Skip to main content
NCBI home page
Brain Circulation logoLink to Brain Circulation
. 2025 Jul 3;11(3):200–211. doi: 10.4103/bc.bc_16_24

Expression profiles and potential clinical significance of circular RNAs in peripheral neutrophils of patients with intracranial atherosclerotic stenosis

Ziping Han 1,#, Tao Wang 1,#, Lingzhi Li 1, Junfen Fan 1, Rongliang Wang 1, Yangmin Zheng 1, Feng Yan 1, Haiping Zhao 1, Yumin Luo 1,2,✉, Liqun Jiao 1,2,✉
PMCID: PMC12367264  PMID: 40842453

Abstract

BACKGROUND:

Expression profiles and clinical significance of circular RNAs (circRNAs) in intracranial atherosclerotic stenosis (ICAS) patients have not been investigated yet.

MATERIALS AND METHODS:

A circRNA microarray was employed to identify differentially expressed circRNAs (DEcircRNAs) in peripheral neutrophils of ICAS patients. The levels of upregulated hsa-circRNA-087631/hsa-circRNA-101141 and downregulated hsa-circRNA-100914/hsa-circRNA-001082 were verified using quantitative real-time polymerase chain reaction (qRT-PCR). In addition, we compared the levels of those four DEcircRNAs before endovascular treatment (pre-E) and 24 h after endovascular treatment (post-E) and between patients with adverse event and severe adverse event (AE/SAE) and those without. Their area under the curve from the receiver operating characteristic (ROC) curve was calculated as well. Bioinformatic analyses of DEcircRNAs host genes and targeted genes in DEcircRNA-miRNA-mRNA regulatory network were further performed.

RESULTS:

A total of 70 circRNAs were identified as differentially expressed in patients with ICAS; of these, 7 were upregulated and 63 were downregulated. qRT-PCR-based validation results of the four DEcircRNAs corresponded with the microarray data. The upregulated hsa-circRNA-087631 and hsa-circRNA-101141 were significantly downregulated 24 h post-E; moreover, they were significantly increased in patients with perioperative AE/SAE compared to those without AE/SAE. ROC analysis further supported their potential to be exploited as diagnostic biomarkers for ICAS. The validated DEcircRNA-miRNA-mRNA regulatory network and further bioinformatic analysis supported the core roles of hsa-circRNA-101141 in regulating target genes mainly related to actin or microtubule-based process.

CONCLUSIONS:

DEcircRNAs in peripheral neutrophils could serve as biomarkers for the diagnostic and AE prediction in ICAS patients receiving endovascular treatment. Moreover, these DEcircRNAs, especially hsa-circRNA-101141-hsa-miRNA-181d axis, might participate in the pathogenesis of ICAS by acting on actin or microtubule-based cytoskeleton organization processes in neutrophils.

TRIAL REGISTRATION:

The CRTICAS study has been registered previously in the ClinicalTrial.gov database (NCT01994161).

Keywords: Circular RNA, cytoskeleton, intracranial atherosclerotic stenosis, neutrophils

Introduction

Intracranial atherosclerotic stenosis (ICAS) remains one of the major causes of ischemic stroke, especially among Asian populations. The prevalence of symptomatic ICAS could be as high as 46.6% in Chinese patients diagnosed with ischemic stroke.[1] Owing to the disadvantageous results of the SAMMPRIS study, interventional treatments for ICAS are routinely discouraged.[2] An improved understanding of the pathophysiological processes underlying the occurrence and development of ICAS may not only assist in prognostication and risk stratification of interventional treatments but also aid in selecting an optimal treatment for ICAS patients; this is particularly beneficial for those who fail to respond to active medical treatment.

Circular RNAs (CircRNAs) are stable, sequence-conservative, and tissue-specific RNA molecules, due to their covalent bonds between two ends.[3,4] They participate in transcriptional and posttranscriptional regulation of various genes through acting as miRNA sponges (predominantly in the cytoplasm) as well as promoting the transcription of their host genes (or parental genes) by interacting with the U1-small nuclear ribonucleoprotein complex and RNA polymerase II in the nucleus.[5,6] Recent studies have reported the alteration of circRNAs levels using in vivo and in vitro cerebral ischemic models as well as in patients.[7,8,9,10] Notably, the circRNA-0006896-miR1264-DNMT1 axis has been reported to play a vital role in atherosclerosis, including involving in carotid plaque destabilization through targeting endothelial cells.[11,12,13] However, whether circRNAs participate in the pathogenesis of ICAS has not been investigated yet.

Atherosclerosis is increasingly considered a chronic inflammatory disease of vascular walls and vascular response to pathogenic factors remains the main cause of cardiovascular and cerebrovascular events.[14,15] Moreover, synthetic adropin has been proved to reduce monocyte/macrophage transmigration across endothelial cells in vitro, which is inspiring for potential therapeutic to vascular injuries.[16] As the largest proportion of immune cells, neutrophils are involved in various aspects of cerebrovascular disease. In addition, recent studies have reported that circulating neutrophil levels are associated with the occurrence of ICAS, which suggests that neutrophils might involve in the pathogenesis of symptomatic ICAS; however, underlying specific mechanisms are yet to be inspected.[17,18] Thus, we aimed to investigate expression profiles of circRNAs from circulating neutrophils of ICAS patients, examine their clinical significance, and explore the potential roles that differentially expressed circular RNAs (DEcircRNAs) play in ICAS.

