Oxidative DNA damage and DNA repair gene variants in differentiated thyroid cancer patients treated with radioactive iodine

Abstract

Purpose

This study aimed to evaluate oxidative DNA damage and its association with polymorphisms in DNA repair enzymes among patients with differentiated thyroid cancer (DTC) treated with high-dose radioactive iodine (RAI, ≥100 mCi). Relationships between DNA damage markers, gene variants, and clinical or tumor characteristics were also explored.

Methods

Seventy-nine patients with DTC and 59 age and sex matched controls from a Turkish population were included. Urinary 8-hydroxy-2′-deoxyguanosine (8-oxoG), a marker of oxidative DNA damage, was measured by ELISA at baseline, 2 weeks, and 3 months post-RAI. Genotyping for hOGG1 Ser326Cys and APE1 Asp148Glu polymorphisms was performed on leukocyte-derived DNA using real-time PCR and melting curve analysis.

Results

Urinary 8-oxoG levels showed a non-significant upward trend over time (p = 0.252). The Cys/Cys genotype of hOGG1 was more frequent in patients than controls (13 vs. 6%, p = 0.54), while the Ser/Cys genotype was significantly less frequent in patients (36.7 vs. 57.6%; OR: 0.46, 95% CI: 0.22–0.94, p = 0.03). Cys allele frequencies were 0.32 in patients and 0.35 in controls. APE1 genotype and allele distributions did not differ significantly between groups. No associations were found between polymorphisms and 8-oxoG levels or clinical features, including DTC subtype, tumor stage, sex, smoking status, or age.

Conclusion

This is the first study to jointly evaluate urinary 8-oxoG and hOGG1/APE1 polymorphisms in Turkish DTC patients receiving RAI. No consistent associations were found with oxidative DNA damage or clinical characteristics. Larger studies are needed to validate these findings.

Introduction

Differentiated thyroid cancer (DTC), primarily comprising papillary and follicular subtypes, is the most common endocrine malignancy, with its global incidence steadily rising in recent decades. Standard treatment includes total thyroidectomy followed by radioactive iodine (RAI) therapy, leveraging the thyroid tissue’s unique ability to concentrate iodine via the sodium-iodide symporter [1]. While RAI is highly effective in ablating residual or metastatic thyroid tissue, the ionizing radiation it emits can induce reactive oxygen species (ROS), leading to oxidative stress and potential genotoxic effects [2].

ROS can damage DNA through base modifications, strand breaks, and abasic sites, with 8-hydroxy-2′-deoxyguanosine (8-oxoG) being a widely recognized and quantifiable marker of oxidative DNA damage. Unrepaired 8-oxoG lesions can result in G:C to T:A transversions, which contribute to genomic instability, mutagenesis, and cancer development [2]. The base excision repair (BER) pathway plays a pivotal role in the removal of such lesions, with enzymes like human 8-oxoguanine DNA glycosylase (hOGG1) and apurinic/apyrimidinic endonuclease 1 (APE1) acting sequentially to excise oxidized bases and repair apurinic sites [3–5].

Polymorphic variants in these DNA repair genes specifically hOGG1 Ser326Cys and APE1 Asp148Glu may alter enzyme structure or function, modulating the efficiency of BER and potentially influencing individual susceptibility to various cancers [6–10]. These associations have been explored in breast, lung, and colorectal cancer, with inconsistent results that appear to vary by ethnicity, environmental exposures, and genetic background [11, 12]. In thyroid cancers specifically, differential patterns of oxidative DNA damage and repair activity have been documented between histological subtypes, suggesting that DNA repair mechanisms may play subtype-specific roles in tumorigenesis [13].

Despite the extensive literature on RAI-induced genotoxicity, longitudinal assessments of oxidative DNA damage in DTC patients remain limited. Urinary 8-oxoG is a non-invasive, dynamic biomarker that reflects systemic oxidative DNA damage, yet few studies have examined its post-RAI kinetics or its relationship with individual DNA repair capacity. Furthermore, the interaction between 8-oxoG levels and functionally relevant BER gene polymorphisms in DTC patients is poorly understood, particularly in genetically distinct populations such as the Turkish cohort.

