Abstract
WNTs are critical to many developmental and disease processes. They are post-translationally acylated at a serine within a highly conserved sequence termed the "WNT motif". Changes in individual amino acids in the WNT motif reduce but do not eliminate WNT function. However, the role of a highly conserved triplet of residues (Cys-His-Gly) upstream of the serine has yet to be examined. We show that an in-frame deletion of the Cys-His-Gly triplet in zebrafish Wnt16 likely functions as a null mutation. These findings highlight the utility of using small in-frame indels that target conserved amino acid regions to modulate protein function.
Figure 1. The Cys-His-Gly triplet within the WNT motif is necessary for Wnt16 function.
A. (Top) Sequence alignment of Xenopus (X) Wnt8, human (H) WNT1-16, and zebrafish (D) Wnt16. Asterisks indicate the highly conserved Cys-His-Gly triplet within the WNT motif. "A" indicates the serine that is post-translationally acylated. (Bottom) Darker and taller bars indicate higher consensus at that amino acid position.
B. Sequence and genomic location of wnt16 w1012 . Grey highlight indicates gRNA target sequence in exon 4 used for CRISPR-based gene editing.
C. Predicted effects of allele on amino acid sequence with location on protein indicated.
D. 2-way ANOVA analyses of volume, tissue mineral density (TMD), and thickness for centrum, haemal arch, and neural arch, and centrum length. n=10/group for wnt16 w1001 clutchmate controls and wnt16 w1012 homozygous mutants and clutchmate controls. n=6/group for wnt16 w1001 homozygous mutants. Purple highlight and table indicate phenotypic features of wnt16 w1001 and wnt16 w1012 that differ significantly from controls.
E. Maximum intensity projections of representative microCT scans for one wnt16 w1012 fish and one clutchmate control.
F. (Top) Structural model of the wild-type Wnt16 protein (green) with inset showing superimposition of the protein encoded by wnt16 w1012 (orange). Blue dotted lines represent hydrogen bonds. “CHG” represents the location of the Cys-His-Gly triplet on Wnt16. Arrows indicate the location of acyl addition (*Ser215 is equivalent to Ser218 but shifted due to triplet deletion). (Bottom) Tables showing missing/created hydrogen bonds within the thumb of the encoded protein of wnt16 w1012 . Numbers in parentheses indicate the number of those specific bonds that are missing or created.
Description
WNT proteins are highly conserved cysteine-rich glycoproteins critical to numerous developmental, regenerative, homeostatic, and pathological processes. Given their functional importance, it is essential to understand how specific mutations alter WNT protein function. While missense and loss-of-function variants for genes encoding WNT proteins have been well-characterized, much less is known about the functional consequences of small in-frame insertions and deletions (indels). Indels occur frequently within the genome and can have significant repercussions on protein structure (Savino et al., 2022; Miton and Tokuriki, 2023). Moreover, small in-frame indels have been linked to diseases involving WNT family members (Kantaputra et al., 2018). Therefore, there is a scientific need to better understand how small in-frame indels alter WNT protein function, as this could lead to principles that help to predict the consequences of genetic variation in WNT genes, as well as reveal novel strategies to manipulate WNT signaling.
Here, we examine the consequences of a small deletion in the so-called “WNT motif”, a sequence of highly conserved amino acid residues present in all 19 known human WNT proteins: (C-[KR]-C-H-G-[LIVMT]-S-G-x-C) (Laine et al., 2013) ( Fig. 1A ). The WNT motif resides in the N-terminal saposin-like “thumb” domain which has multiple functions including serving as the site of a post-translational acylation at a highly conserved serine, as well as facilitating the engagement of WNTs with Frizzled (FZD) receptors (Janda et al., 2012). Residues in the WNT motif have individually been found to play important roles in WNT function, predominantly through single amino acid substitutions. For example, Rios-Esteves et al. showed that substituting individual conserved amino acids within the WNT3A thumb domain limits—but does not eliminate—secretion and activity in vitro (Rios-Esteves et al., 2014). Although the effects of single amino acid substitutions in the WNT motif have been well-characterized, how small deletions in the WNT motif alter the function of WNT proteins remains unknown.