Materials and Methods

Patient enrollment and isolation of peripheral neutrophils

Five male symptomatic patients with ICAS and five age-matched healthy controls (including four males and one female) were enrolled for DEcircRNA detection using microarray, which was a post hoc analysis of the Clinical Registration Trial of Intracranial Stenting for Patients with Symptomatic Intracranial Artery Stenosis (CRTICAS).[19] For the validation part, another cohort of ICAS patients and controls, who have been drawn peripheral blood in Xuanwu Hospital in the CRTICAS study were included for further examination and analysis. The specific inclusion and exclusion criteria for ICAS patient enrollment were the same as previously described.[19] In addition, blood samples were drawn from some patients 24 h after endovascular treatment. The corresponding flowchart is shown in Figure 1.

Figure 1.

Figure 1

Open in a new tab

Design and flowchart of the present study aiming at exploring expression profiles and potential clinical significance of differentially expressed circular RNAs in peripheral neutrophils of patients with symptomatic intracranial atherosclerotic stenosis. ICAS: Intracranial atherosclerotic stenosis, DEcircRNAs: Differentially expressed circular RNA, Pre-E: Before endovascular therapy. Post-E, 24 h after endovascular therapy, AE: Adverse event, SAE: Severe adverse event, RT-PCR: Reverse transcription-polymerase chain reaction

Peripheral neutrophils were isolated from the venous blood of participants as previously described.[20]

RNA extraction, circular RNA array detection, and data processing

Total neutrophil RNA was extracted using TRIzol (Invitrogen, USA). NanoDrop ND-1000 was employed to assess the quantity and quality of the extracted RNA. The human circRNA array was then hybridized according to the manufacturer’s protocol (Arraystar Inc.). The detailed procedure can be found in a previous article.[18]

CircRNA array data were analyzed using Gene-Spring V13.0. Genes were considered differentially expressed when the fold change was ≥2 and P < 0.05. Hierarchical clustering was conducted after log2 transformation using CLUSTER 3.0 software. In addition, a volcano plot was performed to distinguish the DEcircRNAs in the peripheral neutrophils of ICAS patients from those of the healthy controls.

Bioinformatic analysis and functional prediction of the host genes of differentially expressed circular RNAs

GO enrichment and KEGG pathway analyses of the host genes (or source genes) of the top 70 DEcircRNAs were performed to explore their potential functions and underlying mechanisms. Briefly, GO analyses (www.geneontology.org) included biological process (BP), cellular component, and molecular function (MF). KEGG analyses were performed to investigate the enriched pathways, in which DEcircRNAs might play roles (http://www.genome.jp/kegg).

Validation of differentially expressed circular RNA levels using qRT-PCR and construction of a differentially expressed circular RNA-miRNA-mRNA regulatory network

To verify circRNA levels detected in the circRNA array, another cohort of ICAS patients (n = 27, 18 males) and healthy controls (n = 16, 8 males) was enrolled. Blood was drawn again from some of the enrolled patients with ICAS (n = 22) 24 h after receiving endovascular treatment. Perioperative adverse events (AE), the intraoperative critical value, and clinically asymptomatic infarction confirmed by postoperative DWI and severe adverse events (SAE), defined as any AE requiring unexpected surgical intervention, are important indices for evaluating the success of recanalization surgery. To explore the potential roles of DEcircRNAs in predicting perioperative AEs, the patients were followed up for 7 days after recanalization surgery (n = 27) to assess whether they had AE/SAE.

qRT-PCR was performed to verify DEcircRNAs levels (including two upregulated circRNAs hsa-circRNA-087631 and hsa-circRNA-101141 and two downregulated circRNAs hsa-circRNA-100914 and hsa-circRNA-001082) identified in the circRNA array. qRT-PCR was operated as previously.[19] Specific primers are listed in Table 1; β-actin or U6 served as internal references. Based on the competing endogenous RNA (ceRNA) theory, we constructed DE circRNA-targeted miRNA-targeted mRNA interaction networks using TargetScan and miRanda (Arraystar). Followingly, GO and KEGG enrichment analyses of these targeted mRNAs were performed as well.

Table 1.

