Abstract
Non-coding small RNAs and Argonaute proteins mediate conserved defenses against foreign genetic elements. C. elegans mutants in the insulin/IGF-1 signaling (IIS) have previously been shown to exhibit an enhanced response to exogenous RNAi. Here, we found that the loss of IIS via daf-2 enhances transgene silencing, which is reversed by knocking out daf-16 /foxO . Similarly, pals-22 mutants show enhanced RNAi and upregulation of antiviral RNAi pathway. daf-2 and pals-22 mutations exhibit additive effects, and loss of daf-16 restores transgene expression in daf-2 mutants but not in pals-22 mutants, suggesting that these genes act in parallel. RNAi gene expression in daf-2 mutants lacked a consistent pattern, suggesting IIS may regulate RNAi components via post-translational mechanisms.
Figure 1. Knocking out IIS pathway promotes repetitive transgene silencing.
(A) Expression levels of the repetitive transgene otIs356 [rab-3p(prom1)::2xNLS::TagRFP] across various genetic backgrounds, as indicated on the x-axis. Each data point represents an individual animal. Statistical significance was determined by non-parametric Kruskal–Wallis test followed by pairwise Wilcoxon Rank Sum tests with Benjamini–Hochberg correction. Numbers indicate q-values. Error represents mean +/- SD. (B) Scatter plot showing gene expression in wild-type and daf-2 (1370) mutants. The read counts were normalized using Relative Log Expression method. 62 genes with known roles in RNAi regulation are highlighted in blue. (C) Differential expression of RNAi-related genes in daf-2 ( e1370 ) mutants relative to wild type (q < 0.05, DESeq2). Dashed lines denote log₂ fold-change thresholds of +/- 0.5. (D) A model illustrating the roles of insulin/IGF-1 signaling and PALS-22 in regulating transgene silencing.
Description
Non-coding small RNAs, in association with Argonaute proteins (AGO), play an evolutionarily conserved role in defending against foreign genetic elements and mediating antiviral immunity (Maillard et al., 2019; Mello and Conte, 2004). For the past three decades, Caenorhabditis elegans has been pivotal in uncovering the mechanisms and regulation of the RNAi pathways. Genetic screens in C. elegans have identified many mutants with an enhanced response to double-stranded RNA (dsRNA) (Fischer et al., 2013; Kennedy et al., 2004; Kim et al., 2005). Notably, most Enhanced RNAi (Eri) mutants exhibit increased silencing of multicopy repetitive transgenes, which are recognized by the RNAi machinery as foreign elements, analogous to viruses, and are thus targeted for silencing (Félix and Wang, 2019).
The Ruvkun lab has previously showed that loss of IIS increases the animals' response to dsRNA (Wang and Ruvkun, 2004). Moreover, reduced IIS has been shown to restore germline immortality in PIWI mutants by promoting germline genome surveillance mechanisms (Simon et al., 2014), suggesting a role of IIS in regulating small RNA pathways. Insulin/IGF-1 receptor DAF-2 regulate the activity of FoxO transcription factor DAF-16 , the major downstream effector of the IIS pathway (Murphy and Hu, 2013). In this study, we show that daf-2 ( e1370 ) mutants exhibit enhanced silencing of repetitive transgenes (pan-neuronal otIs356 [rab-3p(prom1)::2xNLS::TagRFP] ), an effect that is suppressed by loss of daf-16 ( Figure 1A ), indicating that DAF-2 normally acts to suppress the expression of foreign genetic elements in DAF-16-dependent manner.
In a recent study, we showed that loss of PALS-22 , a negative regulator of the intracellular pathogen response that protects against viral and microsporidian infections, leads to upregulation of the antiviral RNAi pathway and the AGO gene vsra-1 , which contributes to transgene silencing (Ewe et al., 2025). Here, we found that pals-22 and daf-2 mutations have an additive effect on transgene silencing (two-way ANOVA, pals-22 and daf-2 effects p < 0.0001, interaction effect p = 0.27), and that loss of daf-16 restores transgene expression in daf-2 ( e1370 ) mutants, but not in pals-22 mutants ( Figure 1A ). These results suggest that PALS-22 and the IIS pathway act in parallel to regulate foreign genetic elements.