Using CRISPR/Cas9-based gene editing in zebrafish, we isolated the wnt16 w1012 mutant line (c.640_648delTGTCATGGC) ( Fig. 1B ). wnt16 w1012 is a 9 base-pair in-frame deletion resulting in loss of the Cys-His-Gly sequence within the WNT motif (p.Cys214_Gly216del) ( Fig. 1C ). WNT16 plays an important role in skeletal development, maintenance, and genetic influence on bone mineral density (Gómez et al., 2023). Recently, we showed that wnt16 is necessary for spine and muscle morphology in zebrafish (Watson et al., 2022). In this study, we examined three different mutant alleles ( w1001 , w1008 , and w1009 ) encoding for nonsense mutations predicted to result in the loss of key domains and residues critical for Wnt activity and secretion. Homozygous mutants for all three alleles phenocopied, indicating that all three alleles are likely functioning as null alleles (Watson et al., 2022). After the publication of Watson et al., we isolated the wnt16 w1012 mutant harboring a small in-frame deletion in the highly conserved WNT motif, offering a unique opportunity to evaluate the phenotypic consequences of loss of the Cys-His-Gly triplet in the WNT motif and how this compares to other wnt16 mutants.
To investigate the phenotypic effects of the wnt16 w1012 mutation on adult vertebral morphology, we performed microCT scanning in wnt16 w1012 mutants and wild-type (WT) clutchmates at 90 days post fertilization (dpf). FishCuT, a segmentation algorithm developed by our lab for microCT-based phenotyping in the zebrafish skeleton, was used to measure volume, tissue mineral density (TMD), thickness, and centrum length for the centrum, haemal arch, and neural arch of the 20 anterior-most pre-caudal and caudal vertebrae, resulting in 200 measures per fish (Hur et al., 2017). FishCuT analysis revealed significant differences between WT fish and wnt16 w1012 mutants: wnt16 w1012 mutants (n=10/group) exhibited significantly reduced centrum lengths (p<0.0001), along with a significant increase in neural arch angles (p=0.0002) ( Fig. 1E ). Thus, adult wnt16 w1012 mutants exhibit altered spine morphology.
In order to better understand the impacts of loss of the Cys-His-Gly on Wnt16 function, we compared wnt16 w1012 mutant phenotypes to those of wnt16 w1001 mutants, which our previous studies indicated was functioning as a null allele (Watson et al., 2022). We used two-way ANOVA statistical tests to formally compare wnt16 w1012 and wnt16 w1001 mutant phenotypes. For this, we used the average of each of the 10 FishCuT measurements. The two-way ANOVA allowed us to simultaneously determine whether: (1) there were common phenotypic differences between WT and mutants for both alleles (indicated by p -value for genotype), (2) there were baseline phenotypic differences for different alleles due to genetic background and/or environmental conditions when testing each allele (indicated by p -value for allele), and (3) mutants for each wnt16 allele exhibited different phenotypic responses when compared to WT (indicated by p -value for genotype:allele interaction). Two-way ANOVA analyses confirmed significant effects of genotype for centrum length (p<0.0001) and revealed significant effects of genotype for centrum volume (p=0.0088) and centrum (p=0.0404), haemal arch (p=0.0264), and neural arch (p=0.0166) TMD ( Fig. 1D, E). While we observed significant effects of allele impacting both controls and mutants for most measures ( Fig. 1D ), this is unlikely to be due to differences in genetic background, as both wnt16 w1012 and wnt16 w1001 mutants were generated in an AB background but tested at different times. Rather, this is likely due to slight changes in the environment when testing each allele and their clutchmate controls, which resulted in different developmental rates. Notably, there were no significant genotype:allele interactions across any of the ten measurements analyzed ( Fig. 1D ). Therefore, the phenotypic responses in wnt16 w1012 and wnt16 w1001 mutants were similar, suggesting that wnt16 w1012 is functioning similarly to a null allele.
We next sought to determine the structural impact of the Cys-His-Gly triplet deletion on the Wnt16 protein. Structural modeling of the encoded protein of wnt16 w1012 and superimposition with WT Wnt16 suggested conformational changes within the thumb domain resulting from the triplet deletion ( Fig. 1F ) (Confidence: 0.70) (Baek et al., 2021). Specifically, the predicted protein encoded by wnt16 w1012 exhibited alteration of multiple hydrogen bonds and truncation of the antiparallel beta sheets within the thumb domain. Notably, several native hydrogen bonds in WT Wnt16 were lost, while novel, aberrant hydrogen bonds were formed in the mutant ( Fig. 1F ). Loss of the Cys within this motif additionally resulted in the loss of the native disulfide bond involving this residue. These changes suggest that deletion of the conserved Cys-His-Gly triplet may significantly alter WNT structure and potentially, its function.