Primer sequences of four verified differentially expressed circular RNAs and the target miRNAs

CircRNAs or miRNAs Primer sequence (5’–3’) Product length (bp)
has-circRNA-087631 Forward: 5’ATGGAGGAACCCACAGTGGTG 3’
Reverse: 5’TCTAGGAGTCCGCTTCTGGCTT 3’		 82
has-circRNA-101141 Forward: 5’CTCGCACCTTGTCGCTTAGAT 3’
Reverse: 5’TCACAGCATTCCGATATTCCTT 3’		 120
has-circRNA-100914 Forward: 5’TGCTGCAACAATGACTTAATTC 3’
Reverse: 5’TCTGCCAACTGTGGGATGT 3’		 65
has-circRNA-001082 Forward: 5’GTCAGGACCCTGGGCTGTT3’
Reverse: 5’CCTCAGTCCCAGCCCTTCA3’		 94
has-miRNA-181d-5p GSP: 5’GGGGCATTCATTGTTGTCG3’
Reverse: 5’GTGCGTGTCGTGGAGTCG3’		 63
has-miRNA-338-3p GSP: 5’GGGGGTCCAGCATCAGTGA3’
Reverse: 5’GTGCGTGTCGTGGAGTCG3’		 65
β-actin Forward: 5’GTGGCCGAGGACTTTGATTG3’
Reverse: 5’CCTGTAACAACGCATCTCATATT3’		 73
U6 Forward: 5’GCTTCGGCAGCACATATACTAAAAT3’
Reverse: 5’CGCTTCACGAATTTGCGTGTCAT3’		 89
Open in a new tab

GSP stands for specific primer for the corresponding miRNAs and reverse for a matching primer. CircRNA: Circular RNA, bp: Base pair

Statistical analysis

All data were described as mean ± SEM and analyzed using SPSS 22.0 software (SPSS Inc., USA). Student’s t-test was applied for comparing two groups when the data were distributed normally while Mann–Whitney U-test was used if nonnormal. One-way ANOVA was employed to compare three or more groups. The receiver operating characteristic (ROC) curve was performed to calculate the diagnostic potential of DE circRNAs. The area under the curve (AUC) was exploited to evaluate their diagnostic efficacy. Statistical significance was set at P < 0.05.

Results

Differentially expressed circular RNAs profiles in the peripheral neutrophils of intracranial atherosclerotic stenosis patients

According to the circRNA microarray, hierarchical clustering distinguished the DEcircRNAs in peripheral neutrophils of ICAS patients from those in healthy controls [Figure 2a]. In total, 170340 circRNAs were sequenced, of which 70 were significantly differential expressed between patients with ICAS and controls according to the filtering criteria. Among these DEcircRNAs, seven circRNAs were significantly upregulated, while 63 were markedly downregulated, as shown in the volcano plot [Figure 2b]. Hsa-circRNA-0087631 was the most upregulated circRNA, with an upregulation expression ratio of 7.968, and hsa-circRNA-100914 was the most downregulated one, with a downregulation expression ratio of 5.493.

Figure 2.

Figure 2

Open in a new tab

Differentially expressed circular RNAs (circRNAs) in peripheral neutrophils of intracranial atherosclerotic stenosis (ICAS) patients compared with those in healthy controls, as detected via circRNA array. (a) Heat map of differentially expressed circRNAs in peripheral neutrophils of patients with ICAS compared with those in healthy controls. (b) Volcano plots of differentially expressed circRNAs in peripheral neutrophils of ICAS patients and healthy controls. Red dots represented circRNAs that were significantly aberrantly expressed, and grey ones indicated these that were not (Fold change ≥2.0, P < 0.05, n = 5 per group, Mann–Whitney U-test for comparison between two samples). ICAS: Intracranial atherosclerotic stenosis, circRNA: Circular RNA

Bioinformatic analyses of differentially expressed circular RNA host genes

CircRNAs are well-known to regulate the transcription of their host genes. Thus, GO and KEGG enrichment analyses of host genes of these DEcircRNAs were carried out to explore their potential pathophysiological significance in ICAS. GO analyses demonstrated that the MFs of these host genes comprised phosphoprotein phosphatase activity (especially tyrosine/serine/threonine) and binding with enzymes, such as tau protein and protein kinase [Figure 3c]. They might participate in such BPs as the organization of organelles and supramolecular fibers [Figure 3a]. Correspondingly, they were predicted to be widely distributed in cytosol, nuclear periphery, nuclear matrix, actin filament, cytoskeleton, intracellular nonmembrane-bound organelles, and phosphatase complex (including serine/threonine phosphatase complex) [Figure 3b]. KEGG analyses showed that these host genes were enriched in pathways such as mRNA surveillance, regulation of actin cytoskeleton, nucleocytoplasmic transport, sphingolipid signaling, and platelet activation [Figure 3d].

Figure 3.

Figure 3

Open in a new tab

GO and KEGG enrichment analyses of the host genes of differentially expressed circular RNAs (DEcircRNAs) in peripheral neutrophils from ICAS patients compared with those in healthy controls. (a-c) GO annotation of the DEcircRNAs parental genes based on the top 10 enrichment scores (-log10 [P value]) in the biological process, cellular component, and molecular function domains, respectively. (d) KEGG pathway analysis of the DEcircRNAs parental genes based on the top 10 enrichment scores. DEcircRNAs: Differentially expressed circular RNAs, BP: Biological process, CC: Cellular component, MF: Molecular function

Validate differentially expressed circular RNAs using qRT-PCR and explore their potential clinical significance

To validate the accuracy and reliability of the circRNA array results, four DEcircRNAs, including upregulated hsa-circRNA-087631 and hsa-circRNA-101141 and downregulated hsa-circRNA-100914 and hsa-circRNA-001082, were selected for subsequent verification in another cohort enrolled subsequently. As shown in Figure 4, the expression changes of the validated DEcircRNAs from the qRT-PCR detection were in agreement with the circRNA array results [Figure 4a and c]. Moreover, the upregulated hsa-circRNA-101141 targeted miRNAs hsa-miRNA-181d-5p and hsa-miRNA-338-3p in peripheral neutrophils of ICAS patients were significantly reduced as well compared with controls [Figure 4e, the predicted binding of hsa-circRNA-101141 with hsa-miRNA-181d-5p and hsa-miRNA-338-3p were shown in Figure 5c and d].

