazawa Y, Kitagawa M, et al. Novel autophagy inducers by accelerating lysosomal clustering against Parkinson’s disease. Elife. 2024;13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [50].Zhu Q, Song J, Chen JY, et al. Corynoxine B targets at HMGB1/2 to enhance autophagy for α-synuclein clearance in fly and rodent models of Parkinson’s disease. Acta Pharm Sin B. 2023;13(6):2701–2714. doi: 10.1016/j.apsb.2023.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [51].Wu AG, Pan R, Law BYK, et al. Targeting autophagy as a therapeutic strategy for identification of liganans from peristrophe japonica in Parkinson’s disease. Signal Transduct Tar. 2021;6(1). doi: 10.1038/s41392-020-00442-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- [52].He PK, Gao YY, Lyu FJ, et al. Idebenone-activating autophagic degradation of α-synuclein via inhibition of akt-mTOR pathway in a SH-SY5Y-A53T model of Parkinson’s disease: a network pharmacological approach. Evid-Based Compl Alt. 2021;2021:1–14. doi: 10.1155/2021/8548380 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [53].Xu J, Ao YL, Huang CH, et al. Harmol promotes α-synuclein degradation and improves motor impairment in Parkinson’s models via regulating autophagy-lysosome pathway. NPJ Parkinsons Dis. 2022;8(1). doi: 10.1038/s41531-022-00361-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [54].Poole A, Gibbins JM, Turner M, et al. The Fc receptor γ-chain and the tyrosine kinase syk are essential for activation of mouse platelets by collagen. Embo J. 1997;16(9):2333–2341. doi: 10.1093/emboj/16.9.2333 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [55].Abtahian F, Guerriero A, Sebzda E, et al. Regulation of blood and lymphatic vascular separation by signaling proteins SLP-76 and Syk. Science. 2003;299(5604):247–251. doi: 10.1126/science.1079477 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [56].Ziegenfuss JS, Biswas R, Avery MA, et al. Draper-dependent glial phagocytic activity is mediated by Src and Syk family kinase signalling. Nature. 2008;453(7197):935–U68. doi: 10.1038/nature06901 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [57].Turner M, Schweighoffer E, Colucci F, et al. Tyrosine kinase SYK: essential functions for immunoreceptor signalling. Immunol Today. 2000;21(3):148–154. [DOI] [PubMed] [Google Scholar]
- [58].Lee J, Sung KW, Bae EJ, et al. Targeted degradation of α-synuclein aggregates in Parkinson’s disease using the AUTOTAC technology. Mol Neurodegener. 2023;18(1):41. doi: 10.1186/s13024-023-00630-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [59].Jiang Z, Kuo YH, Arkin MR. Autophagy receptor-inspired antibody-fusion proteins for targeted intracellular degradation. J Am Chem Soc. 2023;145(44):23939–23947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [60].Zhu W, Tao M, Hong Y, et al. Dysfunction of vesicular storage in young-onset Parkinson’s patient-derived dopaminergic neurons and organoids revealed by single cell electrochemical cytometry. Chem Sci. 2022;13(21):6217–6223. doi: 10.1039/D2SC00809B [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding authors upon reasonable request.