To investigate how loss of daf-2 affects the small RNA machinery, we examined the expression of known RNAi pathway regulators (n = 62) in daf-2 ( e1370 ) mutants ( Figure 1B ); however, we did not observe a clear expression pattern that could account for the strong transgene silencing phenotype in this mutant. For example, eri genes and components of the endogenous siRNA pathway showed both up- and downregulation, with no consistent trend ( Figure 1C ). Unlike PALS-22 , which suppresses RNAi and AGO gene expression, it is unlikely that IIS functions through the same mode of regulation. Instead, DAF-2 may regulate RNAi components post-translationally, potentially affecting small RNA amplification and/or their loading onto AGOs, which are critical for robust gene silencing ( Figure 1D ).
Methods
Worm cultivation
C. elegans strains were maintained at 20 o C on Nematode Growth Media (NGM) seeded with E. coli OP50 . Genetic crosses were performed using standard procedure, and genotyping primers are provided below.
Imaging and fluorescence quantification
To examine transgene silencing, we analyzed the expression of the pan-neuronally expressed, repetitive transcriptional reporter otIs356 [rab-3p(prom1)::2xNLS::TagRFP] . Animals were immobilized using 5 mM levamisole and mounted on 2% agarose pads for imaging. Fluorescence images were acquired using either an Olympus IX83 motorized inverted wide-field microscope or an Olympus BX63 motorized upright wide-field microscope. Transgene expression was quantified using Fiji/ImageJ software. To prevent bias, genotype information was blinded from the investigator using the DoubleBlind tool ( https://github.com/GuyTeichman/DoubleBlind ). Corrected total fluorescence per worm was calculated as: integrated density – (area of the selected region × mean background fluorescence). Worms that overlapped with others or were located at the edges of the image were excluded from the analysis.
Bioinformatics analysis
All bioinformatics analysis was perform using RNAlysis (Teichman et al., 2023). RNA-seq data was obtained from GEO: GSE271972. Sequencing reads were pseudo-aligned using Kallisto (Bray et al., 2016). We performed differential expression analysis using DESeq2 (Love et al., 2014).
Reagents
|
Strain |
Genotype |
Source |
|
daf-2 ( e1370 ) III; otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V |
This study |
|
|
pals-22 ( pig26 ) daf-2 ( e1370 ) III; otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V |
This study |
|
|
daf-16 ( mu86 ) I; daf-2 ( e1370 ) III; otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V |
This study |
|
|
daf-16 ( mu86 ) I; pals-22 ( pig26 ) daf-2 ( e1370 ) III; otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V |
This study |
|
|
pals-22 ( pig26 ) III; otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. |
This study |
|
|
This study |
||
|
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. |
CGC |
|
Primer name |
Sequence |
Description |
|
EE17 |
GCGACTCGACCTATCAGTGC |
|
|
EE18 |
ATTTTGCCGCCCATCCCTAA |
|
|
DAF2 F |
CCGACGTTCCGAATCACTCTGAACCTCGACG |
|
|
DAF2 R |
GCACAGATTTGTGATGGTATGGCGTACCTGG |
|
|
EE161 |
CACCACTCAACTCGAGTCCC |
|
|
EE162 |
AAAAGCTCACTCCGAAGGAA |
Acknowledgments
We are grateful to WormBase for providing valuable data and resources. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
Funding Statement
O.R. is grateful to funding from the Eric and Wendy Schmidt Fund for Strategic Innovation (Polymath Award #0140001000) and the generous support from the Morris Kahn foundation. G.T. is grateful to the support from Milner Foundation. C.K.E. is supported by EMBO Postdoctoral Fellowship (#ALTF 6‐2022). This work is supported by ERC grant #335624 to O.R.
References
- Bray NL, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol. 2016 Apr 4;34(5):525–527. doi: 10.1038/nbt.3519. [DOI] [PubMed] [Google Scholar]
- Ewe Chee Kiang, Teichman Guy, Weiss Shir, Knott Maximilian M.L., Anava Sarit, Gingold Hila, Sarmiento Mario Bardan, Troemel Emily, Rechavi Oded. Dynamic control of Argonautes by a rapidly evolving immunological switch. Current Biology. 2025 Jul 1;35(13):3076–3089.e5. doi: 10.1016/j.cub.2025.05.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Félix Marie-Anne, Wang David. Natural Viruses of Caenorhabditis Nematodes . Annual Review of Genetics. 2019 Dec 3;53(1):313–326. doi: 10.1146/annurev-genet-112618-043756. [DOI] [PubMed] [Google Scholar]
- Fischer Sylvia E.J., Pan Qi, Breen Peter C., Qi Yan, Shi Zhen, Zhang Chi, Ruvkun Gary. Multiple small RNA pathways regulate the silencing of repeated and foreign genes in C. elegans . Genes & Development. 2013 Dec 15;27(24):2678–2695. doi: 10.1101/gad.233254.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kennedy Scott, Wang Duo, Ruvkun Gary. A conserved siRNA-degrading RNase negatively regulates RNA interference in C. elegans. Nature. 2004 Feb 1;427(6975):645–649. doi: 10.1038/nature02302. [DOI] [PubMed] [Google Scholar]
- Kim John K., Gabel Harrison W., Kamath Ravi S., Tewari Muneesh, Pasquinelli Amy, Rual Jean-François, Kennedy Scott, Dybbs Michael, Bertin Nicolas, Kaplan Joshua M., Vidal Marc, Ruvkun Gary. Functional Genomic Analysis of RNA Interference in C. elegans . Science. 2005 May 20;308(5725):1164–1167. doi: 10.1126/science.1109267. [DOI] [PubMed] [Google Scholar]
- Love Michael I, Huber Wolfgang, Anders Simon. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014 Dec 1;15(12) doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maillard Pierre V, van der Veen Annemarthe G, Poirier Enzo Z, Reis e Sousa Caetano. Slicing and dicing viruses: antiviral RNA interference in mammals . The EMBO Journal. 2019 Mar 15;38(8) doi: 10.15252/embj.2018100941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mello Craig C., Conte Darryl. Revealing the world of RNA interference. Nature. 2004 Sep 15;431(7006):338–342. doi: 10.1038/nature02872. [DOI] [PubMed] [Google Scholar]
- Murphy Coleen T. Insulin/insulin-like growth factor signaling in C. elegans. WormBook. 2013 Dec 26;:1–43. doi: 10.1895/wormbook.1.164.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simon Matt, Sarkies Peter, Ikegami Kohta, Doebley Anna-Lisa, Goldstein Leonard D., Mitchell Jacinth, Sakaguchi Aisa, Miska Eric A., Ahmed Shawn. Reduced Insulin/IGF-1 Signaling Restores Germ Cell Immortality to Caenorhabditis elegans Piwi Mutants. Cell Reports. 2014 May 1;7(3):762–773. doi: 10.1016/j.celrep.2014.03.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teichman Guy, Cohen Dror, Ganon Or, Dunsky Netta, Shani Shachar, Gingold Hila, Rechavi Oded. RNAlysis: analyze your RNA sequencing data without writing a single line of code. BMC Biology. 2023 Apr 7;21(1) doi: 10.1186/s12915-023-01574-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- WANG D., RUVKUN G. Regulation of Caenorhabditis elegans RNA Interference by the daf-2 Insulin Stress and Longevity Signaling Pathway. Cold Spring Harbor Symposia on Quantitative Biology. 2004 Jan 1;69(0):429–432. doi: 10.1101/sqb.2004.69.429. [DOI] [PubMed] [Google Scholar]