Figure 4.

Figure 4

Open in a new tab

qRT-PCR confirmed the expression of DEcircRNAs screened using circRNAs arrays. Four DEcircRNAs, including upregulated hsa-circRNA-087631 and hsa-circRNA-101141 (a and b) and downregulated hsa-circRNA-100914 and hsa-circRNA-001082 (c and d), were selected for qRT-PCR verification, as well as hsa-circRNA-101141 targeted hsa-miRNA-181d-5p and hsa-miRNA-338-3p (e and f).

Values are expressed as mean ± standard error for the sample mean, *P < 0.05 compared with control, #P < 0.05 compared with before-E and &P < 0.05 compared between those with and without AE/SAE (t-test for comparison between two samples, and one-way ANOVA for comparison between three or more groups). DEcircRNAs: differentially expressed circRNAs, qRT-PCR: Quantitative real-time polymerase chain reaction, circRNA: Circular RNA, miRNA: microRNA, Before-E: Before endovascular treatment, After-E, 24 h after endovascular treatment, AE: Adverse event, SAE: Severe adverse event

Figure 5.

Figure 5

Open in a new tab

Receiver operating characteristic for the comparison of hsa-circRNA-101141, hsa-circRNA-087631, hsa-circRNA-100914, hsa-circRNA-001082, hsa-miRNA-181d-5p and hsa-miRNA-338-3p to discriminate intracranial atherosclerotic stenosis patients from healthy controls, (a and e) as well as distinction between adverse event/SAE (AE/SAE) patients and non-AE/SAE patients (b and f). Interactions of hsa-circRNA-101141 with hsa-miRNA-181d-5p and hsa-miRNA-338-3p predicted using TargetScan and miRanda (c and d)

To investigate the clinical significance of these DEcircRNAs in endovascular treatment risk, we compared changes in levels of the four verified DEcircRNAs pre-E and 24 h post-E. Results demonstrated that levels of upregulated hsa-circRNA-087631 and hsa-circRNA-101141 in ICAS patients were significantly reduced 24 h post-E [Figure 4a]. Besides, hsa-miRNA-181d-5p and hsa-miRNA-338-3p were significantly upregulated 24 h post-E [Figure 4e]. However, downregulated hsa-circRNA-100914 and hsa-circRNA-001082 did not change significantly 24 h post-E [Figure 4c].

We further explored the predictive role of DEcircRNAs in perioperative AEs by dividing the enrolled patients into two groups based on whether they had AE/SAE during 7-day follow-up after endovascular surgery. Results showed that hsa-circRNA-087631 and hsa-circRNA-101141 from peripheral neutrophils of patients with perioperative AE/SAE were significantly upregulated compared with those in patients without perioperative AE/SAE [Figure 4b]. In addition, the levels of both hsa-miRNA-181d-5p and hsa-miRNA-338-3p in peripheral neutrophils of ICAS patients with AE/SAE showed a downward trend compared with those in the peripheral neutrophils of patients without AE/SAE; however, the difference was not statistically significant [Figure 4f]. Hsa-circRNA-100914 and hsa-circRNA-001082 expression showed no statistical difference between patients with and without AE/SAE [Figure 4d].

To further confirm the clinical significance of aberrant expression of circRNAs, ROC curve analysis was performed. It showed that they all provided good AUC values for discriminating ICAS patients from healthy controls [Figure 5a, for hsa-circRNA-101141, AUC = 0.9294, P < 0.001; for hsa-circRNA-087631, AUC = 0.912, P < 0.001; for hsa-circRNA-100914, AUC = 0.8912, P < 0.001; for hsa-circRNA-001082, AUC = 0.9167, P < 0.001; Figure 5e, for hsa-miRNA-181d-5p, AUC = 0.7211, P < 0.05; for hsa-miRNA-338-3p, AUC = 0.8889, P < 0.001]. However, they all showed poor distinction between AE/SAE patients and non-AE/SAE patients [Figure 5b], among which only hsa-miRNA-338-3p has the trend to provide a clear distinction between AE/SAE patients and non-AE/SAE patients [Figure 5f, AUC = 0.7].

Construction of a differentially expressed circular RNA-miRNA-mRNA regulatory network based on four verified differentially expressed circular RNAs

Resorting to the ceRNA theory, four verified DEcircRNAs were used to construct a DEcircRNA-targeted miRNA-targeted mRNA regulatory network to illustrate the regulatory relationship between the aforementioned four DE circRNAs, target miRNAs, and target mRNAs. The predicted network demonstrated that the four verified DEcircRNAs could regulate various target genes by sponging different miRNAs [Figure 6]. Among them, hsa-circRNA-100914 and hsa-circRNA-101141 were the core sites in the constructed regulatory network.