Taken together, our in vivo studies and structural modeling indicate that the Cys-His-Gly triplet within the WNT motif is essential for Wnt16 function. Given the highly conserved nature of the WNT motif, it is likely that this function is shared amongst all WNT family members harboring this sequence. Prior studies of genetic variation in WNTs have almost exclusively focused on nonsense mutations or missense mutations. These studies have shown that single amino acid substitutions in Wnt proteins reduce but do not eliminate secretion and/or activity (MacDonald et al., 2014; Rios-Esteves et al., 2014). Conversely, while prior studies have shown the potential for nonsense mutations in WNT genes to be deleterious, premature termination codons could trigger genetic compensation by mutant mRNA degradation (El-Brolosy et al., 2019). Moreover, truncated WNT protein products could have residual or even dominant negative effects (Hoppler et al., 1996). Our findings suggest that a small in-frame deletion of the Cys-His-Gly triplet in the WNT motif eliminates WNT function. A limitation of this study is that it is unknown whether Wnt16 secretion or activity is affected by the loss of the Cys-His-Gly triplet. However, this could be investigated in future studies with the development of suitable Wnt16-specific antibodies. The results we report here contribute to our understanding of the consequences of small in-frame deletions in the WNT motif and support the utility of using small in-frame indels that target conserved amino acid regions to modulate protein function.
Methods
Ethics statement:
These experiments were conducted on an approved protocol in accordance with the University of Washington Institutional Animal Care and Use Committee (IACUC).
Zebrafish care and genotyping:
Zebrafish used in these experiments were housed in a facility on a 14:10 hour light:dark photoperiod. All fish were housed in plastic tanks at 28.5 degrees C on a commercial recirculating aquaculture system and fed a commercial diet. Conducted studies used mixed sex WT (AB) and mutant ( wnt16 w1012 ) lines. Clutches of the heterozygous and homozygous mutants were housed together. Experimental animals were generated by incrossing heterozygous wnt16 w1012 zebrafish.
Genotyping was performed by taking fin clip samples from adult (90 days post fertilization (dpf)) zebrafish and using standard PCR procedures (35 cycles, 58°C annealing temperature). The following primers were used for wnt16 w1012 (F: 5’- CATGCTCTCCGTGTCCTGTT-3’, R: 5’- ATCCTTGCGTCGCACCTTAC-3’). Gel electrophoresis on 3% high-resolution agarose gels identified WT and mutant alleles based on amplicon sizes.
CRISPR/Cas9-based gene editing:
CRISPR mutagenesis was performed using the Alt-R CRISPR-Cas9 System from Integrated DNA Technologies (IDT). The gRNA duplex was generated by mixing tracrRNA with crRNA in a 1:1 ratio. This mixture was then incubated at 95 degrees C for 5 minutes and cooled on ice. Ribonucleoprotein complexes were made by mixing Alt-R S.p. HiFi Cas9 Nuclease with a 3XNLS sequence with the crRNA:tracrRNA gRNA duplex in a 1:1 ratio. This mixture was then incubated at room temperature for 5-10 minutes, producing the Cas9:gRNA RNP complex at ~25 mM for injection. Pre-pulled microcapillary needles (Tritech Research) were loaded with RNPs and calibrated. Yolks of 1- to 4-cell stage zebrafish embryos were injected with 2 nL RNP complexes. The following crRNA guide target sequence was used to target exon 4 of wnt16 : (5’—AACCCGATACGCCATGACAG—3’).
Micro-computed tomography (microCT) scanning and analysis: Fish were imaged at 90 dpf using a Scanco vivaCT 40 microCT scanner. Acquired scans with 21 μm voxel size were taken using these settings: 500proj/180 °, 145mA, 1024 samples, 55kVp, 200 ms integration time. Scanco software generated DICOM files of each fish, which were then used for maximum intensity projections of DICOM images. Scans of 4 fish were taken simultaneously in each acquisition. Maximum intensity projections were used for analysis.
FishCuT was used to segment the vertebrae, and analysis was performed as previously described (Hur et al., 2017).
Statistical analysis:
The majority of results are from a single experiment. One technical replicate is represented by each biological replicate. Empirical data are represented as mean ± SEM or as individual measurements. Figure caption reports group sizes (n). No outliers were identified, and all data were included in statistical analyses. The global test using the globaltest package in R was used to perform multivariate analysis of vertebral data. GraphPad Prism was used to conduct all other statistical tests. p<0.05 was considered statistically significant across all data.
Structural modeling:
PDB files of our proteins of interest were generated using the RoseTTAFold method through Robetta (Baek et al., 2021). Computational models were created using Mol* Viewer (Sehnal et al., 2021). PDB files were uploaded, and regions of interest, with hydrogen bonds showing, were superimposed. Hydrogen bond analysis involved manual comparison of bonds between the superimposed regions.