This study aims to longitudinally evaluate urinary 8-oxoG levels in DTC patients receiving high-dose RAI therapy and to assess associations with hOGG1 Ser326Cys and APE1 Asp148Glu polymorphisms. By addressing these relationships in a Turkish population, this research seeks to enhance our understanding of how genetic variation influences oxidative stress responses and DNA repair efficacy in the context of thyroid cancer management.

Methods

This study included 79 patients with differentiated thyroid cancer (DTC) who received high-dose radioactive iodine therapy (RAI ≥ 100 mCi) at the Department of Internal Medicine, Endocrinology and Metabolic Diseases, Istanbul Faculty of Medicine, between February 2011 and March 2012. Patients with diabetes mellitus, chronic renal or liver disease, malignancies other than thyroid cancer, non-DTC thyroid tumors, low-dose RAI, or incomplete clinical or laboratory records were excluded. The study was approved by the Institutional Clinical Research Ethics Committee. All patients provided written informed consent prior to participation.

At the time of admission for high-dose RAI, patients were informed about the study and included after consent was obtained. Demographic and clinical data including age, sex, tumor size, histopathological subtype, presence of lymph node or distant metastases, TNM staging, treatment modalities, cumulative RAI dose, comorbidities, and smoking status were recorded.

The control group consisted of 59 individuals with similar age, sex, comorbidity, and smoking profiles. Individuals with thyroid disease were excluded from the control group.

Measurement of oxidative DNA damage

Urine samples were intended to be collected from all 79 patients at three time points: prior to RAI therapy (baseline), at 2 weeks, and at 3 months post-treatment. However, due to financial constraints that arose during the later stages of the study, 8-oxoG analysis could only be completed for 55 patients. All collected samples were first morning voids and were stored at −20 °C until analysis. Urinary levels of 8-hydroxy-2′-deoxyguanosine (8-oxoG), a biomarker of oxidative DNA damage, were quantified using commercially available competitive ELISA kits.

DNA isolation and genotyping

Peripheral venous blood samples were collected into EDTA tubes. Genomic DNA was extracted from leukocytes using the High Pure PCR Template Preparation Kit (Roche Diagnostics GmbH, Mannheim, Germany) and stored at −80 °C. Genotyping for hOGG1 Ser326Cys and APE-1 Asp148Glu polymorphisms was performed using capillary real-time PCR with melting curve analysis and fluorescent hybridization probes on the Light Cycler platform (Roche Diagnostics GmbH, Mannheim, Germany) (Table 1).

Table 1.

Primer and probe sequences used for genotyping

Target gene (Genbank accession no.) Amino acid change	Primer and probe sequences
APE/Ref-1 (M92444), Asp148Glu	F: 5′-CTTGATTGCTTTCCCTTTTCTTA-3′ R: 5′-CGCTGCCGGTACTCCA-3′ S: 5′LCRed640TGCTCCTCCTCGCCTATAGAAATGAp3′ A: 5′CACAATCACCCGGCCTTCCTGATC-FITC-3′
hOGG1(rs1052133) Ser326Cys	F: 5′-CCCAACACTGTCACTAGTCTCA-3′ R: 5′-TTGGGGAATTTCTTTGTCCA-3′ S: 5′LCRed640CCACCAGCAAAGCGCAGAAAGGGp-3′ A: 5′-CGCCAATCCCGCCATGCTCA

F forward primer, R reverse primer, S sensor prob, A anchor prob

Statistical analysis

Statistical analyses were conducted using SPSS version 15.0 (SPSS Inc., Chicago, IL, USA). Genotype and allele frequencies were compared between patients and controls using the Chi-square test. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated for genotype comparisons. Genotype distributions in the control group were evaluated for Hardy-Weinberg equilibrium using Pearson’s Chi-square, likelihood ratio (Llr), and exact tests.

The repeated measures ANOVA test was used to compare urinary 8-hydroxy-2′-deoxyguanosine (8-oxoG) levels at three time points: baseline, 2 weeks, and 3 months after radioactive iodine treatment. Descriptive comparisons between clinical variables (e.g., age, sex, smoking) and genotype distributions were made, but no adjusted multivariable analyses were performed. The statistical tests used for these comparisons were not consistently recorded across all analyses and should be interpreted accordingly.

A retrospective sample size calculation was performed using G*Power 3.1.9.7 software to assess the adequacy of the study for repeated measures analysis. Assuming a small-to-moderate effect size (f = 0.15), α = 0.05, and power (1–β) = 0.80, the minimum required sample size was estimated at 73 patients. While urinary 8-oxoG levels could only be measured in 55 patients due to funding constraints, post hoc considerations suggest this sample remains sufficient to detect moderate effect sizes (f = 0.2). As emphasized in the literature, post hoc power assessments have methodological limitations and should not be used to infer the presence or absence of true associations [14, 15].

No correction for multiple comparisons was applied, and the findings should be interpreted with in the exploratory scope of the study.

Results

The demographic characteristics of the patient and control groups are presented in Tables 2 and 3, respectively.

Table 2.

Clinical and demographic characteristics of patients with differentiated thyroid cancer (DTC)

Variables	DTC
Age (years)
Mean ± SD	43.08 ± 13.6
Interval	15–71
Gender
Female, n (%)	69 (87.3)
Male, n (%)	10 (12.7)
Diagnosis
Papillary thyroid cancer, n (%)	76 (96.2)
Follicular thyroid cancer, n (%)	2 (2.5)
Mature cystic teratoma, n (%)	1 (1.2)
All group
Follicular variant, n (%)	46(58.2)
Classical type, n (%)	20 (25.3)
Diffuse sclerosan variant, n (%)	3 (3.7)
Solid variant, n (%)	3 (3.7)
Highly cylindrical variant, n (%)	1 (1.2)
Oncositic variant, n (%)	3 (3.37)
Tumor diameter (cm)
Mean ± SD	2.17 ± 1.69
Interval	0.4–11.5
Smoking, n (%)	24(30.3)
Radioactive iodine dose(mCi)
Mean ± SD	141.13 ± 84.2
Interval	100–500

Table 3.

Clinical and demographic characteristics of the control group

Variables	Control group
Age(year)
Mean ± SD	45.08 ± 13.6
Interval	20–79
Gender
Female, n (%)	57 (96.6)
Male, n (%)	2 (3.4)
Smoking, n (%)	15 (25)

The genotype distributions of hOGG1 and APE-1 in the control group were evaluated for Hardy-Weinberg equilibrium (HWE). While the hOGG1 distribution showed borderline deviation (p = 0.048), likely due to the small control sample size, APE-1 was in equilibrium (p = 0.898).

Genotype and allele frequencies for hOGG1 and APE-1 are summarized in Tables 4 and 5. The frequency of the hOGG1 codon 326 Cys allele was 0.35 in controls and 0.32 in patients, consistent with previously reported frequencies in Turkish populations (e.g., 0.30 in Tanrıkulu et al. [7]). TheCys/Cys genotype was observed in 13% of patients and 6% of controls (p = 0.54). The Ser/Cys genotype was significantly less frequent in patients (36.7%) than in controls (57.6%), yielding an odds ratio of 0.46 (95% CI: 0.22–0.94, p = 0.03) (Table 4).

Table 4.

Distribution of hOGG1 codon 326 genotypes and allele frequencies in patients with differentiated thyroid cancer and controls

hOGG1, code 326	Control n (%)	DTC n (%)	OR (%95 CI)	P
Ser/Ser	21(35.5)	39(49.3)	Reference	–
Ser/Cys	34(57.6)	29(36.7)	0,46(0.22–0.94)	0.03
Cys/Cys	4(6)	11(13)	1.48(0.42–5.22)	0.54
Ser/Cys + Cys/Cys	38(64.4)	40(50.6)	0.56(0.28–1.13)	0.10
Cys allele frequency	0.35	0.32	0.86(0.52–1.43)	0.56

Table 5.

Distribution of APE1 codon 148 genotypes and allele frequencies in patients with differentiated thyroid cancer and controls

APE-1 Code 148	Control n (%)	DTC n (%)	OR (95% CI)	p
GG	26(44)	30(37.9)	Reference	–
GT	26(44)	41(51.8)	1.36(0.66–2.80)	0.39
TT	7(12)	8(10.1)	0.99(0.31–3.10)	0.98
GT + TT	33(55.9)	49(62)	1.28(0.64–2.55)	0.47
T allele frequency	0.34	0.36	1.10(0.66–1.81)	0.70

For APE-1 codon 148, the T allele frequency was 0.34 in controls and 0.36 in patients. These values align with prior reports in Turkish cohorts, including Doğru-Abbasoğlu et al. [8]. The TT genotype was present in 12% of patients and 10.1% of controls, while GT was found in 44% of patients and 51.8% of controls (p = 0.30) (Table 5).

Urinary 8-oxoG levels were assessed in 55 patients at baseline, 2 weeks, and 3 months post-RAI using the Friedman test. Although levels showed a slight upward trend, no statistically significant differences were observed across time points (p = 0.251; Table 6 and Fig. 1). Additionally, no significant associations were found between 8-oxoG levels and hOGG1 or APE-1 genotypes or alleles.

Table 6.

Urinary 8-hydroxy-2′-deoxyguanosine (8-oxoG) levels (mean ± SD, median; ng/mg creatinine)

Baseline	73.38 ± 107.72; 35.59
Second week	78.46 ± 100.39; 42.50
Third month	105.37 ± 162.23; 49.20

Fig. 1.

Boxplot graph for urinary 8-hydroxy-2′-deoxyguanosine (8-oxoG) levels (ng/mg creatinine) at baseline (1), 2 weeks (2), and 3 months (3) following radioactive iodine therapy (RAI) in patients with differentiated thyroid cancer (n = 55). No statistically significant differences were observed across time points (repeated measures ANOVA, p = 0.251)

Clinical parameters such as age, gender, smoking status (pack-years), DTC subtype, tumor stage, and cancer histology (papillary vs. follicular) were analyzed in relation to genotype. No significant correlations were identified between these parameters and hOGG1 or APE-1 genotypes or allelic distributions.

Discussion

This study examined the relationship between oxidative DNA damage assessed by urinary 8-hydroxy-2′-deoxyguanosine (8-oxoG) and polymorphisms in two key base excision repair enzymes, hOGG1 (Ser326Cys) and APE-1 (Asp148Glu), in patients with differentiated thyroid cancer (DTC) treated with high-dose radioactive iodine (RAI). Although urinary 8-oxoG levels showed a mild increase at 2 weeks and 3 months after RAI, these changes were not statistically significant. Likewise, no consistent associations were observed between either gene polymorphism and urinary 8-oxoG levels or clinical parameters. The Ser/Cys genotype of hOGG1 was significantly less frequent in patients than in controls, suggesting a possible protective association.

8-oxoG is a well-established marker of oxidative DNA damage, most induced by reactive oxygen species and ionizing radiation [2, 16]. If unrepaired, it can lead to mutagenic G:C toT:A transversions and accelerate cellular aging [2, 16]. Chronic accumulation of 8-oxoG in telomeric DNA has also been implicated in telomere shortening and genome instability [17].

Although the observed increase in urinary 8-oxoG levels post-RAI did not reach statistical significance, the trend toward higher levels at 3 months may reflect a delayed or cumulative oxidative stress response. This could indicate either a lag in the generation of oxidative lesions following high-dose RAI or a gradual decline in repair efficiency over time. Alternatively, it may suggest that short-term DNA repair mechanisms, particularly those involving hOGG1 and APE-1, initially buffer oxidative insult but may not fully prevent persistent damage in all patients. Further studies incorporating extended follow-up, additional oxidative stress markers, and functional repair assays are needed to determine whether these observed changes carry long-term clinical significance.

The hOGG1 and APE-1 enzymes are central to the base excision repair (BER) pathway and are responsible for the excision of oxidative DNA lesions such as 8-oxoG [2]. The Ser326Cys substitution in hOGG1 introduces a cysteine residue with a thiol group that could alter the enzyme’s conformation or function [18]. Similarly, phosphorylation-dependent regulation of the serine residue may be disrupted, potentially impairing repair efficiency. Previous studies have demonstrated the relevance of these polymorphisms in various cancers, within consistent findings [12, 13, 17, 19–23]. While our study found a lower frequency of the Ser/Cys genotype in DTC patients compared to controls, this association did not extend to 8-oxoG levels, and theCys/Cys genotype was not significantly different between groups.

Animal and cellular models have provided mechanistic insights into the effects of BER deficiencies. Fouquerel et al. showed that 8-oxoG accumulation in telomeric DNA due to OGG1 loss leads to replication stress and chromosomal instability [17]. Similarly, Ohno et al. reported shortened lifespan and increased tumor incidence in mice lacking Mth1, Ogg1, and Mutyh, emphasizing the importance of these repair enzymes in maintaining genome integrity [21]. However, in contrast to these models, our findings suggest that in clinical settings involving RAI-treated DTC patients, oxidative DNA damage is relatively modest and may not overwhelm the BER capacity in the short term.

For APE-1 Asp148Glu, our results align with previous reports by Chiang et al. and Doğru-Abbasoğlu et al., which found no significant associations between this polymorphism and thyroid-related disease risk [20, 22]. Similarly, in our cohort, genotype distributions and urinary 8-oxoG levels did not differ significantly between patients and controls.

We also analyzed clinical and pathological parameters including tumor subtype, stage, gender, age, and smoking habits in relation to genotype and 8-oxoG levels. No significant associations were identified, suggesting that neither polymorphism is linked to disease phenotype or oxidative stress burden in this population.

Although a statistically significant association was observed for the hOGG1 Ser/Cys genotype, this finding should be interpreted with caution. The study’s modest sample size and lack of covariate-adjusted models limit the strength of inference. A post hoc power analysis was planned but not reported in detail, and such analyses have limited interpretive value [14, 15]. Furthermore, correction for multiple testing was not applied, and the potential for false-positive results must be considered. Future research with larger, more diverse cohorts and multivariable modeling is warranted to confirm these associations and clarify the biological role of BER variants in RAI-treated DTC patients.

This study’s strengths include the longitudinal design with repeated measurement of urinary 8-oxoG, the use of validated genotyping methods for functionally relevant DNA repair gene polymorphisms, and the inclusion of a demographically matched control group. However, limitations must be acknowledged. The sample size may have limited statistical power, particularly for detecting genotype–phenotype associations involving less frequent alleles. Although the study was originally powered to detect small-to-moderate effects and enrolled enough patients (n = 79), urinary 8-oxoG measurements could only be completed in 55 patients due to unforeseen funding constraints following the lead investigator’s illness and passing. Individual 8-oxoG variability and the influence of unmeasured confounders such as diet or renal clearance may also affect biomarker interpretation. Additionally, multivariable adjustment and correction for multiple comparisons were not applied, which should be addressed in future studies.

Conclusion

To our knowledge, this is the first study to investigate hOGG1 (codon 326) and APE-1 (codon 148) polymorphisms alongside urinary 8-oxoG levels in DTC patients undergoing high-dose RAI therapy. While the findings suggest a possible protective role for the hOGG1 Ser/Cys genotype, no consistent association was observed between these polymorphisms and DTC susceptibility, oxidative DNA damage, or clinical characteristics. Larger studies incorporating broader genetic profiling and functional validation are needed to clarify the role of DNA repair gene variants in thyroid cancer risk.

Author contributions

fevzi necati avşar collected patient data and collected urine and blood samples. evin ademoğlu and semra doğru abbasoğlu conducted biochemical studies on blood and urine samples. The first three authors conducted the statistical analysis and drafted the manuscript together. Tuncay Sahutoglu review of the manuscript.

Funding

Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK).

Data availability

No datasets were generated or analysed during the current study.

Compliance with ethical standards

Ethics committee approval

Approval was received from the Istanbul Medical Faculty ethics committee in 2010 (file number: 2010/886-276. Meeting date: 26.11.2010; number: 10073).

Patient consent

The patients were included in the study after their informed consent was obtained.

Conflict of interest

The authors declare that they have no conflict of interest.