Figure 6.

Figure 6

Open in a new tab

The network constructed based on the differentially expressed circular RNAs (DEcircRNAs)-targeted microRNAs-targeted messenger RNAs of the four DEcircRNAs verified using qRT-PCR

To further investigate the potential roles, these four DEcircRNAs might play in ICAS, GO, and KEGG analyses of their target genes were performed subsequently. GO analysis suggested that they were predicted to involve in the regulation of microtubule-based processes including microtubule polymerization, binding, and microtubule cytoskeleton organization [Figure 7a]. Accordingly, they were mainly distributed in cell projections [Figure 7b], and their MFs were mainly related to binding with tubulin, cytoskeletal protein, microtubule, and others [Figure 7c]. KEGG analysis showed that these target genes may participate in the metabolism of various amino acids such as alanine/aspartate/glutamate/cysteine/methionine/arginine [Figure 7d].

Figure 7.

Figure 7

Open in a new tab

Bioinformatic analyses of the target genes of the four differentially expressed circular RNAs (DEcircRNAs) whose expression was verified with qRT-PCR. (a-c) GO annotation of the target genes of the four verified DEcircRNAs based on the top 10 enrichment scores (-log10 [P value]) in the biological process, cellular component, and molecular function domains, respectively. (d) KEGG pathway analysis of the four verified DEcircRNA target genes based on the top 10 enrichment scores. DEcircRNAs: Differentially expressed circRNAs

Discussion

ICAS is among the most common causes of stroke worldwide, especially for regions such as South and East Asia, accounting for up to half of ischemic stroke cases.[1,21] Correspondingly, the stroke recurrence risk in ICAS patients remains high, even receiving aggressive medical management.[22] Thus, the geographical distribution of ICAS made it of great importance to carry out studies to explore potential biomarkers and possible therapeutic targets based on Asian populations. CircRNAs have been reported to involve in atherosclerosis, ischemic stroke, and ischemia/reperfusion injury. However, possible roles and underlying mechanisms through which they participate in ICAS are yet to be inspected.

Increased peripheral neutrophil counts have been revealed to associate with the presence of ICAS, as well as raise the risk of poor outcomes following ischemic stroke among patients who have received endovascular treatment, and partially among patients with ICAS.[17,23,24] The underlying mechanisms have not been reported yet. In the present study, we used circRNA arrays to identify DEcircRNAs in circulating neutrophils of ICAS patients for the first time. The verification of four selected DEcircRNAs using qRT-PCR in small clinical samples was found to be consistent with the circRNA array data. Moreover, upregulated hsa-circRNA-101141 targeted miRNAs hsa-miRNA-181d-5p and hsa-miRNA-338-3p were both confirmed reduced. This indicated the reliability of our circRNA array results.

To explore the potential clinical significance of these DEcircRNAs in peripheral neutrophils, the ROC analysis indicated that hsa-circRNA-101141, hsa-circRNA-087631, and hsa-circRNA-001082 from circulating neutrophils have a good diagnostic value to distinguish ICAS patients from healthy controls, while hsa-circRNA-100914, hsa-miRNA-181d-5p, and hsa-miRNA-338-3p have a medium diagnostic value. They all owned the potential to be developed as a diagnostic biomarker in ICAS.

Optimal treatment for ICAS patients is still controversial.[25,26] Perioperative adverse and severe AEs have hindered the widespread application of recanalization surgery. However, for patients whose disease is poorly controlled with conventional medical treatment, endovascular treatment (including stent and/or balloon dilation) is a viable alternative.[27] We confirmed that upregulated hsa-circRNA-087631 and hsa-circRNA-101141 in ICAS patients were statistically downregulated 24 h after endovascular treatment compared to those before surgery. Moreover, their levels were significantly higher in patients with perioperative AE/SAE compared to those without AE/SAE during 7-day follow-up after endovascular surgery. These findings all imply that DEcircRNAs (especially hsa-circRNA-087631 and hsa-circRNA-101141) from peripheral neutrophils could be developed as promising biomarkers for predicting prognosis and AEs for ICAS patients receiving endovascular treatment. The predicted network also supported that hsa-circRNA-101141 held the core position in the constructed regulatory network by sponging various miRNAs. However, they all failed to distinguish between AE/SAE patients and non-AE/SAE patients in subsequent ROC analysis, among which only hsa-miRNA-338-3p has the trend to provide a clear distinction. We have to admit that a larger clinical sample is required to confirm the clinical significance of these DE circRNAs in ICAS.