Reagents
|
Reagent or Resource |
Source |
Identifier |
|
Genotyping |
||
|
DreamTaq DNA Polymerase |
Thermo Fisher Scientific |
Cat# EP0711 |
|
Proteinase K |
Thermo Fisher Scientific |
Cat# EO0491 |
|
Sequencing |
||
|
GeneJET Gel Extraction Kit |
Thermo Fisher Scientific |
Cat# K0692 |
|
Primers |
||
|
wnt16 w1012 genotyping primers: Fwd, CATGCTCTCCGTGTCCTGTT; Rev, ATCCTTGCGTCGCACCTTAC |
This paper |
|
|
CRISPR Cas9 |
||
|
Alt-R CRISPR-Cas9 System |
Integrated DNA Technologies |
Cat# 1072532 |
|
wnt16 w1012 gRNA: AACCCGATACGCCATGACAG |
This paper |
|
|
Zebrafish Lines |
||
|
wnt16 w1001 |
Watson et al. 2022 |
ZIRC Catalog ID: ZL14731 |
|
wnt16 w1012 |
This paper |
ZIRC Catalog ID: ZL14818 |
|
Software |
||
|
GraphPad Prism (Prism 9.5.0) |
Graph Pad Software |
|
|
Fiji (ImageJ 2.16.0) |
Schindelin et al. 2012 |
|
|
FishCuT (FishCuT 1.2) |
Hur et al. 2017 |
|
|
RoseTTAFold (Robetta) |
Baek et al., 2021 |
|
|
Mol* Viewer (Mol* Plugin 3.40.1) |
Sehnal et al., 2021 |
Acknowledgments
Research reported in this publication was supported by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health under Award Number AR074417, as well as the Office of the Director (OD) and the Ernest M. Burgess Endowed Chair for Orthopedic Investigation. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The authors have no relevant financial or non-financial interests to disclose.
References
- Baek Minkyung, DiMaio Frank, Anishchenko Ivan, Dauparas Justas, Ovchinnikov Sergey, Lee Gyu Rie, Wang Jue, Cong Qian, Kinch Lisa N., Schaeffer R. Dustin, Millán Claudia, Park Hahnbeom, Adams Carson, Glassman Caleb R., DeGiovanni Andy, Pereira Jose H., Rodrigues Andria V., van Dijk Alberdina A., Ebrecht Ana C., Opperman Diederik J., Sagmeister Theo, Buhlheller Christoph, Pavkov-Keller Tea, Rathinaswamy Manoj K., Dalwadi Udit, Yip Calvin K., Burke John E., Garcia K. Christopher, Grishin Nick V., Adams Paul D., Read Randy J., Baker David. Accurate prediction of protein structures and interactions using a three-track neural network. Science. 2021 Aug 20;373(6557):871–876. doi: 10.1126/science.abj8754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El-Brolosy Mohamed A., Kontarakis Zacharias, Rossi Andrea, Kuenne Carsten, Günther Stefan, Fukuda Nana, Kikhi Khrievono, Boezio Giulia L. M., Takacs Carter M., Lai Shih-Lei, Fukuda Ryuichi, Gerri Claudia, Giraldez Antonio J., Stainier Didier Y. R. Genetic compensation triggered by mutant mRNA degradation. Nature. 2019 Apr 3;568(7751):193–197. doi: 10.1038/s41586-019-1064-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gómez Arianna Ericka, Addish Sumaya, Alvarado Kurtis, Boatemaa Priscilla, Onyali Anne C., Ramirez Emily G., Rojas Maria F., Rai Jyoti, Reynolds Kiana A., Tang W. Joyce, Kwon Ronald Young. Multiple Mechanisms Explain Genetic Effects at the CPED1-WNT16 Bone Mineral Density Locus. Current Osteoporosis Reports. 2023 Mar 21;21(2):173–183. doi: 10.1007/s11914-023-00783-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hoppler S, Brown J D, Moon R T. Expression of a dominant-negative Wnt blocks induction of MyoD in Xenopus embryos. Genes & Development. 1996 Nov 1;10(21):2805–2817. doi: 10.1101/gad.10.21.2805. [DOI] [PubMed] [Google Scholar]
- Hur Matthew, Gistelinck Charlotte A, Huber Philippe, Lee Jane, Thompson Marjorie H, Monstad-Rios Adrian T, Watson Claire J, McMenamin Sarah K, Willaert Andy, Parichy David M, Coucke Paul, Kwon Ronald Y. MicroCT-based phenomics in the zebrafish skeleton reveals virtues of deep phenotyping in a distributed organ system. eLife. 2017 Sep 8;6 doi: 10.7554/elife.26014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Janda Claudia Y., Waghray Deepa, Levin Aron M., Thomas Christoph, Garcia K. Christopher. Structural Basis of Wnt Recognition by Frizzled. Science. 2012 Jul 6;337(6090):59–64. doi: 10.1126/science.1222879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kantaputra Piranit Nik, Kapoor Seema, Verma Prashant, Intachai Worrachet, Ketudat Cairns James R. Split hand-foot malformation and a novel WNT10B mutation. European Journal of Medical Genetics. 2018 Jul 1;61(7):372–375. doi: 10.1016/j.ejmg.2018.02.001. [DOI] [PubMed] [Google Scholar]
- Laine Christine M., Joeng Kyu Sang, Campeau Philippe M., Kiviranta Riku, Tarkkonen Kati, Grover Monica, Lu James T., Pekkinen Minna, Wessman Maija, Heino Terhi J., Nieminen-Pihala Vappu, Aronen Mira, Laine Tero, Kröger Heikki, Cole William G., Lehesjoki Anna-Elina, Nevarez Lisette, Krakow Deborah, Curry Cynthia J.R., Cohn Daniel H., Gibbs Richard A., Lee Brendan H., Mäkitie Outi. WNT1 Mutations in Early-Onset Osteoporosis and Osteogenesis Imperfecta . New England Journal of Medicine. 2013 May 9;368(19):1809–1816. doi: 10.1056/nejmoa1215458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- MacDonald Bryan T., Hien Annie, Zhang Xinjun, Iranloye Oladoyin, Virshup David M., Waterman Marian L., He Xi. Disulfide Bond Requirements for Active Wnt Ligands. Journal of Biological Chemistry. 2014 Jun 1;289(26):18122–18136. doi: 10.1074/jbc.m114.575027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miton Charlotte M., Tokuriki Nobuhiko. Insertions and Deletions (Indels): A Missing Piece of the Protein Engineering Jigsaw. Biochemistry. 2022 Jul 13;62(2):148–157. doi: 10.1021/acs.biochem.2c00188. [DOI] [PubMed] [Google Scholar]
- Rios-Esteves Jessica, Haugen Brittany, Resh Marilyn D. Identification of Key Residues and Regions Important for Porcupine-mediated Wnt Acylation. Journal of Biological Chemistry. 2014 Jun 1;289(24):17009–17019. doi: 10.1074/jbc.m114.561209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Savino Simone, Desmet Tom, Franceus Jorick. Insertions and deletions in protein evolution and engineering. Biotechnology Advances. 2022 Nov 1;60:108010–108010. doi: 10.1016/j.biotechadv.2022.108010. [DOI] [PubMed] [Google Scholar]
- Schindelin Johannes, Arganda-Carreras Ignacio, Frise Erwin, Kaynig Verena, Longair Mark, Pietzsch Tobias, Preibisch Stephan, Rueden Curtis, Saalfeld Stephan, Schmid Benjamin, Tinevez Jean-Yves, White Daniel James, Hartenstein Volker, Eliceiri Kevin, Tomancak Pavel, Cardona Albert. Fiji: an open-source platform for biological-image analysis. Nature Methods. 2012 Jun 28;9(7):676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sehnal David, Bittrich Sebastian, Deshpande Mandar, Svobodová Radka, Berka Karel, Bazgier Václav, Velankar Sameer, Burley Stephen K, Koča Jaroslav, Rose Alexander S. Mol* Viewer: modern web app for 3D visualization and analysis of large biomolecular structures. Nucleic Acids Research. 2021 May 6;49(W1):W431–W437. doi: 10.1093/nar/gkab314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watson Claire J., Tang W. Joyce, Rojas Maria F., Fiedler Imke A. K., Morfin Montes de Oca Ernesto, Cronrath Andrea R., Callies Lulu K., Swearer Avery Angell, Ahmed Ali R., Sethuraman Visali, Addish Sumaya, Farr Gist H., Gómez Arianna Ericka, Rai Jyoti, Monstad-Rios Adrian T., Gardiner Edith M., Karasik David, Maves Lisa, Busse Bjorn, Hsu Yi-Hsiang, Kwon Ronald Young. wnt16 regulates spine and muscle morphogenesis through parallel signals from notochord and dermomyotome. PLOS Genetics. 2022 Nov 8;18(11):e1010496–e1010496. doi: 10.1371/journal.pgen.1010496. [DOI] [PMC free article] [PubMed] [Google Scholar]