Hsa-circRNA-101141, alias hsa-circ-0005785, is located at chr12: 110819556-110834257, and its homologous gene symbol is anaphsae promoting complex subunit 7. Shen et al. previously reported hsa-circRNA-101141 was upregulated in newly diagnosed and relapsed acute myeloid leukemia (AML).[28,29] Hsa-circRNA-101141 was revealed to inhibit pancreatic cancer cell proliferation through sponging miR-373 as well.[30] Moreover, its expression levels changed accompanying with the disease condition transformation, which may be a predictive index to supervise the recurrence of AML. They further predicted that hsa-circRNA-101141 may act as a sponge to adsorb the miR-181 family based on bioinformatic analysis.[31] The sponging of hsa-circRNA-101141 with miR-181d was consistent with our present study. Yang et al. also found that hsa-circRNA-101141 level was associated with the WBC count and blast percentage in bone marrows from AML patients. This may help explain why hsa-circRNA-101141 could be developed as a prognostic factor in ICAS, as increased neutrophil counts have been reported to increase the prevalence rate and the risk of poor outcomes among patients with ICAS.[17,23,24] We will denote to dig out the underlying involvement of hsa-circRNA-101141-miR-181d axis in ICAS progression in subsequent animal models and human specimens studies.

As the most mobile and abundant innate immune cells, neutrophils respond as the first leukocyte subtype to infiltrate the areas of brain ischemia through efficient and directed polarity and migration within minutes.[32,33] Microtubules, which are composed of α-and β-tubulin, formed the main structural cytoskeleton and played vital roles during polarity and migration of neutrophils.[34,35] Coincidentally, as the downstream target of hsa-circRNA-101141, miRNA-181c was required for actin polymerization to generate lamellipodia during T-cell activation.[36] MiRNA-181a/b/c/d subunits were also involved in Rap1B-mediated cytoskeleton remodeling and improved the chemosensitivity of temozolomide in glioblastoma treatment.[37] Our bioinformatic analysis demonstrated that host genes of DEcircRNA were enriched in pathways including regulation of actin cytoskeleton. Moreover, MFs of hsa-circRNA-087631, hsa-circRNA-101141, hsa-circRNA-100914, and hsa-circRNA-001082 targeted genes were mainly related to binding with tubulin, cytoskeletal protein, and microtubule. Correspondingly, these target genes were predicted to involve in BPs, including regulation of microtubule polymerization, binding, and microtubule cytoskeleton organization. They all implied that DEcircRNAs, especially hsa-circRNA-101141-miRNA-181d axis in peripheral neutrophils of ICAS patients might be involved in the progression of ICAS through influencing neutrophil actin or microtubule-based cytoskeleton organization processes. These findings provide new insights into potential roles that neutrophils might play in ICAS and give us novel targets for intervention.

However, our study owned limitations. First, our sample size was relatively small. Second, no functional studies using cultured cells or animal models were performed to further confirm the potential action of these DEcircRNAs on ICAS. The above limitations should be addressed in future investigations using gain/loss-of-function strategies with larger clinical samples.

Conclusion

We demonstrated that DEcircRNAs in peripheral neutrophils could serve as biomarkers for the diagnostic and adverse effect prediction in ICAS patients receiving endovascular treatment. Moreover, these DEcircRNAs, especially hsa-circRNA-101141-hsa-miRNA-181d axis, might participate in the pathogenesis of ICAS by acting on actin or microtubule-based cytoskeleton organization processes in neutrophils. Thus, we provide new insights into the roles that DEcircRNAs from neutrophils may play in ICAS. Further studies based on these findings are warranted to explore new predictive biomarkers and therapeutic targets for ICAS.

Author contributions

Yumin Luo and Liqun Jiao designed this study. Lingzhi Li, Junfen Fan and Rongliang Wang carried out qRT-PCR procedure. Yangmin Zheng, Feng Yan and Haiping Zhao collected the clinical data. Ziping Han and Tao Wang performed data analysis and drafted the article. All authors reviewed the submitted manuscript and agreed on the final submission.

Ethical policy and institutional review board statement

This study was performed in accordance with the Declaration of Helsinki and approved by the Research Ethics Committee of Xuanwu Hospital of Capital Medical University (reference number: KS2018036, dated on Jan 22, 2014). All enrolled patients signed informed consent to participate in this study. All methods were performed in accordance with the relevant guidelines and regulations.

Data availability statement

The data that support the current study were all available in the manuscript.

Conflicts of interest

Tao Wang, Haiping Zhao and Yumin Luo are Editorial Board members of Brain Circulation. The article was subject to the journal’s standard procedures, with peer review handled independently of the Editorial Board members and their research groups.

Acknowledgements

We thank all these patients that enrolled in this study and their family for their participation.

Funding Statement

This research was funded by National Natural Science Foundation of China (82171298, 82171303 and 82171301) and Capital Funds for Health Improvement and Research (2020-2-1032).

References

  • 1.Wang Y, Zhao X, Liu L, Soo YO, Pu Y, Pan Y, et al. Prevalence and outcomes of symptomatic intracranial large artery stenoses and occlusions in China: The Chinese Intracranial Atherosclerosis (CICAS) study. Stroke. 2014;45:663–9. doi: 10.1161/STROKEAHA.113.003508. [DOI] [PubMed] [Google Scholar]
  • 2.Almallouhi E, Al Kasab S, Yamada L, Martin RH, Turan TN, Chimowitz MI. Relationship between vascular risk factors and location of intracranial atherosclerosis in the SAMMPRIS trial. J Stroke Cerebrovasc Dis. 2020;29:104713. doi: 10.1016/j.jstrokecerebrovasdis.2020.104713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Piwecka M, Glažar P, Hernandez-Miranda LR, Memczak S, Wolf SA, Rybak-Wolf A, et al. Loss of a mammalian circular RNA locus causes miRNA deregulation and affects brain function. Science. 2017;357:eaam8526. doi: 10.1126/science.aam8526. [DOI] [PubMed] [Google Scholar]
  • 4.Rybak-Wolf A, Stottmeister C, Glažar P, Jens M, Pino N, Giusti S, et al. Circular RNAs in the mammalian brain are highly abundant, conserved, and dynamically expressed. Mol Cell. 2015;58:870–85. doi: 10.1016/j.molcel.2015.03.027. [DOI] [PubMed] [Google Scholar]
  • 5.Li Z, Huang C, Bao C, Chen L, Lin M, Wang X, et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol. 2015;22:256–64. doi: 10.1038/nsmb.2959. [DOI] [PubMed] [Google Scholar]
  • 6.Shang FF, Luo L, Yan J, Yu Q, Guo Y, Wen Y, et al. CircRNA_0001449 disturbs phosphatidylinositol homeostasis and AKT activity by enhancing Osbpl5 translation in transient cerebral ischemia. Redox Biol. 2020;34:101459. doi: 10.1016/j.redox.2020.101459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lin SP, Ye S, Long Y, Fan Y, Mao HF, Chen MT, et al. Circular RNA expression alterations are involved in OGD/R-induced neuron injury. Biochem Biophys Res Commun. 2016;471:52–6. doi: 10.1016/j.bbrc.2016.01.183. [DOI] [PubMed] [Google Scholar]
  • 8.Mehta SL, Pandi G, Vemuganti R. Circular RNA expression profiles alter significantly in mouse brain after transient focal ischemia. Stroke. 2017;48:2541–8. doi: 10.1161/STROKEAHA.117.017469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dong Z, Deng L, Peng Q, Pan J, Wang Y. CircRNA expression profiles and function prediction in peripheral blood mononuclear cells of patients with acute ischemic stroke. J Cell Physiol. 2020;235:2609–18. doi: 10.1002/jcp.29165. [DOI] [PubMed] [Google Scholar]
  • 10.Yang J, Hao J, Lin Y, Guo Y, Liao K, Yang M, et al. Profile and functional prediction of plasma exosome-derived CircRNAs from acute ischemic stroke patients. Front Genet. 2022;13:810974. doi: 10.3389/fgene.2022.810974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wen Y, Chun Y, Lian ZQ, Yong ZW, Lan YM, Huan L, et al. circRNA0006896miR1264DNMT1 axis plays an important role in carotid plaque destabilization by regulating the behavior of endothelial cells in atherosclerosis. Mol Med Rep. 2021;23:311. doi: 10.3892/mmr.2021.11950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xiao Q, Yin R, Wang Y, Yang S, Ma A, Pan X, et al. Comprehensive analysis of peripheral exosomal circRNAs in large artery atherosclerotic stroke. Front Cell Dev Biol. 2021;9:685741. doi: 10.3389/fcell.2021.685741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fu Y, Sun C, Li Q, Qian F, Li C, Xi X, et al. Differential RNA expression profiles and competing endogenous RNA-associated regulatory networks during the progression of atherosclerosis. Epigenomics. 2021;13:99–112. doi: 10.2217/epi-2020-0252. [DOI] [PubMed] [Google Scholar]
  • 14.Libby P. The changing landscape of atherosclerosis. Nature. 2021;592:524–33. doi: 10.1038/s41586-021-03392-8. [DOI] [PubMed] [Google Scholar]
  • 15.Logsdon AF, Lucke-Wold BP, Turner RC, Huber JD, Rosen CL, Simpkins JW. Role of microvascular disruption in brain damage from traumatic brain injury. Compr Physiol. 2015;5:1147–60. doi: 10.1002/cphy.c140057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Dodd WS, Patel D, Lucke-Wold B, Hosaka K, Chalouhi N, Hoh BL. Adropin decreases endothelial monolayer permeability after cell-free hemoglobin exposure and reduces MCP-1-induced macrophage transmigration. Biochem Biophys Res Commun. 2021;582:105–10. doi: 10.1016/j.bbrc.2021.10.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang X, Hou XH, Ma YH, Shen XN, Cao XP, Song JH, et al. Association of peripheral neutrophil count with intracranial atherosclerotic stenosis. BMC Neurol. 2020;20:65. doi: 10.1186/s12883-020-01641-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Huang LY, Sun FR, Yin JJ, Ma YH, Li HQ, Zhong XL, et al. Associations of the neutrophil to lymphocyte ratio with intracranial artery stenosis and ischemic stroke. BMC Neurol. 2021;21:56. doi: 10.1186/s12883-021-02073-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang Y, Wang T, Dmytriw AA, Yang K, Jiao L, Shi H, et al. Safety of endovascular therapy for symptomatic intracranial artery stenosis: A national prospective registry. Stroke Vasc Neurol. 2022;7:166–71. doi: 10.1136/svn-2021-000979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ma Q, Li L, Yu B, Jiao L, Han Z, Zhao H, et al. Circular RNA profiling of neutrophil transcriptome provides insights into asymptomatic moyamoya disease. Brain Res. 2019;1719:104–12. doi: 10.1016/j.brainres.2019.05.033. [DOI] [PubMed] [Google Scholar]
  • 21.Kim YD, Choi HY, Cho HJ, Cha MJ, Nam CM, Han SW, et al. Increasing frequency and burden of cerebral artery atherosclerosis in Korean stroke patients. Yonsei Med J. 2010;51:318–25. doi: 10.3349/ymj.2010.51.3.318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Turan TN, Nizam A, Lynn MJ, Egan BM, Le NA, Lopes-Virella MF, et al. Relationship between risk factor control and vascular events in the SAMMPRIS trial. Neurology. 2017;88:379–85. doi: 10.1212/WNL.0000000000003534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li T, Chen Z, Zhu X, Tang X, Pan S, Gong F, et al. Neutrophil count, intracranial atherosclerotic stenosis, and prognosis of ischemic stroke after endovascular treatment: A mediation analysis. Front Neurol. 2020;11:605852. doi: 10.3389/fneur.2020.605852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yu Y, Yan L, Lou Y, Cui R, Kang K, Jiang L, et al. Multiple predictors of in-stent restenosis after stent implantation in symptomatic intracranial atherosclerotic stenosis. J Neurosurg. 2022;136:1716–25. doi: 10.3171/2021.6.JNS211201. [DOI] [PubMed] [Google Scholar]
  • 25.Gutierrez J, Turan TN, Hoh BL, Chimowitz MI. Intracranial atherosclerotic stenosis: Risk factors, diagnosis, and treatment. Lancet Neurol. 2022;21:355–68. doi: 10.1016/S1474-4422(21)00376-8. [DOI] [PubMed] [Google Scholar]
  • 26.Al Kasab S, Hess DC, Chimowitz MI. Rationale for ischemic conditioning to prevent stroke in patients with intracranial arterial stenosis. Brain Circ. 2016;2:67–71. doi: 10.4103/2394-8108.186260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Al Kasab S, Almallouhi E, Alawieh A, Wolfe S, Fargen KM, Arthur AS, et al. Outcomes of rescue endovascular treatment of emergent large vessel occlusion in patients with underlying intracranial atherosclerosis: Insights from STAR. J Am Heart Assoc. 2021;10:e020195. doi: 10.1161/JAHA.120.020195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li W, Zhong C, Jiao J, Li P, Cui B, Ji C, et al. Characterization of hsa_circ_0004277 as a new biomarker for acute myeloid leukemia via circular RNA profile and bioinformatics analysis. Int J Mol Sci. 2017;18:597. doi: 10.3390/ijms18030597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shen Y, Jia Y, Zhang R, Chen H, Feng Y, Li F, et al. Using Circ-ANAPC7 as a novel type of biomarker in the monitoring of acute myeloid leukemia. Acta Haematol. 2022;145:176–83. doi: 10.1159/000520446. [DOI] [PubMed] [Google Scholar]
  • 30.Shi X, Yang J, Liu M, Zhang Y, Zhou Z, Luo W, et al. Circular RNA ANAPC7 inhibits tumor growth and muscle wasting via PHLPP2-AKT-TGF-? signaling axis in pancreatic cancer. Gastroenterology. 2022;162:2004–17.e2. doi: 10.1053/j.gastro.2022.02.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chen H, Liu T, Liu J, Feng Y, Wang B, Wang J, et al. Circ-ANAPC7 is upregulated in acute myeloid leukemia and appears to target the MiR-181 family. Cell Physiol Biochem. 2018;47:1998–2007. doi: 10.1159/000491468. [DOI] [PubMed] [Google Scholar]
  • 32.Levard D, Buendia I, Lanquetin A, Glavan M, Vivien D, Rubio M. Filling the gaps on stroke research: Focus on inflammation and immunity. Brain Behav Immun. 2021;91:649–67. doi: 10.1016/j.bbi.2020.09.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Arya AK, Hu B. Brain-gut axis after stroke. Brain Circ. 2018;4:165–73. doi: 10.4103/bc.bc_32_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Klemm LC, Denu RA, Hind LE, Rocha-Gregg BL, Burkard ME, Huttenlocher A. Centriole and Golgi microtubule nucleation are dispensable for the migration of human neutrophil-like cells. Mol Biol Cell. 2021;32:1545–56. doi: 10.1091/mbc.E21-02-0060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kraus RF, Gruber MA. Neutrophils-from bone marrow to first-line defense of the innate immune system. Front Immunol. 2021;12:767175. doi: 10.3389/fimmu.2021.767175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lim SP, Ioannou N, Ramsay AG, Darling D, Gäken J, Mufti GJ. miR-181c-BRK1 axis plays a key role in actin cytoskeleton-dependent T cell function. J Leukoc Biol. 2018;103:855–66. doi: 10.1002/JLB.1A0817-325RR. [DOI] [PubMed] [Google Scholar]
  • 37.She X, Yu Z, Cui Y, Lei Q, Wang Z, Xu G, et al. miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014;31:892. doi: 10.1007/s12032-014-0892-9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the current study were all available in the manuscript.

Articles from Brain Circulation are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES