5′-Phosphorothioester Linked Cyclic Dinucleotides, Endo-S-CDNs, Displaying Impressive Antitumor Activities In Vivo when Dosed Subcutaneously

Abstract

Cyclic dinucleotides (CDNs) have become popular as immunotherapies triggering an immune response achieved via their activation of the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway. Many analogs of 2′3′-cGAMP, c-di-GMP, and c-di-AMP have been developed and shown as effective cancer vaccines and immuno-stimulators for the induction of both the adaptive and innate immune systems. Unfortunately, these CDNs have been dosed via intratumor route, which is not convenient, especially for tumors that are difficult to reach. We recently introduced endo-S-CDNs as potent STING agonists but in our prior report we did not evaluate the in vivo efficacies of these novel STING agonists. Herein, we conduct a more extensive structure activity relationship study as well as in vivo evaluation of our best endo-S-CDNs. We demonstrate that endo-S-CDNs can be dosed via subcutaneous route to provide robust protection against MC38 and B16–F10 tumor models.

Introduction

Immunotherapies are promising agents for tackling cancer and they can be used as standalone treatment, antitumor vaccines and vaccine adjuvants. , Although immune-checkpoint blockade inhibitors have revolutionized cancer treatment and boosted patient survival across broad range of cancers, only a minority of patients respond to these therapies. − Also, both primary and secondary resistance of these blockade inhibitors pose a major clinical challenge. − For this reason, recent immunotherapy strategies have aimed at utilizing pathways that can alter T-cell suppressed tumor microenvironments (TME) into T-cell-infiltrated tumors, which are more susceptible to checkpoint blockades. The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway has emerged as an exciting target for anticancer immunity; this pathway, when activated, could turn ‘cold tumors’ into ‘hot tumors’ by activating the tumor’s immunogenicity.

The cGAS-STING pathway plays an important role in sensing pathogen-associated and damage-associated molecular patterns (PAMPs and DAMPs, respectively). − Following double-stranded DNA (dsDNA) detection in the cytoplasm, cGAS synthesizes a cyclic dinucleotide known as 2′3′-cGAMP (structure shown in Figure ) using ATP and GTP as substrates. 2′3′-cGAMP has a unique 2′-5′ phosphodiester linkage mixed with a conventional 3′–5′ phosphodiester linkage. , Binding of 2′3′-cGAMP to STING in the endoplasmic reticulum (ER) leads to a conformational change, where the C-terminal CDN binding domain (CTD) revolves relative to the N-terminal transmembrane domain (NTD) subsequently engulfing 2′3′-cGAMP. This conformational change triggers STING’s polymerization and eventual translocation from the ER to the Golgi apparatus where it recruits other downstream effectors via the tank binding kinase 1 (TBK1) and inhibitor of nuclear factor-κB kinase (IKK). This leads to the production of type I interferons (IFNs) as well as other pro-inflammatory cytokines via activation of interferon regulatory factor 3 (IRF3) and nuclear factor-κB (NF-κB).

1.

CDN-based STING agonist previously reported.

Type I IFNs are well established for promoting robust antitumor, antibacterial, and antiviral immunity. There is enormous evidence that suggest innate immune cells such as dendritic cells (DCs) produce type I IFNs and play a pivotal role in cancer immunosurveillance. Also, type I IFN-controlled antitumor immunity is dependent on an intact STING signaling pathway within the DC population. Therefore, STING agonism provides a platform in developing immunotherapies, which could elicit robust and durable antitumor immunity. In collaboration with Gravekamp’s group, we were among the first to demonstrate that c-di-GMP, the bacterial-derived CDN, activated STING in vivo to reduce 4T1 proliferation as well as improving vaccination against a model of metastatic breast cancer.

Indeed, CDN administered on its own or in combination with other therapies, such as checkpoint blockade, chimera antigen receptor T cells (CAR-T cells) and radiation, has shown efficacious and synergistic antitumor immunity. − However, poor cell permeability and rapid hydrolysis by plasma phosphodiesterases (PDEs) drastically hinders 2′3′-cGAMP’s in vivo utility. Hence, many synthetic 2′3′-cGAMP analogs, which harbor PDE-resistant linkages, have been developed with improved ADME properties. ,− Although these analogs have shown in vivo efficacy, majority of them are administered by intratumor injection, where these STING agonists are delivered directly to the tumor site. ,− Drawbacks of intratumor administration include: (i) its limitation to patient population, (ii) excessive leakage of CDNs from tumors into systemic circulation demonstrating off-target hyperinflammation, and (iii) the risk of overdosing a particular area where it was administered, leading to an ablative effect in immune cells. In order to address these challenges we became interested in developing CDN-based STING agonists that could be systemically administered. This could alleviate the burden of cost, technical expertise needed, and risk of infection during administration. We previously reported endo-S-cGA_FMP (3) and endo-S-cGA_LMP (4) as potent STING agonists, which are stable to clinically relevant phosphodiesterases like ectonucleotide phosphodiesterase I (ENPP1) and poxvirus immune nucleases (poxin). Herein, we explore a more thorough structural activity relationship (SAR) of the first-generation endo-S-CDNs, focusing on both 2′3′-CDNs and 3′3′-CDNs, and evaluate the best analogs activity and in vivo efficacy in MC-38 and B16–F10 tumor models.

Result and Discussion

Interestingly, most CDN-based STING agonists in clinical development as immuno-oncology agents (for example ADU-S100, E7766, MK-1454, and BI 7446 shown in Figure ) contain an exophosphorothioate modification, where a nonbridging oxygen is replaced with sulfur. Notwithstanding their effectiveness, this strategy produces a new P-chiral center that is difficult to set and hence pose significant challenges in purifying the synthesized diastereomers, leading to low synthetic yields. Also, desulfurization of exophosphorothioate oligonucleotides is prevalent during the cleavage and deprotection step using either solid phase or solution phase synthesis (under aqueous ammonia in the presence of trace amounts of Fe²⁺, Ni²⁺, or Cr³⁺), and occurs readily in aqueous solution. , Hence, novel CDNs that are easier to synthesize with better synthetic yields and retaining potency are highly desirable. Our group has previously explored the synthesis of endo-S-CDN analogs where a 5′-bridging oxygen of a phosphodiester is replaced with sulfur. ,,, The phosphorus on these endo-S-CDNs lacks chirality, hence alleviate the purification and yield concerns posed by exophosphorothiate CDNs. We have shown that such atomic editing confers cleavage resistance to phosphodiesterases that degrade phosphodiester-containing cyclic dinucleotides. , We previously reported compound 3 as a STING agonist, with in vitro activities against THP1 monocyte that were comparable to ADU-S100 (a CDN that was evaluated in the clinic). In our earlier study, we did not evaluate the in vivo efficacy of compound 3. Here, we synthesized and tested various analogs of compound 3 and we now show that compound 3 and another analog 4 show excellent efficacy in MC38 and B16–F10 mouse tumor model when administered via subcutaneous route.

Biological Methods and Assays

In order to profile the potency of our synthesized endo-S-CDNs, both biochemical and cellular assays were used. To evaluate the binding affinity of hSTING (human STING), we used the differential scanning fluorimetry (DSF) assay, which measures the thermal shift (ΔTm shift) upon binding of CDNs to hSTING. This assay assumes that the thermal stability of CDN-hSTING complex corresponds with its binding affinity. We confirmed the preliminary thermal shift binding results with a hSTING fluorescence polarization (STING FP) assay previously reported by us. This assay uses fluorescein labeled c-di-GMP, which in the presence of strong STING binders is readily displaced and exhibits low anisotropy but with poor binders it leads to increased anisotropy. The effectiveness of CDNs to activate IRF induction in THP1 monocytes and RAW macrophages was determined using the QUANTI-Luc luminescence assay.

SAR Exploration

For our SAR correlation we compared the activities of all analogs synthesized (5–33) to 2′3′-cGAMP, ADU-S100, 3 and 4. To account for the variation in activity that may arise as a result of the increased ring size from changing a bridging oxygen to a bridging sulfur, we decided to focus on both endo-S-2′3′-CDNs and endo-S-3′3′-CDNs. A change of 3′–OH in 3 to a hydrogen in 5 leads to a loss in potency as evident from the STING binding and EC₅₀ determination assays (see Table ). Also, stemming from the effectiveness of 3, we opted to change the adenine moiety to cytidine, uridine and inosine as is shown in Table for 6, 7, and 8 respectively. The DSF result show that this change leads to a loss in binding affinity for the pyrimidines as evident for 6 and 7 but inosine retains binding potency as shown by 8 (endo-S-cGI_FMP) having similar ΔTm value to ADU-S100 and 3 (see Table ). 8 also exhibited better STING FP (IC₅₀ = 7.37 μM) than 3 (IC₅₀ = 13.97 μM) and ADU-S100 (IC₅₀ = 12.8 μM) as well as approximately 4-fold lower EC₅₀ in the THP1 wildtype (WT) cellular assay compared to 2′3′-cGAMP. 8 maintains potency in THP1 KI STING R232 and RAW dual WT cells unlike 2′3′-cGAMP, with comparable results to 3 and ADU-S100. A change of the fluorine in 8 to hydrogen in 9 leads to approximately 8-fold loss of EC₅₀ in THP1 monocytes. In addition, modifying the adenine nucleobase in 3 to an ethenoadenine base for 10, results in reduced binding and IRF induction in THP1 cells. Interestingly, altering the adenine of 3 to a guanine in 12, maintains potency as well as STING binding. This shows all 2′-fluoro modified endo-S-CDN analogs with natural purines as in 3 (adenosine), 8 (inosine), and 12 (guanosine) are all potent STING agonists. This may be due to the ability of the purines to form key hydrogen bonds as well as pi–pi interactions, which are not accessible to pyrimidines. We attempted to improve cellular penetration of our endo-S-CDNs by making an analog, 13, where a charged oxygen is replaced with a neutral methyl group. While this modification leads to chirality at phosphorus, we could only isolate one isomer out of the potential two diastereomers. In addition to the poor yield of 13 (4%), initial evaluation of 13 indicated it did not bind to STING and no THP1 activity was observed, thus there was little impetus to continue spending resources to figuring out which isomer (R or S at phosphorus) was obtained in 13.

1. Structure–Activity Relationship of Endo-S-CDNs Varying Right-Hand Nucleobase With Ribose Substitution.

^aThermal shift assay to determine STING binding.

^bFluorescence polarization assay to determine binding affinity for analogs to STING.

^cReporter assay in THP1 cells to determine EC₅₀ values.

^dReporter assay in RAW cells to determine EC₅₀ values.

Next, we investigated changing the nucleobase of 3 from guanine to adenine and uridine while altering the right-hand nucleobase (see Table ). Though 14 is a close analog to ADU-S100, there is a complete drop in efficacy as evident from thermal shift assay, STING FP and cellular assays. Unfortunately, changing the adenine in 14 to guanine (15) and 2’–OH to fluorine as in 16 only leads to a partial rescue of binding as seen in Table . We then explored changing the guanine in 3 to a uridine moiety as in 17 and this substitution leads to loss in activity. Interestingly, flipping the two bases of 3 as in 18 rescues or retains some activity as shown by both the STING binding assays and EC₅₀ determination (see Table ). This shows that the nature of the purine relative to 2′ and 3′ linkage positions is pivotal for STING binding and activation. Next, we investigated if substituting a charged oxygen for a methyl group can impact activity. Just like 13, this modification adds chirality at phosphorus, and we could only isolate one of the isomers, 19, in a poor yield (3%). Unfortunately, this isomer was inactive, like results for 13, and hence no efforts were put into determining the absolute chirality at phosphorus in 19.

2. Structure–Activity Relationship of Endo-S-2′3′-CDNs Varying Both Nucleobases and Ribose Substitution.

^aThermal shift assay to determine STING binding.

^bFluorescence polarization assay to determine binding affinity for analogs to STING.

^cReporter assay in THP1 cells to determine EC₅₀ values.

^dReporter assay in RAW cells to determine EC₅₀ values.

We have shown in a previous publication that locked nucleic acid (LNA) endo-S compound 4 is a potent STING agonist. Replacing the 3′–OH of 4 to hydrogen is detrimental to STING binding as shown for 20 (Table ). Substituting the guanine group in 4 to adenine, as in 21, leads to a loss in STING binding and IRF activation in THP1. Also, replacing the guanine in 4 to uridine, as in 22, leads to a loss in activity, which suggests that for LNA endo-S-CDN, the guanine moiety on the ribose unit bearing the noncanonical 2′-phosphorothioate linkage might be essential for activity.

3. Structure–Activity Relationship of Analogs of 4, Varying the Left Nucleobase or Ribose Substitution.

^aThermal shift assay to determine STING binding.

^bFluorescence polarization assay to determine binding affinity for analogs to STING.

^cReporter assay in THP1 cells to determine EC₅₀ values.

^dReporter assay in RAW cells to determine EC₅₀ values.

Next, we wanted to synthesize various sugar conformers of 3 (changing the ribose group to either xylose or arabinose) and probe activity with respect to STING binding and cellular activity. Replacing the adenosine ribose group of 3 to a xylose group in 23 completely alters and kills its potency as shown in Table . Altering the guanosine ribose of 3 to an arabinose sugar as in 24 improves the cellular profiles as evident from its performance in THP1 and RAW cells (see Table ). This result differs to what was observed in arabinose and xylose modified 2′3′-cGAMP containing natural phosphodiester linkages, where the xylose derivative still retains some of its binding and cellular potency and arabinose 2′3′-cGAMP shows a slightly better IRF activation compared to 2′3′-cGAMP. In our case the arabinose endo-S analog (24) shows STING binding and excellent cellular potency but xylose modified endo-S analog (23) is a poor STING binder and inactive in the THP1 IRF induction assay (Table ). It appears that the properties of CDNs containing the natural phosphodiester linkages cannot be readily extrapolated to the endo-S CDNs, albeit the conservative change from 5′-phosphodiester to a 5-phosphorothioester.

4. Structure–Activity Relationship of Analogs of 3 Containing Xylose and Arabinose-Substituted Sugars.

CDN	DSFΔTm [K]	FP STING IC50 (μM)	THP1 EC50 (μM) IRF induction		RAW dual WT EC50 (μM)
			WT	KI STING R232
2′3′cGAMP (1)	15.0	18.25 ± 0.98	15.47 ± 2.30	19.79 ± 0.88	70.067 ± 0.002
ADU-S100 (2)	10.0	12.80 ± 0.26	4.08 ± 0.20	3.83 ± 0.65	13.646 ± 0.001
3 (endo-S-cGAFMP)	11.3	13.97 ± 1.68	2.45 ± 0.01	3.29 ± 0.21	5.54 ± 0.01
23	2.0	>25	>50	N.D	N.D
24	7.0	10.53 ± 1.99	1.57 ± 0.01	1.418 ± 0.001	0.886 ± 0.001

^aThermal shift assay to determine STING binding.

^bFluorescence polarization assay to determine binding affinity for analogs to STING.

^cReporter assay in THP1 cells to determine EC₅₀ values.

^dReporter assay in RAW cells to determine EC₅₀ values.

Motivated by the activity of previously reported fluorinated 3′3′-CDNs, ,, we sought to synthesize a library of endo-S-3′3′CDNs and evaluate their activity in both biochemical and cellular assays. Stemming from the activities of 3, 4, 8, and 12 we decided to focus on 3′–5′ phosphodiester CDNs only having purines, 2′-fluorinated and 2′,4′-LNAs. It is noteworthy that 26, a 2′2′-difluorinated endo-S-CDN bearing both guanine and adenine, had comparable STING binding and low EC₅₀ as demonstrated by 3, 4, and 8, with about 4-fold improvement over 2′3′-cGAMP in THP1 cells (see Table ). Interestingly, flipping the position of the nucleobases in 26, as in 27, leads to a 2.5-fold reduction in THP1 WT activity although both compounds have similar EC₅₀ values in RAW dual WT cells. 3′3′-cAIMPF₂, shown in Figure , is an ultrapotent STING agonist, which was previously developed by Lioux et al. (invivogen). We made the endo-S-CDN analogs of 3′3′-cAIMPF₂ (29 and 31) and evaluated their in vitro activity. Unexpectedly, 29 and 31 completely lost activity in both STING binding and THP1 assays (see Table ), one more showing that the replacement of a 5′-O bridging phosphodiester with a sulfur, though a minimal change, is significant enough to completely abrogate activity. Also, the endo-S-3′3′-CDN analogs of 8 (28 and 30) were inactive compounds. Compound 32, an endo-S difluorinated c-di-GMP show modest binding as seen from its DSF and STING FP data (see Table ). 32 also show modest IRF induction in THP1 and RAW cells. In addition, 33 bearing two guanine bases with a fluoro group and locked nucleic ribose could stabilize STING (ΔTm = 8°) but did not show binding to the CDN site in STING (inferred from inability to displace FAM-labeled c-di-GMP from STING, Table ). In agreement with the STING FP assay, 33 had no activity in the THP IRF induction assay. We note that while DSF is a good proxy for binding affinity, a positive thermal shift does not always mean tighter binding and that a secondary confirmatory assay (in this case the STING FP assay) is needed to confirm binding. In summary, 26 showed the best STING binding and cellular activity of all the endo-S-3′3′-CDNs we synthesized and analyzed. Although fluorinated canonical 3′3′-CDNs especially 3′3′-cAIMPF₂ (shown in Figure ) have good binding and cellular activities their corresponding endo-S analogs lose that potency as displayed in Table .

5. Structure–activity Relationship of endo-S-3′3′-CD ns With LNA and 2′-Fluorinated Ribose .

^aThermal shift assay to determine STING binding. Fluorescence polarization assay to determine binding affinity for analogs to STING. Reporter assay in THP1 and RAW cells to determine EC₅₀ values.

Docking 3, 23, and 24 to hSTING

Encouraged by the improvement in binding (determined by the FP assay) and cellular activity exhibited by arabinose-substituted (24) over xylose-analog (23) and ribose-epimer (3), we conducted a docking study to deduce if interactions in the binding pocket of STING could explain this experimental trend. Interestingly, our docking predicts the preferred binding pose of 23 (xylose derivative) is an open conformation as shown in Figure B, while 24 and 3 adopts preferentially a closed conformation in the binding pocket of STING (see Figure ) similar to the pose exhibited by MK-1454 bound to hSTING (PDB: 7MHC). This conformation facilitates binding to key amino acid residues with fewer steric clashes in STING’s binding pocket. Also, noteworthy is that the best binding pose for 23 is flipped compared to that for 3 and 24 with its adenine portion binding in the pocket where the guanine binds for both 3 and 24 (see Figure D). Docking shows these analogs all form key interactions with Tyr167, Arg238, Ser162, and Thr263 (see Figure ), while Only 3 and 24 forms hydrogen bonding with Thr269. Also, the 3′–OH of 24 is predicted to form an additional hydrogen bond with the backbone amide of Leu159. Docking was done with flare using PDB: 7MHC. It is important to note that the activities of 3, 23, and 24 may not be solely based on binding to STING but also interaction with CDN-based importers, − which traffic CDNs into mammalian cells.

2.

Docking of close endo-S-CDN analogs showing key interaction with amino acids in STING’s binding pocket (A) docking of 3 to STING’s binding pocket, (B) docking of 23 to STING’s binding pocket, (C) docking of 24 to STING’s binding pocket. Docking was performed using Flare from PDB: 7MHC. (D) Overlap of the best pose of 3, 23, and 24 in the binding pocket of STING.

STING activation results in downstream signaling leading to the transcription and expression of type I interferons and proinflammatory cytokines like CXCL10, TNFα, and IFNβ. ,− CXCL10 is highly inducted by interferons and NF-κB, and is the major chemokine that recruits CD8+ T lymphocytes to clear and regress expanding tumors. , Hence, we sought to evaluate these three tumor-associated cytokines in THP1 cells. Real-time quantitative PCR (RT-qPCR) analysis after treatment with CDNs shows that 3 (approximately 100-fold upregulation as compared to nontreated control) and 8 (roughly showing 400-fold induction vs nontreated control) induce the mRNA expression of CXCL10 at 10 μM (see Figure A) while marginally upregulating the transcription of both TNFα and IFNβ (see Figure B,C). However, it still performed better than 2′3′-cGAMP in upregulating TNFα and IFNβ as shown in Figure B,C. Also, 3 and 8 after treatment in PBMCs at 40 μM induce the expression of TNFα compared to 2′3′-cGAMP (see Figure D).

3.

Comparison of induction of some proinflammatory cytokines in either THP1 cells or PMBC. (A) mRNA expression levels of CXCL10 in THP1 cells. (B) mRNA expression levels of TNFα in THP1 cells. (C) mRNA expression levels of IFNβ in THP1 cells. (D) Expression of TNFα in PMBCs after treatment with endo-S-CDNs as quantified using an ELISA assay. The mRNA expression levels were determined by real-time quantitative PCR (RT-qPCR). Statistical significance was performed using Students t-test (paired, one-tailed) with significant differences as * P ≤ 0.05.

In Vivo Efficacy of 3, 4, and 8 in Mice Tumor Models

CDNs may induce ablative effect depending on cell-type and intratumor (IT) injection provides these CDNs at high concentration within the tumor microenvironment (TME) and this could induce a cytotoxic effect on T cells within this region. Also, intratumor administration of CDN-based STING agonist may not have an effect on metastasized tumors that have moved to distal regions of the body where the CDN was not injected. Hence, intravenous (IV) and subcutaneous (SubQ or SC) dosing could be adequate administration routes for STING agonist with the caveat of having a good therapeutic profile with no safety concerns. To develop these CDN-based STING agonist for systemic administration, these compounds should show little or no systemic hyperinflammation and should not overstimulate the immune machinery in normal cells but also be able to recruit and modulate different players that could elicit tumor suppression as well as reach distal tumors. We sought to investigate the antitumor activity of our potent STING agonist in vivo and chose MC38 and B16–F10 mouse tumor models. While the majority of in vivo studies with STING agonists utilized IT dosing, ALG-031048, a CDN-based compound with a north-methanocarba sugar modification, when dosed SubQ could reduce MC38-hPD-L1tumor, albeit modestly. Another carbocyclic containing STING agonist, developed by Takeda scientists, displayed in vivo efficacy when dosed via intravenous route. Thus, we wanted to investigate and compare the efficacy when endo-S-CDNs were dosed via SubQ and IT. For systemic administration, we preferred SubQ over IV dosing because SubQ is easier to implement than IV. Pleasingly, in the MC38 mice model, SubQ dosing of 3 provides robust protection against MC38 tumor growth (see Figure ). Dosing was done every three days for four times within the study period. 3 was dosed at 10 mg/kg for SubQ while IT dosing was at 100 μg initially and then 50 μg for the last three regimen. IT dosing of 4 and 8 was also at 100 μg for first administration and then changed to 50 μg for subsequent dosing. These compounds and the respective mode of administration did not affect the body weight of mice as can be seen in Figure S2A (see Supporting Information). Indeed, in the clinical setting, most CDN-based STING agonists, such as E7766, ADU-S100 (MIW815), have been reported to be reasonably tolerated (fever and fatigue being most adverse events) at concentrations that provided stable disease or tumor reduction. , Even in the case of ADU-S100, a maximum tolerated dose could not be reached in patients with metastatic disease. ,

4.

In vivo efficacy of endo-S-CDNs in MC38 mouse model. (A) Chemical structures of compounds 3, 4, and 8. (B) Plot of tumor volume against days after treatment of CDN regimen began. (C) Image of tumors at the end of the study. (D) Tumor growth curves of individual animals: in vehicle (blue), 3 IT dosed (red), 3 SubQ dosed (green), 4 IT dosed (purple) and 8 IT dosed (orange). Statistical significance was performed using Students t-test (paired, one-tailed) with nonsignificant and significant differences as follows: ns P > 0.05, *** P ≤ 0.001, and **** P ≤ 0.0001. The significance on each group is in relationship with vehicle unless otherwise stated in Figure A.

Pleasingly, the endo-S CDNs displayed good antitumor activities. The image of tumor after the end of the study is shown in Figure C, and analysis of respective tumor growth of each animal during the study is shown in Figure D. Due to the encouraging initial in vivo results obtained with the endo-S analogs, we wanted to investigate if 3, 4, and 8 were efficacious when dosed via SubQ in a B16–F10 mouse model. This time around we decided to compare only 3 via IT. Pleasingly, all three analogs dosed subcutaneously show antitumor efficacy with 4 outperforming 3 and 8 (see Figure B–D). 3 showed better antitumor immunity when dosed subcutaneously than when administered via IT. Also, the treatment of all endo-S-CDNs did not significantly affect the body weight of mice in this study (Figure S2B, Supporting Information). We currently do not know why in the case of the B16–F10 model, the SubQ dosing led to a better tumor reduction than IT dosing but we speculate that the mode of administration may have distinctive mechanism in activating T cells and other players to cause antitumor immunity and hence variation in the efficacy of 3 when dosed by either SubQ or IT. In fact others have shown that systemic administration of STING agonists can adequately lead to tumor shrinkage, probably via the activation of dendritic and T cells in spleens and/or tumor draining lymph nodes. , Even in the case of IT administration of STING agonists, which is predicated on local activation of the STING pathway in TME, some leakage of the STING agonist into systemic circulation is still possible. Thus, even for IT administration, the contribution of systemic activation of the immune system toward tumor reduction cannot be ignored. A potential complication of IT administration of STING agonists is the possibility of altered T-cell signaling or induced T cell death at high STING agonist concentration within the TME, which could lead to a reduction in T cell number and hence reduced efficacy. ,,

5.

In vivo efficacy of endo-S-CDNs in B16–F10 mouse model. (A) Chemical structures of compounds 3, 4, and 8. (B) Plot of tumor volume against days after treatment of CDN regimen began. (C) Image of tumors at the end of the study. (D) Tumor growth curves of individual animals: in vehicle (blue), 3 IT dosed (red), 4 SubQ dosed (purple), 3 SubQ dosed (green), and 8 SubQ dosed (orange). Statistical significance was performed using Students t-test (paired, one-tailed) with nonsignificant and significant differences as follows: ns P > 0.05, ** P ≤ 0.01, and *** P ≤ 0.001. The significance on each group in Figure A is in relationship with vehicle unless otherwise stated.

STING activation can lead to direct cancer cell death, , so we tested these endo-S-CDNs in vitro against both MC38 and B16–F10 cells to determine if the in vivo efficacy data was partly due to their ability to induce cell death in these cancer cells. Compounds 3, 4, and 8 do not kill MC38 and B16–F10 cells in vitro (see Figure S1). This suggests that the tumor shrinking ability of the compounds in vivo is likely via extrinsic mechanism, i.e. the endo-S-CDN compounds likely activate STING to recruit the immune machinery of the mice to suppress the tumor growth. Future work, beyond the scope of the current study, would aim to elucidate the mechanism by which these endo-S-CDNs provide robust protection against tumors when dosed via SubQ as this may provide insight into how the efficacy of STING agonists may depend on route of administration. We note that most CDN-based STING agonists trialed in the clinic were dosed via IT or IV; our data suggest that the mode of compound administration in these trials should be revisited.

Synthetic Preparation of Endo-S-CDNs

Conventionally, most CDNs are prepared via H-phosphonate chemistry, which involves one-pot synthesis developed by Jones and co-workers. This method entails the cyclization of 5′-O deprotected dinucleotide containing an H-phosphonate moiety using 2-chloro-5,5-dimethyl-1′3′2-dioxaposphorinane-2-oxide (DMOCP). This cyclization step is not efficient and leads to overall poor yields of CDNs. To make endo-S-CDNs we use an underutilized approach initially developed by Kool and co-workers on solid phase, and later adapted by us for the preparation of endo-S-c-di-GMP and analogs via solution phase and solid phase, respectively. , This approach is a multistep synthesis where the penultimate step is a reaction with ammonium hydroxide which is both a global deprotection and macrocyclization step. This synthesis strategy has better yield than CDNs made via the Jones’ method. To synthesize the xylose (23) and arabinose (24) modified endo-S-CDNs, we use an approach disclosed by Xie et al., where the hydroxy group of the protected nucleoside 34a and 35a, respectively, is converted to a good leaving group via triflation using triflic anhydride and DMAP, subsequently followed by nucleophilic attack with sodium trifluoroacetate (NaOTFA) to invert the configuration of the 2′- (arabinose) and 3′- (xylose) hydroxy group. This is illustrated in Schemes and , showing the synthesis of 23 (xylose modification) and 24 (arabinose modification), respectively. Scheme describes the synthesis of methyl phosphonate linked endo-S-CDNs. The synthesis of the other endo-S-CDNs is described in the Supporting Information.

1. Synthetic Preparation of 23 .

2. Synthetic Preparation of 24 .

3. Synthesis of Methyl Phosphonate Linked endo-S-CDN 13 and 19 .

Conclusion

To conclude, though numerous CDN-based STING agonist have been developed with impressive in vivo activity in mouse models, their preferred mode of administration has been via intratumoral route. Most clinical studies of these agonist are via intratumor (IT) injection and as combo therapy with immune checkpoint blockades. This mode of administration is limited for a localized population and might have ablative effect on T cells at high concentration, hence more systemic dosing options is needed in developing STING agonists for cancer immunotherapy. We have identified endo-S-CDNs STING agonist, which are efficacious when dosed via subcutaneous route. These compounds do not lead to weight loss or abnormal animal behavior, when dosed subcutaneously and they are efficacious as a standalone therapeutic in mouse models. In some instances, same compound dosed subcutaneously had better efficacy in suppressing tumor growth than when they were administered intratumorally. These CDN analogs hold promise for cancer immunotherapy and further preclinical studies are needed to evaluate their utility in the clinic and if they could synergize with other modalities, such as CAR T cell, anti-PD1 and anti-CTLA4 therapies.

Experimental Section

Biological Methods and Materials

For all biological assays and in vivo experiments, CDNs were dissolved in water. Sodium salts of the respective endo-S-CDNs were used for all in vivo studies.

Protein Expression and Purification

STING plasmid was received from Prof Pingwei Li’s lab. After plasmid transformation into Escherichia coli BL21 (DE3), the BL21 cells where cultured in LB media (10 mL) with 50 μg/mL of selection antibiotics (kanamycin and chloramphenicol). After overnight culturing, the 10 mL culture was inoculated into a 1L TB culture and supplemented with 50 μg/mL of both chloramphenicol and kanamycin. After attaining an OD of 0.6, 1 mM IPTG was added to induce STING expression and then the culture was incubated at 16 °C for 16 h. After incubation, the culture was collected via centrifugation at 5000 rpm for 30 min. Lysis buffer (50 mM Na₃PO₄, 300 mM NaCl, 20 mM imidazole, 5 mM β-mercaptoethanol (βME), 10% glycerol, pH = 7.4, and 1 mM phenylmethylsulfonyl fluoride) was added to the collected pellets. Lysis was achieved by sonication, and STING mixture was collected (supernatant) via centrifugation at 22,000 rpm for 25 min at 4 °C. STING was purified using a nickel His-trap column with a gradient of imidazole in the wash and elution buffers. The purified protein was dialyzed overnight at 4 °C and its concentration was estimated via UV–vis spectrometry at 280 nm wavelength (ε for STING = 47955 M^–1 cm^–1).

Differential Scanning Fluorimetry Assay or Thermal Shift Assay

To a solution of 150 μM CDNs in water was added to 20 μM of STING in a buffer (100 mM Tris–HCl, pH = 7.4, 150 mM NaCl) and 1:500 (v/v) SYPRO orange. Denaturation was done using a real time PCR (RT-PCR) cycler with a temperature gradient from 15 to 80 °C (increasing 1 °C per every 15 s).

$$\mathrm{\Delta }T\mathrm{m}=T_y-T_x$$

ΔTm values were reported by subtracting the average denaturing temperature (T _x ) determined for the untreated STING from the temperature (T _y ) determined for treatment with CDNs.

hSTING Fluorescence Polarization (FP) Assay

The fluorescence assay was adapted form Karanja et al. and as previously used by Yeboah et al.

EC₅₀ Determination in THP1 Dual WT, THP1 STING KI R232, and RAW Dual WT Cells

THP1 dual WT and THP1 KI STING R232 cells (from invivogen) were grown in RPMI media supplemented 1× penicillin/streptomycin (1× pen/strep) and 10% fetal bovine serum (FBS) in a 37 °C incubator (5% CO2) while RAW dual WT was cultured in DMEM media supplemented with 1x pen/strep and 10% FBS. After passaging and allowing to grow to confluence, all cell lines were seeded at a concentration 5 × 105 cells per ml in 96 well plates. After 24 h incubation at 37 °C cells were treated with CDNs ranging from concentration of 50 nM to 100 μM in triplicates to determine EC₅₀ values. After incubating for 24 h, IRF induction was deduced using QUANTI-Luc reagent (using manufacturer protocol), and the results were analyzed via Graph Pad Prism using the dose–response 4-point model.

Docking Analysis

MK-1454 bound to hSTING, PDB: 7MHC, crystal structure was obtained from RCSB Protein Data Bank and were prepared using the Protein Preparation Wizard; Flare Cresset. Ligands 3, 23, and 24 were exported as mol2 files and then imported to Flare, version 9.0 and prepared for docking using Ligand Preparation protocol. Docking was run using the “Very Accurate but Slow” method by centering at 4.0 Å on precrystallized MK-1454. For all three analogs, the best pose was selected for comparison. Contact maps and images were then generated with Flare, version 9.0, Cresset, Litlington, Canbridgeshire, UK: http://www.cresser-group.com/flare/

Real-Time Quantitative PCR (RT-qPCR)

The mRNA levels of some cytokines were quantified using RT-PCR (RT-qPCR). THP1 WT cells were seeded at a concentration of 1.5 × 10⁶ cells per ml in 6 well plates and after 24 h, CDNs were treated at either 5 μM of 3 and 10 μM of all CDNs including 3, with 2′3′-cGAMP used as a positive control. After 24 h incubation, cells were collected via centrifugation and total RNA was isolated using the trizol reagent method. After total RNA isolation, cDNA synthesis was performed using Superscript first strand synthesis system (per manufacturer protocol). Next, the synthesized cDNA was used for RT-PCR using the QuantiTect SYBR Green PCR kit performed on a CFX96 real-time system, with both forward and reverse primers of respective cytokines. RT-PCR primers used are listed in the supplementary. The mRNA expression levels were estimated according to the formula (2^–ΔΔCq) using GAPDH as an internal reference gene and normalized to the water-treated cells. Technical replicates were in triplicates and biological replicates were in duplicates. p < 0.05 was statistically significant using t-test. RT-qPCR primers of target cytokine genes and internal control gene are listed below.

Primer name	Sequence
IFN-β-F	AACAAGTGTCTCCTCCAAAT
IFN-β-R	TCTCCTCAGGGATGTCAAAG
CXCL10-F	CATTCTGATTTGCTGCCTTAT
CXCL10-R	TTGATGGCCTTCGATTCTGG
TNF-α-F	TGAAAGCATGATCCGGGACG
TNF-α-R	AGGCAGAAGAGCGTGGTGGC
GADPH-F	GGACCTGACCTGCCGTCTA
GAPDH-R	GAGTGGGTGTCGCTGTTGA

TNFα Quantification after Peripheral Blood Mononuclear Cells (PMBCs) Were Treated with CDNs

PMBCs were purchased from ATCC (catalog number: PCS-800-011) . After successful passaging cells were incubated in RPMI media supplemented with 1× pen/strep and 10% FBS. PMBC Cells were seeded at 5 × 10⁵ cells in 96 well plates for 24 h in previously described incubation conditions. CDNs were treated at 40 μM, after 24 h cells were applied on human TNF alpha ELISA research reagent kit Picokine (from Boster Bio) per manufacturer’s instruction. Experiments were done in triplicates and data was analyzed via GraphPad prism. CDNs were treated in triplicates and 2′3′-cGAMP as well as ADU-S100 was used as a positive control while water was used as negative control.

Cell Viability Experiment (GI₅₀ Determination)

MC38 and B16–F10 cells were seeded in 96-well plates. After 24 h incubation at 37 °C under 5% CO₂, CDNs were treated varying concentration from 50 nM to 40 μM. At 72 h incubation, 10 μL of CellTiter-Blue cell viability reagent (Promega) was added and later incubated for 3 h. MC38 and B16–F10 cells where only treated at 10 μM, 20 μM and 40 μM of the compounds. Fluorescence (λ_ex/λ_em = 560/590 nm) was read using Biotek Cytation 5 multimode reader. Experiments were done in triplicates and the cell viability were normalized to the water treated cells for respective cell lines.

Animal Experiments

All the procedures related to animal handling, care and the treatment in this study were performed according to the guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of BioDuro (MC38 tumor model) and Purdue University (B16–F10 tumor model) following the guidance of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).

Efficacy of endo-S-CDN in MC38 Tumor Model

The sodium salts of the respective endo-S-CDNs were used for this study. MC38 cells were cultured in DMEM medium supplemented with 10% heat-inactivated FBS, 1× pen/strep at 37 °C in an atmosphere of 5% CO₂. 5 × 10⁵ MC38 cells were suspended in 100 μL unsupplemented DMEM medium with 50% matrix gel and inoculated subcutaneously into the right flank of C57BL/6 female mice. When the tumor volume reached a size of approximately 72 mm³, mice were randomly subgrouped according to body weight and tumor volume and administered vehicle (PBS) and respective endo-S-CDN either intratumorally or subcutaneously. Each subgroup had six tumor-bearing mice. The tumor volume was measured twice a week with caliper and volume was reported in mm³ using the formula: V = 0.5 a x b ², where a and b are the long and short diameters of the tumor, respectively. Animals with tumor size larger than 2000 mm³ were euthanized.

Efficacy of endo-S-CDN in B16–F10 Tumor Model

The sodium salts of the endo-S-CDNs were used for this study. B16–F10 cells were cultured in DMEM medium supplemented with 10% FBS and 1× pen/strep at 37 °C in an atmosphere of 5% CO₂. 5 × 10⁵ cells were suspended in 100 μL unsupplemented DMEM medium and inoculated subcutaneously into the right flank of C57BL/6 female mice. When the tumor volume reached a size of approximately 100 mm³, mice were randomly grouped according to body weight and tumor volume and administered vehicle (PBS) and respective endo-S-CDN either intratumorally or subcutaneously. Each group had six tumor-bearing mice for a total of 36 mice. The tumor volume was measured with caliper and volume was expressed in units of mm³ using the formula: V = 0.52 a × b × c. Animals were euthanized on day 15 postinoculation. A two-way ANOVA was performed to compare the tumor volume was analyzed using GraphPad prism. p < 0.05 was statistically significant.

Chemistry

General Synthetic Information

Unless otherwise stated, all reagents and solvents were purchased from commercial suppliers and used as received without purification. The ¹H, ³¹P and ¹³C NMR spectra were obtained in methanol-d ₄ or D₂O as solvent using either a 500 or 800 MHz spectrometer. Tetramethylsilane was used as an internal standard. Flash or column chromatography using silica gel (230–400 mesh) for purification of intermediates. All final compounds were purified via RP-HPLC. The cyclic dinucleotide synthesized were either isolated as a triethylammonium salt or proton salt. Coupling constants (J values) reported in Hz. All final compounds were characterized by ¹H, ³¹P and ¹³C NMR, and high-resolution mass spectrometry (HRMS) data. All intermediates were also characterized via ESI–MS using Advion Mass Spectrometer. HRMS was done for all final compounds (ESI).

Synthesis of N-(9-((2R,3R,4S,5R)-5-((Bis­(4-methoxyphenyl)­(phenyl)­methoxy)­methyl)-3-Fluoro-4-Hydroxytetrahydrofuran-2-yl)-9H-purin-6-yl)­benzamide (34b)

To 2 g of 5′-DMT-2′-fluoro-N ⁶-benzoyladenosine (34a, 2.56 mmol) was added DMAP (7.69 mmol, 3 equiv) and then DCM was used to dissolve the solid mixture (30 mL). This solution was cooled on ice before triflic anhydride (3.84 mmol, 1.5 equiv) was slowly added and the reaction mix was left to stir for 45 min 70 mL of diethyl ether and 30 mL of 2% acetic acid was added and separated after extraction. Another 30 mL of 2% acetic acid was added again to wash the organic layer. 5% NaHCO₃ (30 mL) and water was used to back extract the diethyl ether layer. The organic layer was concentrated via reduced pressure and subsequently reconcentrated with acetonitrile (10 mL, 3×). Thirty ml of DMF was used to dissolve the crude product and then sodium trifluoroacetate (12.8 mmol, 5 equiv) was added. After 18 h, the mixture was heated to 55–60 °C for 3 h to ensure complete inversion to the xylose epimer, 34b. After the reaction was complete, the mixture was slowly added to a solution of 5% NaHCO₃ (50 mL) and water (50 mL) to precipitate the solids and then later filtered to isolate the product. The crude product was then purified via column chromatography to give 34b (1.3 g). ESI–MS: m/z = 678.8 [M + H]⁺. ¹H NMR (500 MHz, CDCl₃ δ) 8.86–8.62 (m, 2H), 8.22 (d, J = 6.3 Hz, 2H), 8.12–7.93 (m, 3H), 7.64–7.57 (m, 2H), 7.51 (td, J = 7.9, 2.4 Hz, 3H), 7.46–7.40 (m, 1H), 7.36–7.27 (m, 6H), 7.27–7.18 (m, 4H), 7.18–7.13 (m, 4H), 6.86–6.75 (m, 6H), 5.79 (dd, J = 3.8, 1.3 Hz, 1H), 4.75–4.69 (m, 1H), 4.40–4.31 (m, 3H), 4.13–4.04 (m, 2H), 4.00 (dd, J = 12.9, 2.8 Hz, 1H), 3.81–3.74 (m, 9H), 3.61 (d, J = 4.9 Hz, 1H), 2.16 (s, 1H), 1.33–1.27 (m, 3H), 1.27–1.22 (m, 2H), 0.96 (dd, J = 6.8, 1.3 Hz, 3H), 0.90 (d, J = 2.4 Hz, 5H), 0.89–0.84 (m, 11H), 0.08 (s, 3H), −0.12 (d, J = 2.3 Hz, 3H). ¹³C NMR (CDCl₃, 126 MHz): δ 164.73, 158.63, 158.55, 152.32, 150.39, 149.97, 147.38, 144.50, 142.87, 139.51, 135.66, 133.35, 133.02, 130.07, 130.01, 129.16, 128.93, 128.12, 127.94, 127.85, 127.80, 127.07, 126.89, 123.42, 113.20, 113.16, 92.80, 91.36, 86.86, 83.14, 82.30, 81.59, 81.54, 81.46, 77.96, 77.30, 77.05, 76.79, 61.87, 55.26, 55.22, 34.68, 31.60, 25.67, 25.58, 25.29, 22.67, 17.95, 17.85, 14.14, −4.73, −5.09.

Synthesis of (2R,3S,4R,5R)-5-(6-Benzamido-9H-Purin-9-Yl)-2-((Bis­(4-methoxyphenyl)­(phenyl)­methoxy)­methyl)-4-Fluorotetrahydrofuran-3-Yl (2-Cyanoethyl) Diisopropylphosphoramidite (35b)

Two grams of 5′-DMT-3′-OTBS-isobutylguanosine (35a, 2.59 mmol) used as substrate to synthesize 35b similar to the procedure used to synthesize 34b. ESI–MS: m/z = 770.5 [M + H]⁺. ¹H NMR (500 MHz, CDCl₃ δ) 7.51–7.42 (m, 3H), 7.37 (d, J = 8.9 Hz, 5H), 7.16 (s, 5H), 6.83 (d, J = 8.9 Hz, 9H), 4.43–4.40 (m, 2H), 4.09–4.06 (m, 1H), 3.99 (td, J = 4.2, 2.2 Hz, 1H), 1.27 (d, J = 6.9 Hz, 8H), 1.24 (dd, J = 6.9, 5.4 Hz, 6H), 0.94 (s, 7H), 0.90–0.87 (m, 12H), 0.17 (d, J = 9.3 Hz, 5H), 0.12 (s, 3H), 0.06 (s, 3H). ¹³C NMR (CDCl₃, 126 MHz): δ 158.65, 147.34, 147.04, 139.48, 130.08, 129.15, 128.30, 127.86, 127.78, 127.09, 113.18, 86.70, 81.46, 78.97, 77.29, 77.03, 76.78, 55.26, 36.46, 31.60, 25.83, 25.63, 22.67, 19.04, 18.82, 18.73, 18.07, 18.00, 14.13, −4.55, −4.84.

Synthesis of (2R,3S,4R,5R)-5-(6-Benzamido-9H-Purin-9-Yl)-2-((Bis­(4-methoxyphenyl)­(phenyl)­methoxy)­methyl)-4-Fluorotetrahydrofuran-3-Yl (2-Cyanoethyl) Diisopropylphosphoramidite (34c)

34b (1.10 g, 1.62 mmol) was sealed, degassed and dry DCM (10 mL), dry DIPEA (1.21 mmol, 1.1 equiv), NMI (1.21 mmol, 1.1 equiv) and 2-cyanoethyl N,N-diisopropyl-chlorophosphoramidite (3.63 mmol, 3.3 equiv) was added and then vacuumed and argon was bubbled through solution to create an inert atmosphere. After 1 h reaction was quenched with 5 mL methanol and the product was concentrated to an oil and immediately purified via column chromatography (gradient Hexane/Ethyl acetate 100%/0% to 30%/70%). ESI–MS: m/z = 876.0 [M + H]⁺. ¹H NMR (500 MHz, CDCl₃ δ) 9.30 (s, 1H), 8.81 (dd, J = 11.9, 2.6 Hz, 1H), 8.15 (dt, J = 6.7, 1.8 Hz, 1H), 8.02 (d, J = 7.6 Hz, 2H), 7.61–7.57 (m, 1H), 7.51 (dd, J = 7.7, 2.5 Hz, 2H), 7.50–7.46 (m, 3H), 7.36 (ddd, J = 8.8, 6.2, 3.2 Hz, 4H), 7.29–7.26 (m, 1H), 7.25–7.20 (m, 1H), 6.83 (ddd, J = 13.3, 6.6, 4.9 Hz, 4H), 6.51–6.43 (m, 1H), 5.42 (d, J = 29.1 Hz, 1H), 4.71 (tt, J = 7.5, 3.6 Hz, 1H), 4.59–4.49 (m, 1H), 3.87–3.83 (m, 1H), 3.83–3.73 (m, 8H), 3.71–3.61 (m, 2H), 3.59–3.48 (m, 2H), 3.48–3.40 (m, 1H), 3.36 (dd, J = 10.3, 2.8 Hz, 1H), 3.31–3.17 (m, 2H), 2.54 (ddt, J = 6.2, 3.7, 2.0 Hz, 1H), 2.35 (q, J = 5.8 Hz, 2H), 1.33 (dd, J = 6.5, 2.1 Hz, 2H), 1.30–1.18 (m, 2H), 1.04 (ddd, J = 16.5, 6.8, 2.4 Hz, 6H), 0.89 (dd, J = 6.8, 2.5 Hz, 3H), 0.82 (dd, J = 7.1, 2.5 Hz, 4H). ³¹P NMR (203 MHz, CDCl₃) δ 152.21, 150.34. ¹³C NMR (126 MHz, CDCl₃): δ 164.85, 164.76, 158.59, 152.87, 152.75, 151.16, 149.46, 144.53, 144.48, 141.30, 135.89, 135.82, 135.66, 133.67, 132.78, 130.16, 130.12, 130.09, 130.05, 130.00, 128.90, 128.83, 128.25, 128.14, 127.94, 127.90, 127.01, 126.94, 123.20, 122.91, 118.21, 117.26, 117.18, 113.19, 98.23, 96.73, 88.75, 88.46, 88.33, 88.04, 86.66, 86.59, 83.30, 75.85, 74.14, 74.04, 62.60, 62.18, 58.71, 58.55, 57.98, 57.83, 57.69, 55.28, 55.24, 46.69, 43.22, 43.12, 43.02, 24.55, 24.50, 24.35, 24.15, 21.46, 20.15, 20.09, 19.07, 19.02.

Synthesis of (2R,3S,4R,5R)-5-((Bis­(4-Methoxyphenyl)­(phenyl)­methoxy)­methyl)-4-((tert-Butyldimethylsilyl)­oxy)-2-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-Yl)­tetrahydrofuran-3-yl (2-cyanoethyl) Diisopropylphosphoramidite (35c)

35c was synthesized from 35b using the same procedure as the synthesis of 34c. ESI–MS: m/z = 971.2 [M + H]⁺. ¹H NMR (500 MHz, CDCl₃ δ) 7.86 (s, 1H), 7.82 (s, 1H), 7.58 (d, J = 5.2 Hz, 2H), 7.51 (s, 1H), 7.45–7.39 (m, 4H), 7.32 (s, 4H), 7.29 (dd, J = 8.9, 2.1 Hz, 5H), 7.25–7.21 (m, 2H), 7.20–7.13 (m, 2H), 7.06 (t, J = 1.2 Hz, 2H), 6.88 (t, J = 1.4 Hz, 2H), 6.81 (ddd, J = 9.7, 4.9, 2.7 Hz, 5H), 6.79–6.75 (m, 3H), 6.31 (s, 1H), 6.25 (dd, J = 9.4, 5.2 Hz, 2H), 4.36–4.32 (m, 2H), 4.31 (s, 1H), 4.19 (td, J = 6.2, 2.8 Hz, 2H), 4.15–4.09 (m, 3H), 4.08–4.01 (m, 4H), 3.87 (t, J = 6.4 Hz, 2H), 3.55–3.46 (m, 4H), 3.36–3.29 (m, 6H), 2.77–2.73 (m, 3H), 2.69 (t, J = 6.4 Hz, 3H), 2.63–2.56 (m, 5H), 2.03 (s, 1H), 1.35 (dd, J = 6.5, 3.5 Hz, 14H), 1.26 (t, J = 7.1 Hz, 19H), 1.24–1.20 (m, 15H), 0.98 (dd, J = 9.2, 6.8 Hz, 13H), 0.92–0.88 (m, 15H), 0.82 (d, J = 2.9 Hz, 9H), 0.74 (d, J = 6.7 Hz, 3H), 0.16 (d, J = 3.1 Hz, 3H), 0.13 (s, 1H), 0.08 (d, J = 2.5 Hz, 3H), 0.06 (s, 1H), −0.02 (s, 1H), −0.04 (s, 2H). ³¹P NMR (203 MHz, CDCl3) δ 2.49. ¹³C NMR (126 MHz, CDCl₃): δ 158.59, 148.00, 144.45, 139.49, 136.56, 130.08, 129.14, 128.22, 127.82, 127.77, 127.04, 123.90, 121.16, 118.47, 117.69, 113.13, 77.29, 77.04, 76.79, 58.59, 57.58, 55.23, 46.63, 34.84, 29.68, 25.72, 25.66, 21.49, 20.13, 20.08, 19.01, 17.90, −3.56, −4.92.

Synthesis of O-((2R,3R,4R,5R)-4-((Tert-Butyldimethylsilyl)­oxy)-5-(Hydroxymethyl)-2-(2-Isobutyramido-6oxo-1,6-Dihydro-9H-Purin-9-Yl)­tetrahydrofuran-3-yl) O,O-bis­(2-cyanoethyl) Phosphorothioate (II)

Cyanolethanol (0.40 mL, 5.5 mmol) was added to guanosine (n-ibu) 3′-tBDSilyl CED phosphoramidite or I (from Chemgenes, 1.06 g, 1.09 mmol) in anhydrous MeCN (15 mL) under argon. After stirring for 10 min at room temperature, dicyanoimidazole (0.472 g, 4.0 mmol) was added to the reaction mixture and stirred for 16 h under argon at RT. Beaucage reagent was added to the reaction mixture and left to stir for an hour. The reaction was quenched with Na₂S₂O₃ (30 mL, 1 M solution) and subsequently extracted 3× using DCM (30 mL). After drying under reduced pressure, the crude product was redissolved in DCM (20 mL) and DCA (1 mL, 12.2 mmol) was added dropwise and left to stir for 10 min. Saturated NaHCO₃ (30 mL) was added to quench the reaction, and the aqueous layer was extracted 3x using DCM (30 mL). After concentrating under reduced pressure, the crude product was purified via column chromatography (silica gel, gradient 10–100% ethyl acetate in hexanes) to afford 0.5 g of II. ESI–MS: m/z = 670.8 [M + H]⁺. 1H NMR (500 MHz, MeOD) δ 8.34 (s, 1H), 6.23 (d, J = 7.6 Hz, 1H), 5.44 (ddd, J = 12.6, 7.6, 4.7 Hz, 1H), 4.57 (d, J = 4.7 Hz, 1H), 4.23 (ddt, J = 10.5, 8.9, 5.9 Hz, 1H), 4.18–4.12 (m, 2H), 4.12–4.05 (m, 1H), 3.94 (dddd, J = 10.5, 9.6, 6.7, 5.1 Hz, 1H), 3.79 (qd, J = 12.2, 3.1 Hz, 2H), 2.81 (td, J = 5.9, 0.9 Hz, 2H), 2.75–2.66 (m, 2H), 2.61 (ddd, J = 17.2, 7.3, 5.1 Hz, 1H), 2.15 (s, 1H), 1.21 (dd, J = 6.9, 4.1 Hz, 7H), 0.98 (s, 9H), 0.20 (d, J = 11.5 Hz, 6H). 31P NMR (203 MHz, MeOD) δ 68.18. 13C NMR (126 MHz, MeOD) δ 180.40, 156.12, 149.82, 148.81, 138.38, 119.62, 116.92, 116.76, 88.13, 84.61, 79.37, 72.64, 63.51, 63.17, 61.31, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 35.57, 24.91, 18.53, 18.46, 18.34, 18.27, 18.01, 17.85, 17.64, −5.64, −6.07.

Synthesis of O-((2R,3S,4R,5R)-4-((Tert-Butyldimethylsilyl)­oxy)-5-(Hydroxymethyl)-2-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-Yl)­tetrahydrofuran-3-yl) O,O-Bis­(2-cyanoethyl) Phosphorothioate (35d)

35d was synthesized from 35c using the same procedure as the synthesis of II. LRMS: m/z = 670.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD) δ 8.13 (s, 1H), 7.28 (d, J = 35.0 Hz, 1H), 6.44 (dd, J = 3.8, 1.7 Hz, 1H), 4.92 (ddd, J = 12.0, 3.9, 2.1 Hz, 2H), 4.62 (t, J = 2.4 Hz, 1H), 4.35–4.30 (m, 1H), 4.26–4.14 (m, 2H), 4.04 (td, J = 5.7, 2.7 Hz, 1H), 4.00–3.93 (m, 2H), 3.92–3.86 (m, 1H), 3.84 (s, 2H), 3.82–3.79 (m, 2H), 2.90 (td, J = 6.1, 2.7 Hz, 1H), 2.86–2.82 (m, 1H), 2.70 (dq, J = 10.5, 6.6 Hz, 2H), 2.65 (dd, J = 7.2, 4.9 Hz, 1H), 2.15 (s, 1H), 1.98 (s, 1H), 0.96 (d, J = 9.5 Hz, 10H), 0.92 (s, 1H), 0.90 (s, 1H), 0.22 (d, J = 10.5 Hz, 4H), 0.17 (s, 2H), −0.00 (s, 2H). ³¹P NMR (203 MHz, MeOD) δ 67.35. ¹³C NMR (126 MHz, MeOD) δ 180.41, 156.13, 148.95, 148.79, 139.78, 139.13, 123.57, 119.33, 116.98, 116.76, 86.67, 86.01, 85.21, 83.70, 81.45, 77.68, 76.27, 76.18, 63.47, 63.29, 61.06, 60.90, 48.12, 47.95, 47.78, 47.60, 47.43, 47.26, 47.09, 35.54, 33.48, 31.35, 29.34, 24.97, 24.87, 24.76, 22.30, 18.52, 18.45, 18.29, 18.22, 17.93, 17.90, 17.43, 13.03, −1.44, −5.57, −5.89, −5.97, −6.16.

Synthesis of O,O-Bis­(2-Cyanoethyl) O-((2R,3R,5S)-5-(Hydroxymethyl)-2-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-Yl)­Tetrahydrofuran-3-Yl) Phosphorothioate (III)

III was synthesized from 37d using the same procedure as the synthesis of II. ESI–MS: m/z = 540.6 [M + H]⁺. ¹H NMR (500 MHz, MeOD) δ 8.30 (s, 1H), 6.18 (d, J = 2.4 Hz, 1H), 5.46 (ddt, J = 9.0, 5.7, 2.7 Hz, 1H), 4.49 (td, J = 6.0, 3.0 Hz, 1H), 3.88 (dd, J = 12.3, 2.9 Hz, 1H), 3.69 (dd, J = 12.3, 3.7 Hz, 1H), 3.31 (t, J = 1.7 Hz, 1H), 2.92–2.83 (m, 3H), 2.76–2.70 (m, 1H), 2.70–2.63 (m, 1H), 2.41 (ddd, J = 14.0, 6.2, 2.9 Hz, 1H), 2.15 (s, 1H), 1.31 (d, J = 6.5 Hz, 1H), 1.22 (d, J = 6.9 Hz, 5H). ³¹P NMR (203 MHz, MeOD) δ 66.35. ¹³C NMR (126 MHz, MeOD) δ 180.41, 156.11, 148.80, 148.49, 141.65, 138.55, 120.05, 117.93, 117.11, 110.57, 89.21, 89.14, 82.25, 82.20, 81.02, 63.29, 63.26, 63.22, 62.07, 60.64, 48.13, 47.96, 47.79, 47.62, 47.45, 47.28, 47.11, 35.56, 32.41, 32.38, 31.35, 29.31, 22.30, 18.67, 18.54, 18.48, 17.98, 17.95, 13.04, −1.42.

Synthesis of O-((2R,3R,4R,5R)-2-(6-Benzamido-9H-Purin-9-Yl)-4-((Tert-Butyldimethylsilyl)­oxy)-5-(Hydroxymethyl)­tetrahydrofuran-3-yl) O,O-Bis­(2-Cyanoethyl) Phosphorothioate (VI)

VI was synthesized from IV using the same procedure as the synthesis of II. ESI–MS: m/z = 688.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.73 (d, J = 13.2 Hz, 2H), 8.22–7.91 (m, 2H), 7.68–7.63 (m, 1H), 7.57 (dd, J = 8.4, 7.1 Hz, 2H), 6.41 (d, J = 6.6 Hz, 1H), 5.66 (ddd, J = 12.6, 6.6, 4.6 Hz, 1H), 4.71 (dd, J = 4.6, 2.1 Hz, 1H), 4.23 (td, J = 4.0, 1.2 Hz, 2H), 4.19–4.13 (m, 1H), 4.12–4.06 (m, 1H), 4.05–3.97 (m, 1H), 3.92 (dd, J = 12.5, 3.1 Hz, 1H), 3.79 (dd, J = 12.5, 2.7 Hz, 1H), 2.84–2.78 (m, 2H), 2.77–2.71 (m, 2H), 1.00 (s, 9H), 0.93–0.83 (m, 1H), 0.23 (d, J = 11.5 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.39. ¹³C NMR (126 MHz, MeOD): δ 152.00, 151.84, 150.25, 143.60, 132.55, 128.38, 128.10, 124.38, 116.93, 87.86, 86.71, 78.48, 72.07, 63.52, 63.35, 61.27, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 24.93, 18.46, 18.39, 18.33, 17.68, −5.61, −6.08.

Synthesis of O-((2R,3R,4R,5R)-4-((Tert-Butyldimethylsilyl)­oxy)-2-(2,4-Dioxo-3,4-Dihydropyrimidin-1­(2H)-yl)-5-(Hydroxymethyl)­tetrahydrofuran-3-yl) O,O-Bis­(2-cyanoethyl) Phosphorothioate (VII)

VII was synthesized from V using the same procedure as the synthesis of II. ESI–MS: m/z = 561.7 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.02 (d, J = 8.1 Hz, 1H), 6.19 (d, J = 6.3 Hz, 1H), 5.74 (d, J = 8.1 Hz, 1H), 5.05 (ddd, J = 12.6, 6.3, 4.7 Hz, 1H), 4.47 (dd, J = 4.8, 2.5 Hz, 1H), 4.28 (ddd, J = 11.9, 5.7, 2.9 Hz, 4H), 4.08 (s, 1H), 3.76 (ddd, J = 46.2, 12.1, 2.6 Hz, 2H), 3.37–3.20 (m, 2H), 2.87 (td, J = 5.8, 4.2 Hz, 4H), 0.95 (s, 9H), 0.18 (d, J = 15.0 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.72. ¹³C NMR (126 MHz, MeOD): δ 164.64, 151.10, 141.72, 141.22, 117.02, 101.92, 86.80, 86.22, 86.18, 78.76, 78.72, 71.65, 71.60, 63.44, 63.41, 63.38, 63.35, 60.72, 48.13, 47.96, 47.79, 47.62, 47.45, 47.28, 47.11, 24.92, 18.61, 18.54, 18.47, 18.41, 17.64, −5.61, −6.15.

Synthesis of O-((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(Hydroxymethyl)­tetrahydrofuran-3-yl) O,O-Bis­(2-cyanoethyl) Phosphorothioate (XI)

XI was synthesized from VIII using the same procedure as the synthesis of II. ESI–MS: m/z = 576.7 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.69 (d, J = 38.8 Hz, 2H), 8.19–8.00 (m, 2H), 7.64 (d, J = 7.4 Hz, 1H), 7.56 (dd, J = 8.4, 7.1 Hz, 2H), 6.50 (dd, J = 16.0, 3.7 Hz, 1H), 5.87 (dt, J = 51.5, 4.2 Hz, 1H), 5.61 (ddd, J = 11.4, 8.8, 5.3 Hz, 1H), 4.44 (dd, J = 4.9, 2.3 Hz, 1H), 4.37 (dq, J = 9.2, 5.8 Hz, 4H), 3.96 (dd, J = 12.6, 2.5 Hz, 1H), 3.84 (dd, J = 12.6, 3.2 Hz, 1H), 2.93 (q, J = 6.3 Hz, 4H), 2.15 (s, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.07. ¹³C NMR (126 MHz, MeOD): δ 166.81, 151.98, 151.56, 150.06, 143.17, 133.52, 132.56, 128.39, 128.07, 124.09, 117.15, 117.10, 91.97, 90.42, 87.09, 86.82, 83.44, 83.39, 74.58, 74.50, 63.38, 60.17, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 29.29, 18.58, 18.55, 18.51, 18.49.

Synthesis of O,O-Bis­(2-cyanoethyl) O-((2R,3R,4R,5R)-4-Fluoro-2-(Hydroxymethyl)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphorothioate (XII)

XII was synthesized from IX using the same procedure as the synthesis of II. ESI–MS: m/z = 558.3 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.71 (d, J = 5.7 Hz, 2H), 8.28 (s, 1H), 8.08 (dd, J = 8.4, 1.3 Hz, 2H), 7.64 (d, J = 7.5 Hz, 1H), 7.56 (t, J = 7.7 Hz, 2H), 6.43 (dd, J = 16.4, 2.5 Hz, 1H), 6.30 (dd, J = 15.1, 3.7 Hz, 1H), 5.64 (dt, J = 51.5, 4.1 Hz, 1H), 5.56–5.40 (m, 1H), 5.36 (ddd, J = 12.2, 8.8, 5.2 Hz, 1H), 4.68 (ddd, J = 18.1, 6.9, 4.5 Hz, 1H), 4.41–4.31 (m, 6H), 4.16 (dd, J = 6.8, 3.3 Hz, 1H), 3.96 (td, J = 12.8, 2.5 Hz, 2H), 3.82 (ddd, J = 21.9, 12.5, 3.1 Hz, 2H), 2.97–2.86 (m, 5H), 2.71 (p, J = 6.9 Hz, 1H), 2.15 (s, 1H), 1.30–1.26 (m, 2H), 1.24–1.19 (m, 7H), 0.94–0.77 (m, 2H). ³¹P NMR (203 MHz, MeOD) δ 67.02. ¹³C NMR (126 MHz, MeOD): δ 180.30, 156.00, 151.89, 148.88, 148.61, 143.00, 137.90, 133.54, 132.55, 128.39, 128.06, 120.09, 117.16, 117.08, 94.36, 92.86, 92.32, 90.77, 87.33, 87.07, 86.19, 85.93, 84.33, 83.06, 83.01, 74.10, 68.81, 68.68, 63.36, 60.29, 59.55, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 35.60, 18.51, 18.45, 17.94, 17.88.

Synthesis of O,O-Bis­(2-cyanoethyl) O-((2R,3R,4R,5R)-4-Fluoro-2-(Hydroxymethyl)-5-(6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphorothioate (XIII)

XIII was synthesized from X using the same procedure as the synthesis of II. ESI–MS: m/z = 473.3 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.34 (s, 1H), 8.08 (s, 1H), 6.37 (dd, J = 16.2, 3.6 Hz, 1H), 5.74 (dt, J = 51.7, 4.2 Hz, 1H), 5.53 (ddd, J = 10.5, 7.1, 5.4 Hz, 1H), 4.43–4.39 (m, 1H), 4.36 (dq, J = 9.1, 5.7 Hz, 4H), 3.93 (dd, J = 12.6, 2.6 Hz, 1H), 3.81 (dd, J = 12.6, 3.3 Hz, 1H), 2.97–2.88 (m, 4H), 2.15 (s, 3H). ³¹P NMR (203 MHz, MeOD) δ 67.01. ¹³C NMR (126 MHz, MeOD): δ 157.40, 148.17, 145.83, 141.17, 139.53, 124.71, 117.12, 92.22, 90.67, 87.01, 86.75, 83.28, 83.23, 74.44, 74.33, 63.35, 60.08, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 29.27, 18.52, 18.48, 18.45.

Synthesis of (2S,3S,4R,5R)-5-(6-Benzamido-9H-Purin-9-Yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-Yl (((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((Tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-yl)­tetrahydrofuran-2-Yl)­methyl) (2-Cyanoethyl) Phosphate (34d)

Anhydrous MeCN was used to dissolve phosphorothioate II (0.27 g, 0.42 mmol) and phorsphoramidite 34c (0.63 mmol, 1.5 equiv) and left to stir under argon for 15 min. DCI (2 mmol, 4.76 equiv) was added and left to stir at RT for 6 h. ^t BuOOH (70% aq solution, 0.5 mL, 3.9 mmol) was used to oxidize the coupled product and the reaction was left for 10 min, then the mixture was quenched with 30 mL of Na₂S₂O₃ (1 M) and extracted 3x with 30 mL DCM. Then the extracted product is concentrated under reduced pressure. After concentrating, the oil is dissolved in 20 mL DCM and then 0.5 mL of DCA is added dropwise and left to stir for 12 min. Saturated NaHCO₃ (30 mL) was added to quench the reaction and extracted 3× with 30 mL DCM. The organic layer is then concentrated, and the crude product was immediately purified via flash chromatography (2–5% methanol in ethyl acetate). To the purified product (0.3 mmol) is then added methyltriphenoxyphosphonium iodide (3 mmol, 10 equiv) and 2,6-lutidine (10.2 mmol, 34 equiv) in anhydrous DMF (1.5 mL) in inert atmosphere. After an hour, the reaction was quenched with 20 mL of Na₂S₂O₃ (1 M) and then 30 mL DCM was added to extract the aqueous layer (3x). The organic layer was concentrated under reduced pressure and the crude product was purified via flash chromatography (4–10% methanol in ethyl acetate). The isolated product (0.116 g) was collected as a pale yellow solid. ESI–MS: m/z = 1268.9 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.81–8.64 (m, 1H), 8.53–8.33 (m, 1H), 8.08 (d, J = 7.7 Hz, 2H), 8.03–7.98 (m, 1H), 7.65 (t, J = 7.6 Hz, 1H), 7.60–7.50 (m, 2H), 6.65–6.43 (m, 1H), 6.17 (dd, J = 34.2, 7.6 Hz, 1H), 5.98–5.76 (m, 1H), 5.48 (dt, J = 12.5, 5.9 Hz, 1H), 5.33 (ddd, J = 13.1, 7.8, 4.9 Hz, 1H), 5.29–5.22 (m, 1H), 4.72 (d, J = 5.8 Hz, 1H), 4.66–4.60 (m, 1H), 4.59 (d, J = 1.5 Hz, 1H), 4.49 (d, J = 5.0 Hz, 1H), 4.41 (d, J = 14.6 Hz, 1H), 4.36–4.30 (m, 1H), 4.22 (dq, J = 10.9, 6.0 Hz, 2H), 4.19–4.13 (m, 2H), 4.09 (q, J = 4.7 Hz, 1H), 4.02–3.93 (m, 1H), 3.65 (dd, J = 12.1, 8.1 Hz, 1H), 3.60–3.43 (m, 1H), 2.93 (td, J = 5.9, 1.4 Hz, 1H), 2.86–2.74 (m, 3H), 2.69 (ddt, J = 12.9, 9.4, 6.2 Hz, 2H), 1.28 (s, 3H), 1.23–1.15 (m, 5H), 0.95 (d, J = 17.5 Hz, 9H), 0.20 (d, J = 10.5 Hz, 3H), 0.14 (d, J = 18.5 Hz, 2H), −0.00 (s, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.90, −3.27, −3.36, −3.64. ¹³C NMR (126 MHz, MeOD): δ 210.65, 180.25, 166.84, 156.04, 151.37, 149.97, 141.54, 132.55, 128.36, 128.12, 128.01, 124.00, 117.07, 116.90, 96.67, 95.17, 88.26, 85.77, 84.77, 78.10, 63.91, 63.64, 63.31, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.59, 31.34, 29.34, 24.90, 22.29, 18.58, 18.10, 17.88, 17.75, 17.60, 13.03, −1.44, −5.59, −5.96.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-Purin-9-yl)-4-Fluoro-2-(Iodomethyl)­Tetrahydrofuran-3-Yl (((2R,3R,4S,5R)-4-((Bis­(2-Cyanoethoxy)­Phosphorothioyl)­oxy)-3-((Tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (35e)

35e was synthesized from 35d (0.42 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The purified product (0.090 g) was isolated as pale yellow solid. ESI–MS: m/z = 1268.9 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.80–8.66 (m, 1H), 8.54 (d, J = 15.6 Hz, 1H), 8.08 (d, J = 7.7 Hz, 2H), 7.66 (t, J = 7.4 Hz, 1H), 7.57 (t, J = 7.6 Hz, 2H), 6.08 (dd, J = 52.9, 27.1 Hz, 3H), 5.57 (s, 2H), 4.57 (s, 2H), 4.43 (d, J = 6.6 Hz, 2H), 4.36 (s, 1H), 4.32–4.17 (m, 3H), 3.73–3.63 (m, 1H), 3.61–3.52 (m, 1H), 2.97 (td, J = 9.5, 4.4 Hz, 3H), 2.89–2.81 (m, 2H), 2.75–2.60 (m, 2H), 2.15 (s, 1H), 1.95 (s, 1H), 1.29 (s, 4H), 1.24–1.19 (m, 4H), 0.97 (t, J = 3.7 Hz, 8H), 0.90 (q, J = 6.7 Hz, 2H), 0.25 (t, J = 6.7 Hz, 4H). ³¹P NMR (203 MHz, MeOD) δ 67.27, −2.70. ¹³C NMR (126 MHz, MeOD): δ 181.53, 161.70, 152.17, 151.46, 148.86, 143.67, 139.21, 132.59, 128.85, 128.39, 128.11, 117.11, 112.98, 76.92, 67.56, 63.64, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.57, 29.36, 24.87, 18.54, 17.44, 2.26, −1.45, −5.97.

Synthesis of O-((2R,3R,4R,5R)-5-((((((2S,3S,5R)-5-(6-Benzamido-9H-Purin-9-yl)-2-(Iodomethyl)­tetrahydrofuran-3-yl)­oxy)­(methyl)­phosphoryl)­oxy)­methyl)-4-((Tert-Butyldimethylsilyl)­oxy)-2-(2-Isobutyramido-6-Oxo-1,4,5,6-Tetrahydro-9H-Purin-9-yl)­tetrahydrofuran-3-yl) O,O-Bis­(2-cyanoethyl) Phosphorothioate (36c)

36c was synthesized from II (0.42 mmol) and 36b (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.06 g) was isolated as an off-white solid. ESI–MS: m/z = 1198.2 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.71 (d, J = 26.3 Hz, 1H), 8.51 (d, J = 69.8 Hz, 1H), 8.20 (d, J = 21.1 Hz, 1H), 8.09 (t, J = 7.7 Hz, 2H), 7.66 (t, J = 7.3 Hz, 1H), 7.57 (t, J = 7.6 Hz, 2H), 6.53 (dt, J = 53.3, 7.0 Hz, 1H), 6.21 (dd, J = 39.0, 7.5 Hz, 1H), 5.49 (s, 1H), 5.32 (d, J = 70.3 Hz, 1H), 4.66 (dd, J = 18.9, 4.8 Hz, 2H), 4.49 (d, J = 14.4 Hz, 2H), 4.44 (s, 2H), 4.38 (d, J = 6.6 Hz, 2H), 4.32 (d, J = 4.7 Hz, 1H), 4.27–4.13 (m, 3H), 4.11 (d, J = 17.2 Hz, 1H), 4.04–3.93 (m, 1H), 3.65 (dd, J = 10.7, 7.1 Hz, 1H), 3.53 (dt, J = 11.4, 6.2 Hz, 1H), 3.45 (dd, J = 10.5, 5.9 Hz, 1H), 3.43–3.38 (m, 1H), 2.81 (dq, J = 12.3, 6.2 Hz, 4H), 2.77–2.74 (m, 1H), 2.71 (dd, J = 11.2, 5.3 Hz, 2H), 2.15 (s, 2H), 1.75 (dd, J = 17.7, 13.4 Hz, 4H), 1.29 (s, 3H), 1.21 (dd, J = 6.9, 2.8 Hz, 6H), 0.99 (d, J = 5.3 Hz, 10H), 0.92–0.85 (m, 1H), 0.24 (dd, J = 8.3, 5.5 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.16, 68.04, 34.09, 33.30. ¹³C NMR (126 MHz, MeOD): δ 180.41, 166.80, 151.88, 149.89, 143.61, 138.85, 133.55, 132.55, 128.82, 128.38, 128.11, 128.05, 124.07, 120.51, 119.89, 117.08, 116.88, 85.16, 84.99, 78.48, 77.58, 71.60, 69.28, 65.37, 63.69, 63.32, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 36.61, 35.59, 29.28, 24.92, 24.89, 18.57, 18.34, 18.05, 17.64, 13.02, 9.17, 3.58, 3.32, −5.59, −5.92, −6.01.

Synthesis of O-((2R,3R,4R,5R)-2-(6-Benzamido-4,5-dihydro-9H-purin-9-yl)-4-((tert-Butyldimethylsilyl)­oxy)-5-((((((2S,3S,5R)-2-(Iodomethyl)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-yl)­tetrahydrofuran-3-yl)­oxy)­(methyl)­phosphoryl)­oxy)­methyl)­tetrahydrofuran-3-yl) O,O-bis­(2-cyanoethyl) Phosphorothioate (36d)

36d was synthesized from IV (0.42 mmol) and 36a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.065 g) was isolated as an off-white solid. ESI–MS: m/z = 1198.2 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.78 (d, J = 19.4 Hz, 1H), 8.64 (d, J = 11.7 Hz, 1H), 8.10 (s, 1H), 8.07–7.91 (m, 2H), 7.64 (dt, J = 11.2, 7.4 Hz, 1H), 7.53 (dt, J = 25.8, 7.6 Hz, 2H), 6.46 (d, J = 4.1 Hz, 1H), 6.43 (d, J = 4.9 Hz, 1H), 6.19 (dt, J = 33.2, 7.1 Hz, 1H), 5.85 (dt, J = 12.3, 5.9 Hz, 1H), 5.22 (s, 1H), 5.03–4.95 (m, 1H), 4.58–4.51 (m, 1H), 4.49–4.42 (m, 1H), 4.32 (s, 2H), 4.26 (dtd, J = 19.4, 10.1, 5.1 Hz, 2H), 4.18 (ddt, J = 13.7, 9.8, 4.0 Hz, 2H), 3.95 (s, 1H), 2.89–2.82 (m, 2H), 2.82–2.79 (m, 1H), 2.74 (dt, J = 17.8, 6.1 Hz, 2H), 2.54 (dd, J = 13.7, 5.2 Hz, 1H), 2.15 (s, 1H), 1.61 (d, J = 17.7 Hz, 3H), 1.32–1.25 (m, 3H), 1.23 (d, J = 6.8 Hz, 3H), 1.16 (dt, J = 12.3, 6.1 Hz, 4H), 1.01 (d, J = 11.7 Hz, 9H), 0.89 (q, J = 5.7 Hz, 2H), 0.33–0.26 (m, 5H), 0.25 (s, 2H). ³¹P NMR (203 MHz, MeOD) δ 68.08, 33.13. ¹³C NMR (126 MHz, MeOD): δ 180.43, 166.59, 161.97, 152.00, 150.35, 148.27, 144.24, 144.00, 138.71, 132.62, 128.38, 128.15, 127.95, 124.40, 120.45, 117.02, 87.50, 85.04, 84.63, 83.69, 83.09, 78.55, 78.17, 77.66, 70.72, 70.22, 63.60, 63.43, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 36.93, 35.58, 31.35, 29.27, 24.99, 24.95, 22.30, 18.50, 18.02, 17.89, 17.68, 13.02, 10.69, 9.55, 3.77, −5.43, −5.50, −5.96, −6.02.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (38e)

38e was synthesized from II (1.26 mmol) and VIII (1.89 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.45 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1268.0 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.73 (d, J = 24.8 Hz, 1H), 8.53 (d, J = 37.1 Hz, 1H), 8.20 (d, J = 11.3 Hz, 1H), 8.11–8.06 (m, 2H), 7.68–7.63 (m, 1H), 7.57 (td, J = 7.6, 1.3 Hz, 2H), 6.47 (ddd, J = 26.9, 19.3, 2.3 Hz, 1H), 6.22 (dd, J = 20.0, 7.5 Hz, 1H), 6.10–5.90 (m, 1H), 5.66–5.55 (m, 1H), 5.56–5.41 (m, 1H), 4.72–4.62 (m, 1H), 4.63–4.52 (m, 2H), 4.47 (dt, J = 7.6, 5.8 Hz, 1H), 4.40 (dt, J = 7.4, 5.8 Hz, 2H), 4.33–4.25 (m, 1H), 4.25–4.20 (m, 1H), 4.16 (ddd, J = 19.9, 10.0, 4.9 Hz, 1H), 4.08 (tdd, J = 9.7, 6.9, 4.8 Hz, 1H), 4.03–3.91 (m, 1H), 3.69 (ddd, J = 21.9, 11.3, 4.7 Hz, 1H), 3.56 (ddd, J = 27.4, 11.3, 5.5 Hz, 1H), 3.00 (td, J = 5.8, 1.2 Hz, 1H), 2.92 (td, J = 5.8, 1.2 Hz, 1H), 2.81 (dt, J = 11.0, 5.8 Hz, 2H), 2.75 (ddd, J = 10.1, 6.8, 3.2 Hz, 1H), 2.73–2.65 (m, 2H), 1.25–1.17 (m, 6H), 0.97 (t, J = 6.0 Hz, 9H), 0.88 (ddd, J = 15.2, 6.9, 3.0 Hz, 1H), 0.23 (dd, J = 7.7, 6.2 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.93, 67.91, −3.13. ¹³C NMR (126 MHz, MeOD): δ 180.37, 166.82, 152.17, 151.34, 150.09, 148.63, 143.89, 143.44, 139.10, 133.52, 132.58, 128.89, 128.39, 128.12, 124.07, 120.55, 119.89, 117.08, 116.88, 91.97, 90.51, 87.30, 87.05, 85.57, 84.91, 80.16, 77.47, 77.32, 76.93, 71.51, 67.86, 63.84, 63.69, 63.33, 48.12, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.61, 24.91, 18.90, 18.51, 18.40, 18.34, 18.11, 17.85, 17.63, 2.54, 2.26, −5.60, −5.94, −6.00.

Synthesis of (2S,3R,4R,5R)-5-(4-Benzamido-2-oxopyrimidin-1­(2H)-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (38f)

38f was synthesized from II (0.48 mmol) and 38a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.14 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1245.0 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.19 (s, 1H), 8.16–8.11 (m, 1H), 8.04 (d, J = 7.5 Hz, 1H), 7.44 (d, J = 7.5 Hz, 1H), 7.36 (d, J = 7.6 Hz, 1H), 6.22 (d, J = 7.6 Hz, 1H), 6.16 (d, J = 7.7 Hz, 1H), 5.92 (d, J = 22.1 Hz, 1H), 5.80 (d, J = 22.1 Hz, 1H), 5.56 (d, J = 5.0 Hz, 1H), 5.52 (t, J = 6.4 Hz, 1H), 5.47 (s, 1H), 5.08 (dt, J = 12.6, 6.2 Hz, 1H), 4.99 (dd, J = 18.2, 5.5 Hz, 1H), 4.66 (d, J = 5.0 Hz, 1H), 4.63 (d, J = 4.7 Hz, 1H), 4.58 (s, 1H), 4.54–4.46 (m, 2H), 4.43 (q, J = 6.3 Hz, 1H), 4.39–4.32 (m, 2H), 4.22 (td, J = 10.2, 5.0 Hz, 1H), 4.16 (q, J = 7.4 Hz, 2H), 4.12–4.05 (m, 1H), 4.04–3.95 (m, 1H), 3.70 (dd, J = 11.3, 4.1 Hz, 1H), 3.65 (dd, J = 11.1, 4.2 Hz, 1H), 3.54 (dd, J = 11.3, 5.8 Hz, 1H), 3.49 (dd, J = 11.2, 5.6 Hz, 1H), 2.96 (td, J = 5.9, 1.2 Hz, 1H), 2.89 (t, J = 5.9 Hz, 1H), 2.81 (q, J = 6.0 Hz, 2H), 2.79–2.74 (m, 1H), 2.74–2.69 (m, 2H), 2.20 (d, J = 10.5 Hz, 3H), 2.15 (s, 1H), 1.22 (dd, J = 6.8, 3.8 Hz, 6H), 0.98 (d, J = 3.2 Hz, 9H), 0.23 (dd, J = 7.5, 6.2 Hz, 7H). ³¹P NMR (203 MHz, MeOD) δ 67.85, −3.16, −3.19. ¹³C NMR (126 MHz, MeOD): δ 180.41, 171.66, 163.81, 155.89, 147.09, 146.64, 139.12, 117.09, 116.90, 96.94, 92.66, 84.89, 80.02, 77.14, 71.49, 67.75, 63.67, 63.33, 63.32, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.62, 29.28, 24.91, 23.21, 18.59, 18.41, 18.35, 18.11, 17.63, 2.03, −5.61, −5.93, −6.01.

Synthesis of ((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-cyanoethyl) ((2S,3R,4R,5R)-5-(2,4-Dioxo-3,4-dihydropyrimidin-1­(2H)-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl) Phosphate (38g)

38g was synthesized from II (0.48 mmol) and 38b (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.15 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1141.2 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.18 (d, J = 11.1 Hz, 1H), 7.68 (d, J = 8.1 Hz, 1H), 7.61 (d, J = 8.1 Hz, 1H), 6.22 (dd, J = 9.8, 7.6 Hz, 1H), 5.81 (ddd, J = 35.7, 22.5, 1.9 Hz, 1H), 5.72 (d, J = 8.0 Hz, 1H), 5.68 (d, J = 8.0 Hz, 1H), 5.59–5.54 (m, 1H), 5.51 (s, 1H), 5.15–5.05 (m, 1H), 5.05–4.96 (m, 1H), 4.66 (dd, J = 9.3, 4.8 Hz, 1H), 4.60–4.48 (m, 2H), 4.43 (q, J = 6.2 Hz, 1H), 4.39–4.31 (m, 2H), 4.22 (dq, J = 11.0, 5.2 Hz, 1H), 4.15 (ddd, J = 18.9, 9.4, 4.3 Hz, 1H), 4.13–4.03 (m, 2H), 4.03–3.94 (m, 1H), 3.64 (dd, J = 11.2, 4.4 Hz, 1H), 3.59 (dd, J = 11.2, 4.4 Hz, 1H), 3.49 (dd, J = 11.2, 5.8 Hz, 1H), 3.42 (dd, J = 11.2, 5.8 Hz, 1H), 2.97 (td, J = 5.9, 1.2 Hz, 1H), 2.89 (t, J = 5.8 Hz, 1H), 2.81 (p, J = 5.6 Hz, 2H), 2.78–2.73 (m, 1H), 2.74–2.67 (m, 2H), 1.23 (t, J = 6.8 Hz, 6H), 0.99 (d, J = 2.2 Hz, 10H), 0.90 (s, 3H), 0.23 (dd, J = 7.3, 3.8 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.86, −3.07, −3.17. ¹³C NMR (126 MHz, MeOD): δ 208.73, 180.38, 180.37, 164.58, 164.48, 150.30, 150.16, 148.62, 143.34, 143.16, 139.19, 139.08, 128.86, 123.17, 120.58, 119.89, 117.10, 117.02, 116.90, 101.82, 92.03, 91.73, 91.43, 90.51, 85.65, 85.43, 84.88, 79.67, 77.25, 76.56, 71.53, 67.72, 67.68, 63.70, 63.33, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 35.64, 34.28, 31.35, 29.29, 24.92, 22.30, 19.62, 18.85, 18.78, 18.72, 18.61, 18.55, 18.42, 18.36, 18.25, 17.86, 17.64, 13.03, 10.36, 2.07, 1.84, −5.54, −5.59, −5.93, −5.99.

Synthesis of ((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-Purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(Iodomethyl)-5-(6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (38h)

38h was synthesized from II (1.26 mmol) and XIII (1.89 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.42 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1165.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.24 (s, 1H), 8.23–8.17 (m, 2H), 8.10 (d, J = 24.3 Hz, 1H), 6.43–6.35 (m, 1H), 6.32 (s, 1H), 6.24 (d, J = 7.5 Hz, 1H), 6.20 (d, J = 7.6 Hz, 1H), 6.03–5.91 (m, 1H), 5.49 (dt, J = 22.5, 6.8 Hz, 2H), 5.37 (s, 1H), 4.68 (d, J = 4.9 Hz, 1H), 4.65 (d, J = 5.0 Hz, 1H), 4.57 (d, J = 7.7 Hz, 1H), 4.55 (d, J = 6.5 Hz, 2H), 4.48–4.43 (m, 1H), 4.38 (t, J = 6.4 Hz, 2H), 4.28–4.20 (m, 2H), 4.17 (dq, J = 10.5, 5.5 Hz, 1H), 4.12–4.03 (m, 1H), 4.03–3.93 (m, 1H), 3.72–3.63 (m, 1H), 3.57 (dd, J = 11.3, 5.5 Hz, 1H), 2.98 (t, J = 5.8 Hz, 1H), 2.91 (t, J = 5.7 Hz, 2H), 2.81 (q, J = 6.5 Hz, 3H), 2.75 (d, J = 6.5 Hz, 1H), 2.73–2.66 (m, 2H), 1.29 (s, 5H), 1.22 (dd, J = 6.7, 2.9 Hz, 8H), 0.98 (d, J = 2.9 Hz, 9H), 0.92–0.88 (m, 3H), 0.89–0.84 (m, 2H), 0.23 (dd, J = 7.1, 4.7 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.92, 67.90, −3.01. ¹³C NMR (126 MHz, MeOD): δ 157.45, 148.09, 145.98, 140.24, 138.92, 128.87, 124.89, 123.15, 119.89, 117.09, 116.88, 92.18, 90.63, 85.37, 84.89, 80.21, 77.39, 76.84, 76.82, 71.52, 67.82, 63.68, 63.32, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.64, 34.28, 31.35, 24.90, 22.30, 18.76, 18.54, 18.40, 18.34, 18.15, 17.90, 17.63, 13.03, 2.46, −5.59, −5.96, −6.02.

Synthesis of ((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3S,5R)-2-(Iodomethyl)-5-(6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (38i)

38i was synthesized from II (0.48 mmol) and 38c (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.14 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1147.7 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.23 (d, J = 17.5 Hz, 1H), 8.18 (d, J = 10.9 Hz, 1H), 8.06 (d, J = 18.2 Hz, 1H), 6.54–6.32 (m, 1H), 6.22 (dd, J = 19.3, 7.5 Hz, 1H), 5.56–5.47 (m, 1H), 5.28 (d, J = 67.5 Hz, 1H), 4.67 (dd, J = 12.5, 4.7 Hz, 1H), 4.60 (t, J = 5.6 Hz, 1H), 4.51 (q, J = 6.9 Hz, 2H), 4.44–4.38 (m, 2H), 4.37–4.32 (m, 1H), 4.23 (dd, J = 15.9, 7.8 Hz, 1H), 4.21–4.12 (m, 1H), 4.10 (s, 1H), 4.00 (tq, J = 10.4, 5.6 Hz, 1H), 3.50 (dt, J = 10.9, 6.0 Hz, 1H), 3.42 (dd, J = 10.7, 5.9 Hz, 1H), 2.97 (t, J = 5.8 Hz, 1H), 2.91 (t, J = 5.9 Hz, 1H), 2.82 (q, J = 5.7 Hz, 2H), 2.76 (td, J = 6.5, 2.5 Hz, 1H), 2.72 (q, J = 5.7 Hz, 2H), 1.22 (dd, J = 5.9, 2.9 Hz, 6H), 0.98 (dd, J = 5.8, 2.7 Hz, 9H), 0.23 (dt, J = 6.0, 3.1 Hz, 5H). ³¹P NMR (203 MHz, MeOD) δ 68.00, −3.06, −3.24. ¹³C NMR (126 MHz, MeOD): δ 180.38, 157.47, 156.10, 149.48, 148.53, 148.28, 145.46, 139.80, 139.19, 138.94, 128.88, 124.80, 123.17, 120.60, 119.89, 117.17, 117.08, 116.88, 85.70, 85.01, 80.98, 77.24, 71.48, 67.55, 63.69, 63.37, 48.10, 47.93, 47.76, 47.59, 47.42, 47.25, 47.08, 36.49, 35.60, 31.33, 29.34, 25.04, 24.90, 22.29, 18.85, 18.56, 18.41, 18.34, 18.05, 17.89, 17.62, 13.02, 3.26, 3.07, −5.55, −5.60, −6.02.

Synthesis of ((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(Iodomethyl)-5-(2-Isobutyramido-6-Oxo-1,4,5,6-Tetrahydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (38k)

38k was synthesized from II (0.48 mmol) and XII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.165 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1253.3 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.21 (s, 1H), 8.13 (d, J = 23.6 Hz, 1H), 6.33–6.25 (m, 1H), 6.24 (s, 1H), 6.19 (d, J = 19.3 Hz, 1H), 5.90 (d, J = 52.1 Hz, 1H), 5.47 (d, J = 31.7 Hz, 1H), 4.71–4.61 (m, 1H), 4.57 (s, 1H), 4.54 (s, 1H), 4.46 (d, J = 6.7 Hz, 1H), 4.38 (dd, J = 13.0, 6.2 Hz, 2H), 4.26–4.16 (m, 2H), 4.09 (d, J = 6.8 Hz, 2H), 4.05–3.92 (m, 1H), 3.68 (dd, J = 11.5, 5.2 Hz, 1H), 3.57 (dd, J = 11.3, 5.6 Hz, 1H), 2.99 (t, J = 5.7 Hz, 1H), 2.92 (t, J = 5.9 Hz, 1H), 2.82 (t, J = 5.8 Hz, 2H), 2.78 (s, 2H), 2.70 (dt, J = 12.6, 5.8 Hz, 2H), 2.15 (s, 1H), 1.95 (s, 1H), 1.31–1.27 (m, 5H), 1.27–1.21 (m, 9H), 0.98 (d, J = 8.0 Hz, 9H), 0.90 (t, J = 6.8 Hz, 2H), 0.22 (dd, J = 13.1, 5.4 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.94, 67.90, −2.99. ¹³C NMR (126 MHz, MeOD): δ 180.30, 148.62, 138.63, 128.72, 117.11, 116.85, 91.65, 90.11, 86.73, 85.22, 84.73, 80.26, 76.81, 71.39, 67.70, 63.68, 63.30, 54.83, 48.10, 47.93, 47.76, 47.59, 47.42, 47.25, 47.08, 35.66, 34.27, 31.33, 29.34, 28.75, 24.90, 24.88, 22.28, 18.87, 18.55, 18.42, 18.35, 18.06, 17.61, 17.59, 13.02, 10.35, 2.66, −1.45, −5.55, −5.62, −5.95, −6.04.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-4,5-dihydro-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2S,4R,5R)-4-((bis­(2-Cyanoethoxy)­phosphorothioyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (38l)

38L was synthesized from III (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.1 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1140.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.72 (d, J = 20.4 Hz, 1H), 8.54 (d, J = 12.1 Hz, 1H), 8.13–8.07 (m, 3H), 7.68–7.63 (m, 1H), 7.57 (td, J = 7.7, 1.6 Hz, 2H), 6.42 (ddd, J = 19.3, 4.9, 2.3 Hz, 1H), 6.22 (dd, J = 20.1, 2.4 Hz, 1H), 6.14–5.94 (m, 1H), 5.66–5.48 (m, 2H), 4.56–4.52 (m, 1H), 4.44 (ddd, J = 24.1, 11.5, 5.9 Hz, 2H), 4.39–4.33 (m, 2H), 4.32–4.27 (m, 2H), 4.27–4.23 (m, 2H), 4.17 (q, J = 6.1 Hz, 1H), 3.64 (dt, J = 11.3, 4.6 Hz, 1H), 3.52–3.47 (m, 1H), 2.93 (ddd, J = 10.7, 5.4, 1.3 Hz, 2H), 2.90 (dd, J = 5.7, 1.2 Hz, 1H), 2.86 (ddt, J = 15.5, 10.9, 4.7 Hz, 5H), 2.74 (qd, J = 6.9, 3.0 Hz, 1H), 2.56 (ddt, J = 12.5, 7.5, 3.8 Hz, 1H), 1.28 (s, 5H), 1.20 (td, J = 4.6, 2.2 Hz, 6H), 0.90 (t, J = 6.8 Hz, 2H). ³¹P NMR (203 MHz, MeOD) δ 66.42, −3.07, −3.14. ¹³C NMR (126 MHz, MeOD): δ 180.40, 166.74, 156.10, 152.07, 151.32, 150.03, 148.52, 143.74, 138.80, 133.51, 132.56, 128.38, 128.11, 124.04, 120.55, 117.14, 117.06, 90.30, 89.75, 87.26, 86.98, 81.19, 80.13, 78.44, 76.83, 69.06, 63.35, 48.10, 47.93, 47.76, 47.59, 47.42, 47.25, 47.08, 35.53, 32.95, 31.66, 31.34, 29.34, 22.29, 18.76, 18.53, 18.02, 17.91, 13.02, 2.26, −1.45.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-((tert-Butyldimethylsilyl)­oxy)-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (39c)

39c was synthesized from VI (0.48 mmol) and 39a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.195 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1399.2 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.80 (d, J = 1.8 Hz, 1H), 8.72 (d, J = 7.7 Hz, 1H), 8.64 (d, J = 9.3 Hz, 1H), 8.56 (d, J = 4.2 Hz, 1H), 8.08–8.02 (m, 3H), 7.98–7.95 (m, 1H), 7.66–7.62 (m, 1H), 7.62–7.58 (m, 1H), 7.55 (ddt, J = 9.5, 7.7, 3.8 Hz, 4H), 7.48 (t, J = 7.8 Hz, 1H), 6.46 (t, J = 5.3 Hz, 1H), 6.03 (dd, J = 48.3, 6.4 Hz, 1H), 5.88 (dq, J = 13.5, 4.6 Hz, 1H), 5.39 (dddd, J = 32.6, 6.4, 4.7, 1.9 Hz, 1H), 5.12 (dd, J = 5.6, 4.0 Hz, 1H), 5.03 (dddd, J = 21.1, 7.5, 4.7, 2.2 Hz, 1H), 4.94 (t, J = 4.3 Hz, 1H), 4.65–4.57 (m, 2H), 4.53 (dt, J = 11.3, 5.6 Hz, 1H), 4.41 (qt, J = 6.4, 3.3 Hz, 2H), 4.32 (dtd, J = 12.0, 5.3, 1.4 Hz, 2H), 4.29–4.26 (m, 1H), 4.23 (ddd, J = 7.7, 6.0, 1.8 Hz, 2H), 4.19 (ddd, J = 8.8, 4.8, 2.3 Hz, 1H), 4.17–4.13 (m, 1H), 4.12–4.06 (m, 1H), 3.65 (ddd, J = 11.3, 6.9, 4.5 Hz, 1H), 3.51 (ddd, J = 29.4, 10.8, 6.2 Hz, 1H), 2.93–2.86 (m, 2H), 2.84 (q, J = 6.1 Hz, 2H), 2.79 (ddd, J = 9.1, 5.1, 3.3 Hz, 2H), 2.15 (s, 3H), 1.01 (d, J = 0.9 Hz, 9H), 0.91–0.87 (m, 3H), 0.73 (d, J = 4.5 Hz, 9H), 0.28 (dd, J = 6.5, 3.1 Hz, 6H), −0.04 (d, J = 17.9 Hz, 3H), −0.24 (d, J = 4.8 Hz, 3H). ³¹P NMR (203 MHz, MeOD) δ 67.95, 67.92, −2.62, −2.79. ¹³C NMR (126 MHz, MeOD): δ 208.68, 166.73, 166.61, 152.08, 151.94, 151.80, 151.73, 151.65, 150.23, 150.10, 150.05, 144.12, 144.01, 143.56, 133.54, 133.41, 132.56, 132.49, 128.93, 128.40, 128.35, 128.31, 128.10, 128.04, 124.37, 124.28, 124.11, 119.91, 117.13, 117.08, 116.99, 88.84, 88.74, 87.46, 87.18, 83.82, 83.76, 83.18, 83.12, 82.86, 82.63, 79.64, 79.60, 79.36, 79.31, 77.84, 77.53, 72.92, 72.48, 71.04, 70.60, 70.55, 67.53, 66.66, 63.64, 63.60, 63.48, 63.45, 63.34, 63.30, 63.26, 48.15, 47.98, 47.81, 47.64, 47.47, 47.30, 47.13, 36.04, 34.38, 34.29, 31.36, 29.33, 28.77, 25.05, 24.81, 24.72, 24.68, 22.85, 22.31, 19.65, 18.91, 18.85, 18.64, 18.57, 18.47, 17.70, 17.54, 17.46, 17.43, 13.07, 10.40, 3.26, 2.95, −5.36, −5.39, −5.83, −5.97, −6.04, −6.53, −6.59.

Synthesis of ((2R,3R,4R,5R)-5-(6-Benzamido-9H-Purin-9-yl)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)­tetrahydrofuran-2-yl)­methyl ((2S,3R,4R,5R)-4-((tert-Butyldimethylsilyl)­oxy)-2-(iodomethyl)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) (2-Cyanoethyl) Phosphate (39d)

39d was synthesized from VI (0.48 mmol) and 39b (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.18 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1380.3 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.88 (d, J = 12.7 Hz, 1H), 8.65 (d, J = 8.5 Hz, 1H), 8.12 (d, J = 8.8 Hz, 1H), 7.84 (dd, J = 25.2, 7.7 Hz, 2H), 7.63–7.58 (m, 1H), 7.46 (t, J = 7.9 Hz, 2H), 6.47 (dd, J = 13.4, 5.1 Hz, 1H), 5.90 (dt, J = 11.4, 4.6 Hz, 1H), 5.64 (dd, J = 15.4, 7.4 Hz, 1H), 5.26 (d, J = 5.3 Hz, 1H), 4.75 (d, J = 6.6 Hz, 1H), 4.57 (dd, J = 5.9, 3.1 Hz, 1H), 4.55–4.52 (m, 1H), 4.38 (s, 1H), 4.34–4.31 (m, 1H), 4.30–4.23 (m, 3H), 4.23–4.18 (m, 1H), 4.07 (d, J = 7.6 Hz, 1H), 3.77 (s, 1H), 3.47 (dd, J = 10.7, 7.5 Hz, 1H), 3.43 (d, J = 6.2 Hz, 1H), 3.39 (dd, J = 10.7, 5.6 Hz, 1H), 2.93–2.89 (m, 2H), 2.86 (t, J = 5.9 Hz, 2H), 2.83 (t, J = 6.0 Hz, 2H), 2.77–2.74 (m, 1H), 1.30–1.25 (m, 5H), 1.23 (dd, J = 6.8, 3.6 Hz, 5H), 1.02 (d, J = 4.3 Hz, 9H), 0.70 (d, J = 1.9 Hz, 9H), 0.31 (d, J = 2.0 Hz, 4H), 0.27 (d, J = 6.5 Hz, 2H), −0.05 (d, J = 7.7 Hz, 3H), −0.28 (d, J = 18.7 Hz, 3H). ³¹P NMR (203 MHz, MeOD) δ 67.94, −2.07, −3.31. ¹³C NMR (126 MHz, MeOD): δ 180.32, 166.29, 166.08, 155.74, 152.19, 152.08, 151.73, 151.52, 150.19, 149.15, 148.48, 144.60, 144.40, 138.48, 132.92, 132.68, 128.88, 128.40, 128.35, 127.82, 127.73, 124.34, 124.06, 123.15, 120.33, 119.92, 117.15, 117.07, 117.01, 87.81, 87.55, 86.92, 84.28, 83.13, 82.79, 82.48, 79.50, 77.94, 76.98, 73.86, 71.44, 70.34, 67.92, 66.47, 63.66, 63.47, 63.20, 63.16, 63.03, 48.13, 47.96, 47.79, 47.62, 47.45, 47.28, 47.11, 35.62, 34.28, 31.35, 29.34, 28.77, 25.04, 24.99, 24.81, 24.54, 22.31, 19.63, 18.93, 18.87, 18.64, 18.56, 18.49, 18.12, 17.87, 17.76, 17.70, 17.67, 17.41, 17.35, 13.05, 10.38, 3.89, 3.37, −5.36, −5.48, −5.82, −5.94, −6.10, −6.84.

Synthesis of (2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)­tetrahydrofuran-(2-yl)­methyl ((2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl) (2-cyanoethyl) Phosphate (39e)

39e was synthesized from VI (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.15 g) was isolated as an off-white solid. ESI–MS: m/z = 1287.3 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.77 (d, J = 10.7 Hz, 1H), 8.71 (d, J = 6.0 Hz, 1H), 8.60 (d, J = 4.1 Hz, 1H), 8.53 (d, J = 1.1 Hz, 1H), 8.05 (ddt, J = 10.3, 7.1, 1.5 Hz, 4H), 7.67–7.59 (m, 2H), 7.57–7.49 (m, 4H), 6.47–6.41 (m, 2H), 6.03 (dddd, J = 51.4, 21.0, 4.8, 2.5 Hz, 1H), 5.80 (ddt, J = 13.9, 11.8, 5.0 Hz, 1H), 5.50 (dq, J = 13.5, 6.3 Hz, 1H), 5.03 (t, J = 4.5 Hz, 1H), 4.96 (t, J = 4.4 Hz, 1H), 4.67–4.59 (m, 1H), 4.59–4.52 (m, 1H), 4.45–4.40 (m, 1H), 4.39–4.31 (m, 2H), 4.24 (td, J = 9.7, 4.8 Hz, 2H), 4.21–4.17 (m, 1H), 4.13 (dddd, J = 18.7, 14.4, 6.4, 4.1 Hz, 2H), 3.64 (dt, J = 11.2, 4.7 Hz, 1H), 3.50 (ddd, J = 11.2, 10.0, 5.7 Hz, 1H), 2.96–2.89 (m, 2H), 2.83 (q, J = 6.0 Hz, 2H), 2.79–2.73 (m, 2H), 2.15 (s, 1H), 1.28 (s, 1H), 1.00 (d, J = 6.6 Hz, 9H), 0.90 (t, J = 6.9 Hz, 2H), 0.28–0.23 (m, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.98, 67.95, −3.03, −3.07. ¹³C NMR (126 MHz, MeOD): δ 166.75, 152.15, 151.93, 151.43, 150.14, 150.06, 143.84, 143.74, 133.51, 132.55, 132.50, 128.38, 128.35, 128.11, 124.31, 124.09, 117.06, 91.98, 90.19, 87.21, 86.93, 83.62, 80.23, 77.79, 76.90, 70.87, 67.18, 63.61, 63.43, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 31.35, 29.29, 24.97, 22.30, 18.81, 18.59, 18.48, 18.40, 17.66, 13.03, 2.24, −5.49, −5.94, −5.99.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-Purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2,4-dioxo-3,4-dihydropyrimidin-1­(2H)-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (39f)

39f was synthesized from VII (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.1 g) was isolated as an off-white solid. ESI–MS: m/z = 1159.9 [M + H]⁺. ¹H NMR (500 MHz, MeOD) δ 8.77 (d, J = 6.1 Hz, 1H), 8.56 (d, J = 2.6 Hz, 1H), 8.11–8.06 (m, 2H), 7.67 (dd, J = 7.7, 4.9 Hz, 1H), 7.65–7.63 (m, 1H), 7.56 (dd, J = 8.4, 7.1 Hz, 2H), 6.54–6.46 (m, 1H), 6.17–6.11 (m, 1H), 6.09 (t, J = 5.4 Hz, 1H), 5.77 (dd, J = 8.0, 4.3 Hz, 1H), 5.58 (dddd, J = 14.9, 11.6, 7.7, 4.7 Hz, 1H), 5.12–5.05 (m, 1H), 5.05–4.97 (m, 1H), 4.59 (ddd, J = 14.5, 5.1, 3.6 Hz, 1H), 4.52 (s, 1H), 4.48–4.42 (m, 3H), 4.42–4.35 (m, 1H), 4.34–4.25 (m, 6H), 3.72 (ddd, J = 11.4, 4.8, 1.3 Hz, 1H), 3.59 (ddd, J = 11.3, 5.7, 1.7 Hz, 1H), 3.00–2.96 (m, 2H), 2.88 (dd, J = 7.9, 5.9 Hz, 3H), 1.29 (d, J = 4.7 Hz, 1H), 0.96 (d, J = 4.7 Hz, 9H), 0.90 (s, 1H), 0.20 (dd, J = 8.6, 6.5 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.40, 68.37, −2.98. ¹³C NMR (126 MHz, MeOD): δ 166.85, 164.44, 160.11, 152.15, 151.47, 150.78, 150.07, 143.81, 143.71, 141.57, 141.41, 134.66, 133.49, 132.59, 128.72, 128.40, 128.11, 127.54, 124.07, 117.17, 102.38, 92.03, 90.51, 88.30, 88.08, 87.24, 86.97, 83.32, 80.41, 80.34, 77.69, 76.90, 70.55, 67.36, 63.82, 63.60, 63.49, 48.13, 47.96, 47.79, 47.62, 47.45, 47.27, 47.10, 24.94, 24.80, 18.91, 18.68, 18.61, 18.53, 18.46, 17.60, 2.33, −5.53, −6.06.

Synthesis of ((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(Iodomethyl)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (39g)

39g was synthesized from VI (0.48 mmol) and IX (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.152 g) was isolated as an off-white solid. ESI–MS: m/z = 1269.0 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.78 (d, J = 21.2 Hz, 1H), 8.60 (d, J = 28.4 Hz, 1H), 8.10 (s, 1H), 8.04 (d, J = 7.7 Hz, 1H), 7.98 (d, J = 8.2 Hz, 1H), 7.67–7.60 (m, 1H), 7.53 (dt, J = 20.1, 7.7 Hz, 2H), 7.40 (dt, J = 36.2, 7.9 Hz, 1H), 7.31–7.24 (m, 1H), 6.44 (dd, J = 17.3, 4.8 Hz, 1H), 6.22 (dd, J = 18.4, 2.7 Hz, 1H), 5.81 (dt, J = 10.5, 4.9 Hz, 1H), 5.03 (dt, J = 43.6, 4.6 Hz, 1H), 4.64–4.59 (m, 1H), 4.57 (s, 1H), 4.53 (dt, J = 11.4, 5.7 Hz, 2H), 4.40 (d, J = 5.1 Hz, 2H), 4.34 (q, J = 6.3 Hz, 2H), 4.29 (t, J = 6.5 Hz, 2H), 4.27–4.20 (m, 2H), 4.18–4.15 (m, 1H), 4.14 (d, J = 3.3 Hz, 1H), 3.97 (d, J = 6.0 Hz, 1H), 3.60 (dd, J = 11.3, 4.8 Hz, 1H), 3.55–3.51 (m, 1H), 3.52–3.46 (m, 1H), 3.46–3.39 (m, 1H), 2.99 (s, 1H), 2.94–2.88 (m, 2H), 2.85 (d, J = 3.0 Hz, 2H), 2.83 (t, J = 6.2 Hz, 2H), 2.80–2.75 (m, 2H), 2.72 (ddd, J = 13.9, 6.9, 2.3 Hz, 2H), 1.87 (dd, J = 18.0, 10.1 Hz, 1H), 1.51 (dt, J = 16.7, 4.9 Hz, 1H), 1.28 (d, J = 2.5 Hz, 2H), 1.24–1.22 (m, 4H), 1.20 (d, J = 7.2 Hz, 4H), 1.00 (d, J = 8.3 Hz, 9H), 0.30–0.22 (m, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.06, 68.01, 30.80, −2.71, −2.96. ¹³C NMR (126 MHz, MeOD): δ 180.19, 172.85, 161.68, 152.11, 148.40, 143.79, 138.93, 132.55, 129.83, 128.32, 128.06, 127.99, 117.03, 87.09, 86.62, 79.80, 76.87, 70.47, 66.73, 63.46, 48.09, 47.92, 47.75, 47.59, 47.41, 47.24, 47.07, 35.62, 31.33, 29.34, 24.97, 24.94, 22.28, 18.79, 18.51, 17.92, 17.64, 13.01, 2.52, −1.46, −5.46.

Synthesis of (1S,3R,4R,7S)-3-(6-Benzamido-9H-purin-9-yl)-1-(Iodomethyl)-2,5-dioxabicyclo­[2.2.1]­heptan-7-yl (((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2-Isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (40b)

40b was synthesized from II (1.26 mmol) and 40a (1.89 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.5 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1279.0 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.73 (s, 1H), 8.62 (d, J = 7.3 Hz, 1H), 8.17 (s, 1H), 8.14 (d, J = 7.7 Hz, 1H), 8.10–8.06 (m, 1H), 7.66 (t, J = 7.4 Hz, 1H), 7.58 (dt, J = 15.3, 7.6 Hz, 2H), 6.29 (s, 1H), 6.22–6.17 (m, 1H), 5.28–5.25 (m, 1H), 5.11 (d, J = 8.2 Hz, 1H), 4.63 (d, J = 4.8 Hz, 1H), 4.58 (s, 1H), 4.51 (dd, J = 12.6, 5.7 Hz, 2H), 4.43 (dd, J = 7.6, 5.7 Hz, 1H), 4.33 (dd, J = 13.0, 6.1 Hz, 2H), 4.22 (d, J = 8.5 Hz, 1H), 4.18–4.13 (m, 3H), 4.13–4.05 (m, 2H), 4.00 (dd, J = 13.6, 7.7 Hz, 1H), 3.72 (d, J = 1.9 Hz, 1H), 3.66 (s, 1H), 2.95 (t, J = 5.8 Hz, 1H), 2.86 (t, J = 5.8 Hz, 1H), 2.77 (dd, J = 7.4, 4.3 Hz, 2H), 2.72–2.65 (m, 2H), 2.15 (s, 2H), 1.28 (s, 1H), 1.21 (d, J = 6.8 Hz, 2H), 1.19–1.16 (m, 4H), 0.94 (d, J = 16.3 Hz, 9H), 0.18 (dd, J = 21.2, 9.3 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.87, −3.69, −4.22. ¹³C NMR (126 MHz, MeOD): δ 180.32, 166.73, 156.10, 152.08, 151.16, 149.95, 148.55, 141.86, 139.20, 133.53, 132.57, 128.87, 128.41, 128.21, 128.09, 124.06, 120.61, 119.90, 117.14, 117.06, 116.90, 86.58, 86.04, 85.96, 85.54, 84.87, 78.78, 78.45, 78.34, 76.99, 72.77, 71.53, 71.30, 67.86, 63.68, 63.31, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 35.60, 31.35, 29.29, 24.94, 24.91, 22.30, 18.69, 18.57, 18.43, 18.36, 18.09, 17.81, 17.63, 13.03, −4.02, −5.55, −5.69, −5.92, −6.00.

Synthesis of 1S,3R,4R,7S)-3-(6-Benzamido-9H-purin-9-yl)-1-(Iodomethyl)-2,5-dioxabicyclo­[2.2.1]­heptan-7-yl (((2S,4R,5R)-4-((bis­(2-cyanoethoxy)­Phosphorothioyl)­oxy)-5-(2-Isobutyramido-6-Oxo-1,6-Dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-cyanoethyl) Phosphate (40c

40c was synthesized from III (0.48 mmol) and 40a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.1 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1147.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.70 (d, J = 17.5 Hz, 1H), 8.55 (d, J = 32.3 Hz, 1H), 8.14–8.10 (m, 1H), 8.08 (dd, J = 6.8, 2.4 Hz, 2H), 7.68–7.62 (m, 1H), 7.57 (q, J = 7.5 Hz, 3H), 6.25 (s, 1H), 6.22–6.12 (m, 1H), 5.24–5.17 (m, 1H), 4.51–4.46 (m, 1H), 4.44 (t, J = 5.3 Hz, 1H), 4.40–4.35 (m, 1H), 4.35–4.30 (m, 2H), 4.30–4.25 (m, 3H), 4.25–4.23 (m, 1H), 4.19 (dd, J = 9.4, 5.8 Hz, 1H), 4.10 (dd, J = 12.7, 4.6 Hz, 2H), 3.64 (s, 1H), 3.62 (d, J = 7.9 Hz, 1H), 2.90 (td, J = 5.8, 1.1 Hz, 1H), 2.84 (dd, J = 11.1, 5.7 Hz, 4H), 2.80 (dd, J = 10.8, 4.8 Hz, 2H), 2.76–2.69 (m, 2H), 2.54–2.45 (m, 1H), 1.29 (d, J = 4.3 Hz, 4H), 1.20 (dt, J = 6.9, 2.5 Hz, 8H), 0.92–0.87 (m, 2H). ³¹P NMR (203 MHz, MeOD) δ 66.37, −3.81. ¹³C NMR (126 MHz, MeOD): δ 180.38, 166.69, 156.02, 152.02, 151.10, 149.89, 148.59, 148.45, 141.89, 141.69, 139.26, 138.85, 133.50, 132.55, 128.38, 128.17, 128.11, 123.88, 120.58, 117.11, 89.89, 86.44, 85.81, 81.04, 80.48, 78.78, 78.55, 78.20, 72.83, 72.69, 69.15, 63.47, 63.34, 48.10, 47.93, 47.76, 47.59, 47.42, 47.25, 47.08, 35.53, 32.96, 31.66, 31.34, 29.34, 22.29, 18.71, 18.51, 18.05, 17.99, 17.93, 13.02, −1.46, −4.30.

Synthesis of (1S,3R,4R,7S)-3-(6-Benzamido-9H-purin-9-yl)-1-(Iodomethyl)-2,5-dioxabicyclo­[2.2.1]­heptan-7-yl (((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (40d)

40d was synthesized from VI (0.48 mmol) and 40a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.13 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1297.1 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.74 (d, J = 2.9 Hz, 1H), 8.71–8.69 (m, 2H), 8.64 (d, J = 2.0 Hz, 1H), 8.59 (d, J = 8.4 Hz, 1H), 8.07 (t, J = 7.0 Hz, 6H), 7.67–7.62 (m, 3H), 7.56 (dt, J = 8.5, 5.9 Hz, 5H), 6.40 (dd, J = 19.2, 5.4 Hz, 1H), 6.24 (q, J = 6.5 Hz, 2H), 6.19 (d, J = 4.4 Hz, 1H), 5.76 (ddt, J = 21.4, 11.4, 5.2 Hz, 1H), 5.21–5.13 (m, 4H), 5.13–5.06 (m, 1H), 4.57 (s, 1H), 4.54 (d, J = 6.0 Hz, 2H), 4.33 (d, J = 5.1 Hz, 1H), 4.30 (t, J = 6.8 Hz, 2H), 4.26 (dd, J = 9.5, 4.8 Hz, 1H), 4.24–4.19 (m, 1H), 4.14 (t, J = 8.2 Hz, 3H), 3.69 (s, 2H), 3.67–3.59 (m, 2H), 2.91–2.87 (m, 1H), 2.86 (d, J = 5.1 Hz, 2H), 2.74 (q, J = 5.2 Hz, 2H), 1.85 (dd, J = 18.0, 10.5 Hz, 4H), 1.46 (ddd, J = 17.2, 11.3, 6.2 Hz, 2H), 1.28 (s, 3H), 0.97 (d, J = 1.3 Hz, 9H), 0.90 (t, J = 6.8 Hz, 2H), 0.21 (dd, J = 12.1, 6.4 Hz, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.96, 67.92, 30.34, 30.05, −3.73, −3.80. ¹³C NMR (126 MHz, MeOD): δ 166.74, 152.08, 149.90, 141.84, 128.38, 128.35, 128.11, 128.06, 125.53, 120.45, 120.41, 120.24, 120.21, 117.03, 86.51, 85.91, 78.72, 76.95, 72.90, 63.61, 31.35, 24.95, 22.30, 18.39, 17.64, 13.02, 10.65, 9.39, −1.44, −4.49, −5.52, −6.01.

Synthesis of (1S,3R,4R,7S)-3-(6-Benzamido-9H-purin-9-yl)-1-(iodomethyl)-2,5-Dioxabicyclo­[2.2.1]­heptan-7-yl (((2R,3R,4R,5R)-4-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-3-((tert-Butyldimethylsilyl)­oxy)-5-(2,4-dioxo-3,4-dihydropyrimidin-1­(2H)-yl)­tetrahydrofuran-2-yl)­methyl) (2-cyanoethyl) Phosphate (40e)

40e was synthesized from VII (0.48 mmol) and 40a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.095 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1170.0 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.74 (d, J = 3.3 Hz, 1H), 8.69 (d, J = 11.3 Hz, 1H), 8.63–8.54 (m, 2H), 8.09 (dt, J = 5.4, 2.5 Hz, 2H), 7.68–7.64 (m, 2H), 7.57 (td, J = 5.2, 2.5 Hz, 3H), 6.28 (s, 1H), 6.22 (d, J = 27.5 Hz, 1H), 5.99 (dd, J = 31.1, 5.7 Hz, 1H), 5.73 (t, J = 7.9 Hz, 1H), 5.26–5.20 (m, 1H), 5.16 (dd, J = 9.3, 6.0 Hz, 3H), 5.05 (dt, J = 12.1, 5.3 Hz, 1H), 4.97 (dt, J = 12.3, 5.5 Hz, 2H), 4.57 (s, 1H), 4.55–4.44 (m, 2H), 4.41–4.33 (m, 4H), 4.32–4.23 (m, 4H), 4.23–4.17 (m, 2H), 4.15 (dt, J = 8.3, 2.8 Hz, 2H), 4.10 (d, J = 2.3 Hz, 1H), 3.76–3.68 (m, 3H), 2.99 (s, 2H), 2.92 (dtd, J = 8.9, 5.8, 1.2 Hz, 3H), 2.86 (d, J = 0.7 Hz, 4H), 1.85 (dd, J = 18.0, 10.5 Hz, 2H), 1.28 (s, 3H), 0.93 (d, J = 2.9 Hz, 9H), 0.91–0.88 (m, 2H), 0.20–0.11 (m, 6H). ³¹P NMR (203 MHz, MeOD) δ 68.51, 68.43, 30.35, 30.07, −3.39, −3.74. ¹³C NMR (126 MHz, MeOD): δ 166.73, 164.35, 163.45, 152.11, 152.01, 151.09, 150.72, 149.92, 141.83, 141.62, 141.52, 141.24, 133.55, 132.53, 129.75, 129.60, 128.38, 128.09, 128.05, 125.51, 125.34, 123.97, 120.41, 120.21, 117.16, 102.35, 102.27, 88.51, 87.90, 86.47, 85.87, 83.32, 83.14, 79.06, 78.93, 78.81, 78.74, 78.34, 78.19, 77.66, 77.52, 76.93, 76.74, 72.89, 72.79, 70.40, 67.16, 63.75, 63.58, 63.44, 48.10, 47.93, 47.76, 47.59, 47.42, 47.25, 47.08, 35.54, 31.33, 30.24, 24.90, 22.28, 18.79, 18.64, 18.58, 18.49, 18.43, 17.57, 13.02, 10.65, −1.45, −4.15, −4.34, −4.49, −5.56, −6.08, −6.14.

Synthesis of ((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-3-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-fluorotetrahydrofuran-2-yl)­methyl ((2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl) (2-cyanoethyl) Phosphate (41a)

41a was synthesized from XI (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.15 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1174.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.77 (d, J = 17.4 Hz, 1H), 8.69 (s, 1H), 8.54 (d, J = 3.0 Hz, 1H), 8.52 (d, J = 6.5 Hz, 1H), 8.08–8.03 (m, 3H), 8.03–7.99 (m, 1H), 7.67–7.61 (m, 1H), 7.61–7.57 (m, 1H), 7.58–7.52 (m, 3H), 7.52–7.48 (m, 1H), 6.51 (ddd, J = 19.6, 8.7, 1.3 Hz, 1H), 6.37 (ddd, J = 44.0, 18.9, 2.6 Hz, 1H), 6.06 (d, J = 5.0 Hz, 1H), 5.98–5.94 (m, 1H), 5.45 (ddt, J = 29.8, 12.5, 6.9 Hz, 1H), 4.67 (ddt, J = 8.8, 5.7, 2.9 Hz, 1H), 4.65–4.51 (m, 2H), 4.45–4.35 (m, 4H), 4.31 (dp, J = 8.8, 3.1 Hz, 1H), 4.25 (dt, J = 7.2, 5.9 Hz, 1H), 4.19 (d, J = 6.0 Hz, 1H), 4.00 (d, J = 5.6 Hz, 1H), 3.60 (ddd, J = 25.7, 11.2, 5.0 Hz, 1H), 3.44 (ddd, J = 38.6, 11.2, 5.8 Hz, 1H), 3.01–2.90 (m, 5H), 2.87 (td, J = 5.8, 1.2 Hz, 1H), 2.15 (s, 3H), 1.97 (s, 1H), 1.29 (s, 2H). ³¹P NMR (203 MHz, MeOD) δ 67.24, 67.17, −3.23, −3.31. ¹³C NMR (126 MHz, MeOD): δ 166.74, 152.26, 151.37, 143.78, 133.50, 132.55, 128.86, 128.37, 128.09, 124.07, 123.11, 119.92, 117.27, 117.15, 91.95, 90.42, 87.21, 80.18, 79.49, 76.83, 72.98, 66.15, 63.68, 63.51, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 29.28, 18.63, 13.03, 2.22.

Synthesis of (2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-3-(((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-fluorotetrahydrofuran-2-yl)­methyl (2-cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(iodomethyl)-5-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (41b)

41b was synthesized from XI (0.48 mmol) and IX (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.131 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1156.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.79 (d, J = 35.8 Hz, 1H), 8.55 (d, J = 45.6 Hz, 1H), 8.09 (d, J = 9.0 Hz, 1H), 8.06–7.89 (m, 2H), 7.63 (dt, J = 15.3, 7.5 Hz, 1H), 7.54 (t, J = 7.7 Hz, 1H), 7.48 (t, J = 7.7 Hz, 1H), 6.51 (t, J = 19.6 Hz, 1H), 6.29–6.10 (m, 1H), 6.10–5.94 (m, 2H), 5.80–5.59 (m, 1H), 5.32–5.10 (m, 1H), 4.70–4.48 (m, 3H), 4.40 (ddt, J = 16.9, 9.2, 5.8 Hz, 3H), 4.28 (dt, J = 7.3, 5.9 Hz, 1H), 4.26–4.20 (m, 1H), 3.57 (dd, J = 11.3, 4.8 Hz, 1H), 3.45 (dt, J = 10.8, 5.4 Hz, 1H), 3.38–3.34 (m, 1H), 3.00–2.90 (m, 4H), 2.88–2.82 (m, 1H), 2.75–2.69 (m, 1H), 2.15 (s, 2H), 1.98 (s, 1H), 1.28 (s, 1H), 1.25–1.16 (m, 6H), 0.90 (t, J = 6.9 Hz, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.28, 67.20, −2.81, −3.07. ¹³C NMR (126 MHz, MeOD): δ 180.36, 152.29, 151.33, 148.50, 143.98, 143.76, 139.06, 132.63, 128.87, 128.38, 128.33, 128.09, 127.94, 123.96, 123.13, 120.50, 119.92, 117.27, 117.10, 87.95, 87.67, 76.82, 72.99, 66.17, 63.71, 63.48, 48.11, 47.95, 47.77, 47.60, 47.43, 47.26, 47.09, 35.63, 31.34, 29.28, 22.29, 18.73, 18.61, 18.01, 17.91, 13.02, 2.58, 2.17.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-3-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(2-Isobutyramido-6-Oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-cyanoethyl) Phosphate (41c)

41c was synthesized from XII (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.15 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1156.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.71 (d, J = 29.5 Hz, 1H), 8.54 (d, J = 14.7 Hz, 1H), 8.11 (d, J = 7.1 Hz, 1H), 8.08 (d, J = 4.2 Hz, 2H), 7.66 (t, J = 7.4 Hz, 1H), 7.57 (t, J = 7.6 Hz, 2H), 6.44 (ddd, J = 19.2, 7.1, 2.4 Hz, 1H), 6.33 (ddd, J = 17.1, 14.7, 3.0 Hz, 1H), 6.06 (dd, J = 51.8, 34.1 Hz, 1H), 5.81 (ddt, J = 51.1, 24.1, 3.5 Hz, 1H), 5.55–5.47 (m, 1H), 4.71–4.59 (m, 2H), 4.44 (d, J = 6.1 Hz, 1H), 4.36 (dtd, J = 11.0, 6.2, 2.3 Hz, 3H), 4.27–4.22 (m, 1H), 3.70–3.63 (m, 1H), 3.52 (ddd, J = 13.4, 11.2, 5.7 Hz, 1H), 2.96 (q, J = 5.1 Hz, 2H), 2.92 (q, J = 6.1 Hz, 3H), 2.75 (td, J = 6.8, 4.3 Hz, 1H), 1.29 (s, 2H), 1.24–1.17 (m, 6H), 0.90 (t, J = 6.8 Hz, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.07, 66.97, −3.25, −3.31. ¹³C NMR (126 MHz, MeOD): δ 180.21, 166.79, 159.18, 151.41, 148.64, 143.78, 138.50, 132.57, 128.86, 128.38, 128.12, 119.92, 117.39, 117.20, 113.08, 87.01, 80.29, 76.93, 73.23, 63.63, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.64, 29.37, 18.66, 18.06, 17.81, 15.88, 2.09.

Synthesis of ((2R,3R,4R,5R)-3-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(2-Isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(iodomethyl)-5-(6-Oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (41d)

41d was synthesized from XII (0.48 mmol) and X (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.15 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1053.6 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.21 (d, J = 9.8 Hz, 1H), 8.13–8.09 (m, 1H), 8.08 (d, J = 8.9 Hz, 1H), 6.38–6.30 (m, 2H), 5.98 (s, 1H), 5.90–5.82 (m, 1H), 5.78 (s, 1H), 5.52 (s, 2H), 5.16 (s, 1H), 4.63 (d, J = 5.9 Hz, 2H), 4.57 (s, 2H), 4.43–4.31 (m, 6H), 4.20 (d, J = 5.6 Hz, 1H), 3.95 (s, 1H), 3.62 (dt, J = 11.2, 5.5 Hz, 1H), 3.50 (dt, J = 10.9, 5.5 Hz, 2H), 3.21 (s, 1H), 3.16 (p, J = 1.6 Hz, 2H), 2.92 (dq, J = 17.6, 5.9 Hz, 7H), 2.41 (s, 1H), 2.31 (s, 1H), 2.25 (s, 1H), 2.15 (s, 1H), 1.95 (s, 1H), 1.29 (s, 2H), 1.25–1.21 (m, 6H), 0.90 (s, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.11, 67.02, −3.29.

Synthesis of ((2R,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-3-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-fluorotetrahydrofuran-2-yl)­methyl (2-cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(iodomethyl)-5-(6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (40e)

41e was synthesized from XI (0.48 mmol) and X (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.10 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1071.5 [M + H]⁺. ¹H NMR (800 MHz, D₂O δ) 10.17 (s, 1H), 9.64 (s, 1H), 9.48 (s, 4H), 9.03 (d, J = 71.3 Hz, 3H), 8.65 (d, J = 48.4 Hz, 5H), 7.93 (s, 1H), 5.81 (s, 2H), 4.36 (s, 3H), 2.71 (s, 10H), 2.32 (s, 1H), 1.43 (s, 24H). ¹³C NMR (201 MHz, D₂O) δ 168.23, 163.08, 147.15, 133.96, 130.20, 129.77, 129.51, 124.38, 121.33, 118.48, 113.99, 76.23, 64.86, 30.74, 19.94, 14.41, −7.63.

Synthesis of ((2R,3R,4R,5R)-3-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((2S,3R,4R,5R)-4-Fluoro-2-(iodomethyl)-5-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (41f)

41f was synthesized from XIII (0.48 mmol) and IX (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.09 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1053.7 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.29–8.18 (m, 1H), 8.16–8.02 (m, 2H), 6.45–6.36 (m, 1H), 6.24 (ddd, J = 18.3, 7.1, 2.8 Hz, 1H), 5.93–5.86 (m, 1H), 5.86–5.78 (m, 1H), 5.78–5.73 (m, 1H), 5.21 (ddt, J = 19.2, 13.5, 6.2 Hz, 1H), 4.66–4.58 (m, 1H), 4.53 (ddd, J = 17.0, 11.0, 6.4 Hz, 2H), 4.42–4.38 (m, 1H), 4.38–4.33 (m, 2H), 4.33–4.28 (m, 2H), 4.03–3.93 (m, 1H), 3.91–3.70 (m, 1H), 3.49 (ddd, J = 11.4, 5.5, 3.7 Hz, 1H), 2.96–2.86 (m, 6H), 2.84–2.70 (m, 2H), 2.15 (s, 1H), 1.29 (s, 2H), 1.25–1.21 (m, 6H), 0.90 (t, J = 6.9 Hz, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.13, 67.05, −2.88, −3.11, −3.12. ¹³C NMR (126 MHz, MeOD): δ 180.62, 157.48, 148.63, 148.04, 146.05, 146.03, 140.01, 139.12, 128.87, 125.07, 120.62, 117.27, 117.17, 114.23, 92.09, 90.56, 86.63, 79.53, 76.85, 73.03, 66.39, 63.63, 56.07, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 35.60, 18.57, 17.97, 17.93, 15.87, 13.01, 2.35, 2.14.

Synthesis of (2S,3R,4R,5R)-5-(6-Benzamido-9H-purin-9-yl)-4-Fluoro-2-(iodomethyl)­tetrahydrofuran-3-yl (((2R,3R,4R,5R)-3-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl) (2-Cyanoethyl) Phosphate (41g)

41g was synthesized from XIII (0.48 mmol) and VIII (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.11 g) was isolated as a pale yellow solid. ESI–MS: m/z = 1071.5 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.74 (d, J = 6.9 Hz, 1H), 8.54 (d, J = 1.7 Hz, 1H), 8.21 (d, J = 10.1 Hz, 1H), 8.09 (d, J = 6.4 Hz, 2H), 7.66 (t, J = 7.4 Hz, 1H), 7.57 (t, J = 7.7 Hz, 2H), 6.47–6.36 (m, 2H), 6.03 (d, J = 51.4 Hz, 1H), 5.90 (d, J = 7.9 Hz, 1H), 5.83 (d, J = 12.0 Hz, 1H), 5.82–5.77 (m, 1H), 5.50 (dd, J = 14.9, 6.9 Hz, 1H), 4.66 (dd, J = 10.3, 5.0 Hz, 1H), 4.57 (dd, J = 14.9, 8.8 Hz, 3H), 4.42–4.31 (m, 6H), 4.23 (t, J = 5.8 Hz, 1H), 3.63 (ddd, J = 22.1, 11.2, 4.7 Hz, 1H), 3.48 (ddd, J = 29.0, 11.3, 5.5 Hz, 1H), 2.92 (dq, J = 16.0, 6.0 Hz, 6H), 2.15 (s, 2H), 1.99 (s, 1H), 1.29 (s, 6H). ³¹P NMR (203 MHz, MeOD) δ 67.07, 67.04, −3.20, −3.24. ¹³C NMR (126 MHz, MeOD): δ 166.87, 157.46, 152.12, 150.08, 148.00, 146.00, 143.73, 140.18, 132.58, 128.85, 128.39, 128.12, 119.94, 117.18, 101.34, 92.03, 90.54, 87.91, 86.97, 80.17, 79.59, 76.81, 73.12, 63.61, 63.59, 56.07, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 22.81, 18.56, 15.72, 2.17.

Synthesis of ((2R,3R,4R,5R)-3-((Bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-cyanoethyl) ((2S,3R,4R,5R)-4-fluoro-2-(iodomethyl)-5-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-3-yl) Phosphate (41h)

41h was synthesized from XII (0.48 mmol) and IX (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.2 g) was isolated as a pale yellow solid. ESI-MS: m/z = 1138.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.14 (d, J = 12.0 Hz, 1H), 8.09 (d, J = 11.8 Hz, 1H), 6.33 (ddd, J = 25.7, 16.9, 2.8 Hz, 1H), 6.21 (dd, J = 18.1, 3.2 Hz, 1H), 5.98–5.90 (m, 1H), 5.88–5.78 (m, 1H), 5.75 (s, 1H), 5.50 (s, 1H), 5.27 (s, 1H), 4.65–4.58 (m, 2H), 4.57 (t, J = 4.9 Hz, 1H), 4.42–4.37 (m, 3H), 4.37–4.32 (m, 3H), 4.23–4.17 (m, 1H), 3.60–3.41 (m, 2H), 2.95 (q, J = 6.2 Hz, 4H), 2.92–2.90 (m, 2H), 2.81–2.70 (m, 2H), 2.15 (s, 4H), 1.24–1.21 (m, 6H), 0.90 (d, J = 6.7 Hz, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.10, 67.02, −3.06, −3.15. ¹³C NMR (126 MHz, MeOD): δ 208.73, 180.24, 156.03, 148.63, 138.85, 138.40, 128.91, 120.53, 117.39, 117.22, 91.69, 90.14, 86.70, 86.43, 79.95, 76.84, 73.07, 66.39, 63.63, 48.12, 47.95, 47.78, 47.61, 47.44, 47.27, 47.10, 35.66, 31.35, 29.29, 22.29, 18.71, 18.63, 17.98, 17.85, 13.03, 2.32.

Synthesis of ((2R,3R,4R,5R)-3-((bis­(2-cyanoethoxy)­phosphorothioyl)­oxy)-4-Fluoro-5-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)­tetrahydrofuran-2-yl)­methyl (2-Cyanoethyl) ((1S,3R,4R,7S)-1-(iodomethyl)-3-(2-isobutyramido-6-oxo-1,6-dihydro-9H-purin-9-yl)-2,5-dioxabicyclo­[2.2.1]­heptan-7-yl) Phosphate (42b)

42b was synthesized from XII (0.48 mmol) and 42a (0.63 mmol, 1.5 equiv) using the same procedure as the synthesis of 34d. The product (0.18 g) was isolated as a pale yellow solid. ESI-MS: m/z = 1148.8 [M + H]⁺. ¹H NMR (500 MHz, MeOD δ) 8.71 (s, 1H), 8.05 (d, J = 12.0 Hz, 2H), 6.29 (dd, J = 16.9, 3.1 Hz, 1H), 6.04 (s, 1H), 5.85–5.67 (m, 1H), 5.44 (d, J = 30.9 Hz, 1H), 5.11 (d, J = 12.3 Hz, 2H), 4.63–4.51 (m, 4H), 4.42–4.30 (m, 5H), 4.30–4.23 (m, 2H), 4.14–4.01 (m, 3H), 3.64 (s, 2H), 3.22 (s, 2H), 3.11 (s, 2H), 2.93 (dt, J = 11.8, 5.9 Hz, 4H), 2.83 (s, 1H), 2.75–2.67 (m, 1H), 2.15 (d, J = 0.8 Hz, 2H), 1.29 (s, 3H), 1.23–1.17 (m, 6H), 0.90 (t, J = 6.8 Hz, 1H). ³¹P NMR (203 MHz, MeOD) δ 67.04, −4.05. ¹³C NMR (126 MHz, MeOD): δ 180.19, 158.79, 157.94, 149.71, 138.52, 136.44, 128.84, 117.45, 117.25, 91.19, 87.01, 86.30, 85.73, 79.95, 78.79, 78.16, 73.36, 72.66, 66.63, 63.61, 48.11, 47.94, 47.77, 47.60, 47.43, 47.26, 47.09, 40.19, 35.66, 34.05, 29.27, 18.61, 18.01, 17.84, 13.02, −4.13.

General Synthesis of Endo-S-CDNs

For the synthesis of 3,4, 6–9, 12–19, and 21–24: Ammonium hydroxide (5 mL, 30% ammonia in water) was added to representative iodide intermediate (31d–40e, 0.038 mmol) and the reaction was left to stir at RT for 24 h. The cyclized product was then dried under reduced pressure and then pyridine (1 mL) and Et₃N·3HF (125 μL, 0.798 mmol) was added and left to stir at 55–60 °C for 6 h. Ten milliliters of acetone was then added to precipitate the respective products, and this was collected via centrifugation as an off-white solid. The isolated product was washed 3x with 1 mL acetone before being left to dry overnight. The product was then dissolved in 5 mL of water and then purified via reverse phase (RP)-HPLC using either COSMOSIL C18-PAQ or Xterra RP18 5.0 μm or Hypersil Gold PFP packed columns with gradient comprising of 0–16 min: 99%–87% 0.1 M triethylammonium acetate (TEAA), 1–13% acetonitrile, 16–23 min: 87–10% 0.1 M TEAA, 13–90% acetonitrile 23–25 min: 10–99% 0.1 M TEAA, 90–1% acetonitrile or 0–16 min: 99%–87% of 0.1% formic acid, 1–13% acetonitrile, 16–23 min: 87–10% of 0.1% formic acid, 13–90% acetonitrile 23–25 min: 10–99% of 0.1% formic acid, 90–1% acetonitrile to afford either the triethylammonium or proton salt, respectively. Dowex 50W X8 was used for the salt exchange to convert the triethylammonium salt to the sodium salt for 3, 4, and 8 which was used for the in vivo studies.

For the synthesis of 5, 20, 25–33: 5 mL of ammonium hydroxide solution (30% ammonia in water) was added to dinucleotide iodide intermediate (38l, 40c, and 41a–42b, 0.038 mmol) and stirred for 24 h at RT. The macrocyclized product was then dried under reduced pressure. Five ml of water was added to dissolve about 20 mg of crude product and this solution was purified via RP-HPLC using same procedure as described for the synthesis of 3,4, 6–9, 12–19, and 21–24.

Characterization of 3

Off-white solid, 30% yield. ¹H NMR (800 MHz, D₂O) δ 8.23 (d, J = 2.6 Hz, 1H), 8.14 (d, J = 2.6 Hz, 1H), 8.04 (s, 1H), 6.35 (dt, J = 17.5, 2.6 Hz, 1H), 5.99 (dd, J = 8.2, 2.6 Hz, 1H), 5.70 (dd, J = 5.0, 2.6 Hz, 1H), 5.64 (dd, J = 4.9, 2.5 Hz, 1H), 5.48 (td, J = 7.8, 4.2 Hz, 1H), 5.18–5.12 (m, 3H), 4.60 (t, J = 3.4 Hz, 1H), 4.55–4.53 (m, 1H), 4.39–4.37 (m, 1H), 4.21 (dt, J = 5.2, 2.6 Hz, 4H), 3.37 (dtd, J = 11.5, 6.1, 3.0 Hz, 2H), 3.04 (ddt, J = 13.9, 11.1, 2.7 Hz, 2H), 1.92 (d, J = 2.5 Hz, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.78, −1.24. ¹³C NMR (201 MHz, D₂O) δ 178.84, 158.85, 154.51, 153.53, 151.99, 151.33, 148.31, 140.03, 138.80, 118.82, 116.43, 91.87, 90.92, 86.80, 86.63, 85.18, 84.15, 80.34, 76.60, 72.42, 71.69, 65.83, 30.80, 21.63, 10.42. HRMS (ESI-) m/z calcd for C₂₀H₂₂FN₁₀O₁₁P₂S [M-H]⁻ 691.064956, found 691.06582.

Characterization of 4

Off-white solid, 29% yield. ¹H NMR (800 MHz, D₂O) δ 8.18 (s, 1H), 8.07 (d, J = 2.6 Hz, 1H), 7.81 (s, 1H), 6.09 (s, 1H), 5.97 (d, J = 8.0 Hz, 1H), 5.84 (d, J = 10.6 Hz, 2H), 4.66–4.58 (m, 1H), 4.35 (s, 2H), 4.12 (d, J = 8.3 Hz, 2H), 4.07 (td, J = 7.2, 3.8 Hz, 2H), 3.96 (d, J = 8.2 Hz, 2H), 3.40 (d, J = 13.4 Hz, 2H), 2.98 (t, J = 12.9 Hz, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.43, −1.00. ¹³C NMR (201 MHz, D₂O) δ 159.03, 155.62, 152.96, 152.79, 151.67, 147.84, 140.31, 138.03, 118.89, 117.02, 86.95, 86.80, 86.18, 83.70, 78.58, 74.82, 73.43, 73.24, 71.49, 64.74. HRMS (ESI-) m/z calcd for C₂₁H₂₃N₁₀O₁₂P₂S [M-H]⁻ 701.069293, found 701.069293.

Characterization of 5

Off-white solid, 23% yield. ¹H NMR (800 MHz, D₂O) δ 8.18 (d, J = 29.4 Hz, 1H), 7.95 (d, J = 2.1 Hz, 2H), 5.93–5.79 (m, 1H), 5.78–5.73 (m, 2H), 5.41 (d, J = 9.1 Hz, 1H), 5.18–5.10 (m, 1H), 4.59 (s, 1H), 4.29 (d, J = 11.5 Hz, 1H), 4.23–4.17 (m, 2H), 4.11 (d, J = 14.1 Hz, 3H), 3.88 (s, 2H), 3.40 (dd, J = 13.6, 6.8 Hz, 1H), 2.98 (s, 1H), 2.85 (dt, J = 14.1, 7.4 Hz, 1H), 2.42–2.40 (m, 1H). ³¹P NMR (203 MHz, D₂O) δ 17.33, −1.35. ¹³C NMR (201 MHz, D₂O) δ 158.99, 155.62, 153.69, 152.90, 148.57, 139.79, 138.11, 118.85, 116.54, 91.08, 88.36, 86.67, 80.32, 79.18, 77.59, 72.40, 68.08, 46.65, 42.23, 33.09, 30.67, 10.50, 8.20. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₁₀O₁₀P₂S]^2– [M]^2– 337.03165, found 337.03119.

Characterization of 6

Off-white solid, 20% yield. ¹H NMR (800 MHz, D₂O) δ 8.01 (s, 1H), 7.53 (dd, J = 7.8, 5.0 Hz, 1H), 5.95 (d, J = 18.2 Hz, 3H), 5.91 (d, J = 5.0 Hz, 1H), 5.41–5.33 (m, 2H), 5.28 (d, J = 5.6 Hz, 1H), 4.56 (t, J = 4.8 Hz, 1H), 4.44 (s, 2H), 4.39 (s, 1H), 4.18 (p, J = 6.4 Hz, 4H), 3.45–3.41 (m, 1H), 3.02 (td, J = 11.4, 6.5 Hz, 2H), 2.98 (t, J = 6.5 Hz, 1H), 1.94 (d, J = 4.9 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.60, −1.19. ¹³C NMR (201 MHz, D₂O) δ 163.63, 158.77, 153.58, 142.27, 95.58, 92.12, 91.18, 90.05, 89.87, 85.46, 84.22, 79.13, 76.81, 71.38, 65.48, 42.15, 30.60, 10.41. HRMS (ESI-) m/z Calcd for [C₁₉H₂₁FN₈O₁₂P₂S]^2– [M]^2– 333.02475, Found 333.02432.

Characterization of 7

Off-white solid, 21% yield. ¹H NMR (800 MHz, D₂O) δ 8.14 (d, J = 13.4 Hz, 1H), 7.50–7.41 (m, 1H), 6.01 (t, J = 10.6 Hz, 1H), 5.90 (t, J = 17.6 Hz, 1H), 5.83–5.72 (m, 1H), 5.46–5.38 (m, 2H), 5.40–5.27 (m, 1H), 4.59–4.55 (m, 1H), 4.41–4.35 (m, 2H), 4.19 (q, J = 5.2 Hz, 2H), 3.34 (dd, J = 15.0, 8.3 Hz, 1H), 3.00 (d, J = 13.3 Hz, 2H), 1.99 (d, J = 14.0 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.96, −1.26. ¹³C NMR (201 MHz, D₂O) δ 166.03, 158.53, 153.82, 151.86, 150.88, 142.53, 138.41, 102.21, 91.63, 90.68, 90.20, 85.15, 84.32, 79.43, 76.77, 71.79, 71.60, 65.70, 30.66, 20.49. HRMS (ESI-) m/z calcd for [C₁₉H₂₀FN₇O₁₃P₂S]^2– [M]^2– 333.51695, found 333.51676.

Characterization of 8

Off-white solid, 34% yield. ¹H NMR (800 MHz, D₂O) δ 8.23–8.07 (m, 3H), 6.44–6.25 (m, 1H), 6.02 (q, J = 8.6 Hz, 1H), 5.73 (d, J = 51.3 Hz, 2H), 5.51 (s, 2H), 5.28 (d, J = 12.8 Hz, 1H), 4.64–4.55 (m, 2H), 4.52 (t, J = 8.2 Hz, 2H), 4.39 (d, J = 10.8 Hz, 2H), 4.26–4.11 (m, 3H), 3.32 (s, 3H), 3.02 (s, 2H), 1.90–1.79 (m, 1H). ³¹P NMR (203 MHz, D₂O) δ 19.06, −1.25. ¹³C NMR (201 MHz, D₂O) δ 158.92, 158.54, 153.65, 152.11, 148.37, 146.10, 140.28, 138.53, 124.12, 116.31, 91.88, 90.92, 87.17, 87.00, 84.78, 84.17, 80.69, 76.63, 72.74, 71.85, 66.02, 30.77. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₉O₁₂P₂S]⁻ [M-H]⁻ 692.048972, found 692.04958.

Characterization of 9

Off-white solid, 22% yield. ¹H NMR (500 MHz, D₂O) δ 8.17 (s, 1H), 8.12 (s, 1H), 8.09 (d, J = 0.9 Hz, 1H), 6.43 (t, J = 7.1 Hz, 1H), 6.00 (d, J = 8.1 Hz, 1H), 5.45 (td, J = 7.8, 4.1 Hz, 1H), 5.25–5.00 (m, 1H), 4.59 (d, J = 4.4 Hz, 2H), 4.36 (d, J = 3.1 Hz, 3H), 4.18 (dt, J = 6.4, 3.7 Hz, 3H), 3.03–2.98 (m, 2H), 2.97 (d, J = 6.8 Hz, 3H), 2.96–2.89 (m, 2H), 2.71 (ddd, J = 14.5, 6.4, 2.7 Hz, 2H), 2.13 (s, 1H), 1.88 (s, 3H). ³¹P NMR (203 MHz, D₂O) δ 19.50, −1.20. HRMS (ESI-) m/z calcd for [C₂₀H₂₁N₉O₁₂P₂S]^2– [M]^2– 336.52583, found 336.52504.

Characterization of 12

Off-white solid, 31% yield. ¹H NMR (800 MHz, D₂O) δ 8.59 (s, 1H), 8.08 (s, 1H), 6.20 (dd, J = 17.4, 3.0 Hz, 1H), 6.09 (d, J = 8.1 Hz, 1H), 5.57–5.51 (m, 1H), 5.15 (dq, J = 11.8, 5.9 Hz, 1H), 4.62 (d, J = 4.3 Hz, 1H), 4.49–4.45 (m, 1H), 4.41 (d, J = 2.6 Hz, 1H), 4.25–4.21 (m, 1H), 3.06–3.00 (m, 1H). ³¹P NMR (203 MHz, D₂O) δ 19.10, −1.42. ¹³C NMR (201 MHz, D₂O) δ 215.40, 157.96, 156.97, 154.54, 154.29, 114.43, 91.61, 90.66, 87.11, 86.94, 85.91, 84.68, 81.21, 76.56, 73.31, 71.93, 66.01, 64.33, 30.93. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₁₀O₁₂P₂S]^2– [M]^2– 353.02657, found 353.02584.

Characterization of 13

Off-white solid, 4% yield. ¹H NMR (500 MHz, D₂O) δ 8.44 (s, 1H), 8.16 (s, 1H), 7.96 (s, 1H), 6.44 (t, J = 7.1 Hz, 1H), 6.07 (d, J = 8.0 Hz, 1H), 5.24 (s, 2H), 4.47 (d, J = 10.1 Hz, 2H), 4.29 (d, J = 12.2 Hz, 1H), 3.49–3.43 (m, 1H), 3.12–3.08 (m, 1H), 3.05–2.90 (m, 3H), 2.81 (d, J = 6.2 Hz, 2H), 2.78 (d, J = 6.2 Hz, 1H), 2.25 (s, 2H), 1.99 (d, J = 9.6 Hz, 2H), 1.79 (d, J = 17.1 Hz, 4H), 1.34 (s, 1H), 1.26 (s, 3H), 1.16 (dt, J = 15.6, 7.2 Hz, 2H), 1.08 (t, J = 7.1 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 34.39, 19.38. HRMS (ESI+) m/z calcd for [C₂₁H₂₇N₁₀O₁₀P₂S]⁺ [M + H]⁺ 673.110763, found 673.10951.

Characterization of 14

Off-white solid, 29% yield. ¹H NMR (800 MHz, D₂O) δ 8.66 (t, J = 8.8 Hz, 2H), 8.42 (t, J = 8.0 Hz, 1H), 8.20 (d, J = 3.7 Hz, 1H), 7.90 (d, J = 6.7 Hz, 1H), 6.26 (t, J = 5.7 Hz, 1H), 6.05 (t, J = 4.9 Hz, 1H), 5.29 (ddd, J = 12.1, 8.2, 4.3 Hz, 1H), 4.47–4.42 (m, 2H), 4.24 (dd, J = 11.8, 5.1 Hz, 1H), 4.16–4.10 (m, 1H), 4.05 (q, J = 7.3 Hz, 1H), 3.28 (td, J = 10.0, 3.5 Hz, 2H), 2.88 (q, J = 5.3 Hz, 2H). ³¹P NMR (203 MHz, D₂O) δ 19.16, −1.02. ¹³C NMR (201 MHz, D₂O) δ 215.33, 154.51, 154.19, 151.33, 150.94, 149.36, 148.89, 145.54, 142.19, 140.37, 126.83, 118.86, 118.23, 117.53, 87.29, 84.74, 84.15, 83.24, 78.29, 75.80, 72.18, 72.07, 66.26, 61.62, 35.16, 32.20, 30.13, 20.41, 15.66, 13.14. HRMS (ESI-) m/z calcd for [C₂₀H₂₃N₁₀O₁₁P₂S]⁻ [M-H]⁻ 673.074378, found 673.07474.

Characterization of 15

Off-white solid, 31% yield. ¹H NMR (800 MHz, D₂O) δ 8.65 (d, J = 5.0 Hz, 1H), 8.19 (d, J = 5.0 Hz, 1H), 7.85 (s, 1H), 6.29–6.24 (m, 1H), 5.85 (t, J = 5.9 Hz, 1H), 5.33–5.26 (m, 1H), 4.47–4.42 (m, 1H), 4.39 (dt, J = 5.5, 2.8 Hz, 1H), 4.26–4.19 (m, 1H), 4.13 (t, J = 3.0 Hz, 1H), 1.89 (d, J = 5.2 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 19.25, −1.04. ¹³C NMR (201 MHz, D₂O) δ 179.48, 158.91, 154.65, 153.71, 151.69, 151.56, 149.44, 140.18, 137.99, 118.28, 116.59, 87.24, 84.67, 84.63, 84.05, 84.02, 83.36, 78.22, 78.20, 76.09, 76.06, 72.05, 71.67, 66.25, 66.22, 42.15, 32.25, 22.03, 10.41. HRMS (ESI-) m/z calcd for [C₂₀H₂₃N₁₀O₁₂P₂S]⁻ [M-H]⁻ 689.069293, found 689.06932.

Characterization of 16

Off-white solid, 12% yield. ¹H NMR (800 MHz, D₂O) δ 8.61 (s, 1H), 8.21 (s, 1H), 8.18 (s, 1H), 6.33 (dd, J = 17.2, 3.0 Hz, 1H), 6.26 (d, J = 8.0 Hz, 1H), 5.77–5.63 (m, 1H), 5.27 (td, J = 9.1, 3.7 Hz, 1H), 5.08 (dd, J = 13.4, 6.5 Hz, 1H), 4.62 (d, J = 4.2 Hz, 1H), 4.50 (d, J = 4.7 Hz, 1H), 4.45 (s, 1H), 4.26 (dd, J = 12.1, 5.7 Hz, 1H), 4.14 (dt, J = 12.0, 2.8 Hz, 1H), 3.29 (td, J = 12.7, 6.7 Hz, 1H), 3.06 (t, J = 12.5 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.76, −1.33. ¹³C NMR (201 MHz, D₂O) δ 155.44, 152.72, 152.50, 148.62, 139.73, 124.59, 91.47, 90.51, 86.57, 86.40, 84.80, 84.26, 80.79, 78.51, 72.83, 72.08, 66.29, 57.33, 42.16, 31.27, 16.68, 10.41. HRMS (ESI-) m/z calcd for [C₂₀H₂₂FN₁₀O₁₀P₂S]⁻ [M-H]⁻ 675.070041, found 675.07062.

Characterization of 17

Off-white solid, 16% yield. ¹H NMR (800 MHz, D₂O) δ 8.19 (d, J = 4.5 Hz, 1H), 7.93 (d, J = 8.1 Hz, 2H), 6.33 (dd, J = 16.3, 3.2 Hz, 2H), 6.23 (d, J = 8.3 Hz, 1H), 5.76 (d, J = 8.1 Hz, 2H), 5.72 (t, J = 4.0 Hz, 1H), 5.66 (t, J = 4.0 Hz, 1H), 5.04 (dd, J = 13.1, 6.5 Hz, 2H), 4.52 (d, J = 4.3 Hz, 2H), 4.49 (d, J = 5.1 Hz, 2H), 4.32 (s, 2H), 4.24 (dd, J = 12.2, 6.8 Hz, 2H), 4.10–4.07 (m, 3H), 4.05 (t, J = 7.2 Hz, 2H), 3.29 (td, J = 13.1, 6.9 Hz, 3H), 3.08–3.04 (m, 3H), 1.84 (s, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.94, −1.50. ¹³C NMR (201 MHz, D₂O) δ 174.63, 165.66, 155.54, 152.76, 151.91, 148.52, 141.17, 139.77, 118.91, 102.96, 91.31, 90.34, 86.43, 86.26, 84.22, 84.01, 80.92, 76.73, 73.21, 71.68, 66.58, 61.62, 31.15, 20.41, 13.14. HRMS (ESI-) m/z calcd for [C₁₉H₂₁FN₇O₁₂P₂S]⁻ [M-H]⁻ 652.042824, found 652.04271.

Characterization of 18

Off-white solid, 23% yield. ¹H NMR (800 MHz, D₂O) δ 8.71 (s, 1H), 8.36 (s, 1H), 8.25 (s, 1H), 6.32 (d, J = 8.0 Hz, 1H), 6.21 (dd, J = 17.2, 3.1 Hz, 1H), 5.74 (dt, J = 50.9, 3.6 Hz, 1H), 5.31 (ddd, J = 11.8, 7.9, 4.1 Hz, 1H), 5.13 (dd, J = 13.0, 6.4 Hz, 1H), 4.45 (s, 2H), 4.29 (dd, J = 12.2, 7.1 Hz, 1H), 4.16 (ddd, J = 12.4, 4.9, 2.4 Hz, 1H), 3.22 (td, J = 14.0, 6.8 Hz, 1H), 3.05 (ddd, J = 14.6, 10.7, 4.3 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.78, −1.52. ¹³C NMR (201 MHz, D₂O) δ 165.75, 157.39, 154.51, 150.57, 149.90, 149.12, 144.71, 142.22, 137.39, 118.21, 113.22, 91.29, 90.33, 87.40, 87.23, 85.07, 85.04, 84.65, 84.63, 81.60, 78.62, 78.59, 73.68, 73.66, 73.60, 72.23, 72.21, 66.56, 66.53, 46.66, 31.22. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₁₀O₁₁P₂S]^2– [M]^2– 345.02911, found 345.02899.

Characterization of 19

Off-white solid, 3% yield. ¹H NMR (500 MHz, D₂O) δ 8.57 (s, 1H), 8.17 (s, 1H), 7.76 (s, 1H), 6.31–6.05 (m, 2H), 5.33 (s, 1H), 5.09 (ddd, J = 12.6, 8.3, 4.1 Hz, 1H), 4.50 (s, 1H), 4.40 (d, J = 15.0 Hz, 2H), 3.01–2.90 (m, 2H), 2.69 (dd, J = 13.9, 5.8 Hz, 1H), 1.73 (d, J = 17.4 Hz, 3H). ³¹P NMR (203 MHz, D₂O) δ 35.75, 19.83. ¹³C NMR (126 MHz, D₂O) δ 158.99, 155.32, 153.74, 152.51, 151.42, 149.39, 139.79, 137.53, 118.73, 117.63, 116.60, 84.53, 84.51, 83.92, 78.39, 76.66, 71.07, 67.00, 36.62, 31.43, 9.69, 8.59. HRMS (ESI-) m/z calcd for [C₂₁H₂₇N₁₀O₁₀P₂S]⁺ [M + H]⁺ 673.110763, found 673.10942.

Characterization of 20

Off-white solid, 15% yield. ¹H NMR (800 MHz, D₂O) δ 7.98 (s, 2H), 5.93 (s, 1H), 5.77 (s, 2H), 4.88 (d, J = 4.5 Hz, 3H), 4.57 (s, 2H), 4.34 (d, J = 11.0 Hz, 2H), 4.14 (s, 1H), 3.60 (d, J = 4.0 Hz, 1H), 3.41 (dt, J = 14.8, 7.5 Hz, 1H), 3.35 (d, J = 12.3 Hz, 1H), 3.26 (d, J = 13.3 Hz, 3H), 3.02 (s, 1H), 3.00–2.98 (m, 1H), 2.54–2.45 (m, 3H), 2.42–2.33 (m, 4H). ³¹P NMR (203 MHz, D₂O) δ 18.63, −2.05. HRMS (ESI-) m/z calcd for [C₂₂H₂₃N₉O₁₁P₂S]^2– [M]^2– 342.03382, found 342.03400.

Characterization of 21

Off-white solid, 24% yield. ¹H NMR (800 MHz, D₂O) δ 8.57–8.49 (m, 1H), 8.41–8.35 (m, 1H), 8.33–8.32 (m, 1H), 8.27–8.23 (m, 1H), 6.32 (d, J = 7.7 Hz, 1H), 6.18 (d, J = 2.4 Hz, 1H), 5.43 (s, 1H), 4.94 (s, 2H), 4.65 (s, 2H), 4.61 (d, J = 4.4 Hz, 2H), 4.43 (s, 1H), 4.26 (t, J = 10.3 Hz, 2H), 4.19 (d, J = 11.9 Hz, 2H), 4.11 (d, J = 8.5 Hz, 2H), 4.00 (d, J = 8.6 Hz, 2H), 3.35 (d, J = 13.1 Hz, 1H), 2.95 (t, J = 12.2 Hz, 1H), 1.20 (t, J = 7.5 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.47, −1.48. ¹³C NMR (201 MHz, D₂O) δ 150.42, 147.66, 145.96, 145.22, 142.43, 140.60, 119.06, 86.17, 85.06, 78.75, 77.98, 74.07, 73.65, 71.94, 66.33, 30.21, 25.91. HRMS (ESI-) m/z calcd for [C₂₂H₂₃N₉O₁₁P₂S]^2– [M]^2– 342.03382, found 342.03387.

Characterization of 22

Off-white solid, 25% yield. ¹H NMR (800 MHz, D₂O) δ 8.37 (s, 1H), 8.33 (s, 1H), 7.78 (d, J = 8.1 Hz, 2H), 6.22 (s, 1H), 6.18 (s, 2H), 5.67 (d, J = 8.1 Hz, 2H), 4.95 (s, 2H), 4.90–4.87 (m, 2H), 4.46 (d, J = 4.5 Hz, 2H), 4.31–4.28 (m, 2H), 4.25 (ddd, J = 12.3, 7.8, 1.9 Hz, 2H), 4.09 (d, J = 8.4 Hz, 2H), 4.04 (ddd, J = 12.1, 5.0, 2.0 Hz, 2H), 4.00 (d, J = 8.4 Hz, 2H), 3.40 (d, J = 13.6 Hz, 2H), 2.98 (dd, J = 13.5, 11.4 Hz, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.16, −1.49. ¹³C NMR (201 MHz, D₂O) δ 165.79, 151.88, 150.36, 147.49, 145.11, 141.18, 140.68, 119.06, 103.12, 86.26, 84.62, 84.29, 78.56, 76.70, 73.67, 71.61, 66.87, 26.06. HRMS (ESI-) m/z calcd for [C₂₀H₂₁N₇O₁₃P₂S]^2– [M]^2– 330.52021, found 330.52025.

Characterization of 23

Off-white solid, 21% yield. ¹H NMR (800 MHz, D₂O) δ 8.26 (s, 1H), 8.04 (s, 1H), 6.32 (d, J = 21.0 Hz, 1H), 6.03–5.96 (m, 1H), 5.52 (d, J = 48.1 Hz, 1H), 5.27 (s, 1H), 4.96 (s, 2H), 4.64 (d, J = 4.4 Hz, 1H), 4.60–4.50 (m, 1H), 4.39 (s, 1H), 4.18 (d, J = 11.8 Hz, 1H), 4.11 (d, J = 11.9 Hz, 1H), 3.24 (s, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.07, −0.65. ¹³C NMR (201 MHz, D₂O) δ 215.41, 159.05, 155.67, 153.87, 152.87, 152.31, 148.55, 139.86, 137.79, 118.59, 116.38, 97.76, 96.83, 86.78, 86.60, 84.22, 84.17, 83.99, 80.95, 76.78, 75.38, 71.26, 65.64, 30.21, 27.84. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₁₀O₁₁P₂S]^2– [M]^2– 345.02911, found 345.02914.

Characterization of 24

Off-white solid, 23% yield. ¹H NMR (800 MHz, D₂O) δ 8.23 (s, 1H), 8.21 (s, 1H), 8.05 (s, 1H), 6.35 (d, J = 18.1 Hz, 1H), 6.31 (d, J = 3.8 Hz, 1H), 5.06 (s, 1H), 4.54 (s, 1H), 4.18 (s, 4H), 3.39 (t, J = 13.2 Hz, 1H), 3.27 (d, J = 3.0 Hz, 3H). ³¹P NMR (203 MHz, D₂O) δ 18.44, −1.11. ¹³C NMR (201 MHz, D₂O) δ 159.04, 155.71, 154.02, 153.06, 148.67, 140.11, 138.98, 118.92, 115.48, 86.56, 84.16, 83.65, 78.65, 75.10, 63.99, 48.85, 31.86. HRMS (ESI-) m/z calcd for [C₂₀H₂₁FN₁₀O₁₁P₂S]^2– [M]^2– 345.02911, found 345.02893.

Characterization of 25

Off-white solid, 28% yield. ¹H NMR (800 MHz, D₂O) δ 8.35 (s, 1H), 8.12 (s, 1H), 8.07 (s, 1H), 6.39 (d, J = 17.0 Hz, 2H), 6.30 (d, J = 19.8 Hz, 2H), 5.67 (dd, J = 51.5, 4.7 Hz, 2H), 5.47 (dd, J = 51.2, 3.9 Hz, 2H), 5.16 (dh, J = 19.9, 4.6 Hz, 2H), 5.05–4.94 (m, 2H), 4.57 (t, J = 6.6 Hz, 1H), 4.49 (d, J = 9.5 Hz, 2H), 4.41 (d, J = 12.2 Hz, 2H), 4.09 (dd, J = 12.2, 3.5 Hz, 2H), 3.44 (dt, J = 13.6, 4.1 Hz, 2H), 3.00 (t, J = 12.3 Hz, 3H), 2.14 (s, 2H), 1.82 (s, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.22, −1.44. ¹³C NMR (201 MHz, D₂O) δ 155.42, 152.79, 152.69, 148.29, 147.78, 139.16, 118.70, 92.55, 92.08, 91.61, 91.13, 87.42, 87.25, 86.94, 86.77, 79.37, 78.93, 71.31, 69.27, 61.91, 30.08, 23.15. HRMS (ESI+) m/z calcd for [C₂₀H₂₃F₂N₁₀O₉P₂S]⁺ [M + H]⁺ 679.081353, found 679.08209.

Characterization of 26

Off-white solid, 30% yield. ¹H NMR (800 MHz, D₂O) δ 8.36 (s, 1H), 8.13 (s, 1H), 7.83 (s, 1H), 6.39 (d, J = 17.3 Hz, 1H), 6.12 (d, J = 20.5 Hz, 1H), 5.68 (dd, J = 52.1, 4.9 Hz, 1H), 5.47 (dd, J = 51.3, 4.0 Hz, 1H), 5.23 (ddd, J = 17.6, 8.6, 3.6 Hz, 1H), 5.01 (ddd, J = 18.0, 8.8, 4.4 Hz, 1H), 4.50–4.48 (m, 2H), 4.41 (d, J = 12.2 Hz, 1H), 4.09 (dd, J = 11.8, 3.3 Hz, 1H), 3.42 (dt, J = 13.6, 4.5 Hz, 2H), 3.01 (t, J = 12.0 Hz, 2H), 1.88 (s, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.93, −1.41. ¹³C NMR (201 MHz, D₂O) δ 158.75, 155.13, 155.08, 153.69, 152.73, 151.72, 151.09, 147.85, 140.03, 138.95, 118.85, 118.79, 116.32, 93.11, 92.26, 87.80, 87.62, 86.61, 79.13, 78.42, 69.58, 61.99. HRMS (ESI+) m/z calcd for [C₂₀H₂₃F₂N₁₀O₁₀P₂S]⁺ [M + H]⁺ 695.076268, found 695.07602.

Characterization of 27

Off-white solid, 31% yield. ¹H NMR (800 MHz, D₂O) δ 8.23 (s, 1H), 8.12 (s, 1H), 7.99 (s, 1H), 6.33 (d, J = 19.7 Hz, 1H), 6.22 (d, J = 18.8 Hz, 1H), 5.65 (dd, J = 51.5, 4.7 Hz, 1H), 5.48 (dd, J = 51.5, 4.1 Hz, 1H), 5.18–5.09 (m, 1H), 5.07 (ddd, J = 21.2, 10.2, 5.9 Hz, 1H), 4.56 (t, J = 6.6 Hz, 1H), 4.40 (d, J = 9.5 Hz, 1H), 4.35 (d, J = 12.2 Hz, 1H), 4.08–4.03 (m, 1H), 3.46–3.39 (m, 1H), 3.01 (t, J = 12.3 Hz, 1H), 2.22–2.01 (m, 1H), 1.86 (s, 2H). ³¹P NMR (203 MHz, D₂O) δ 18.56, −1.41. ¹³C NMR (201 MHz, D₂O) δ 215.33, 158.82, 155.18, 153.84, 152.41, 150.68, 148.43, 140.12, 137.14, 118.66, 116.36, 92.64, 92.05, 91.70, 91.11, 87.17, 87.00, 86.80, 86.62, 79.04, 78.95, 71.46, 71.39, 69.38, 69.30, 61.89, 30.17, 30.13, 22.58. HRMS (ESI+) m/z calcd for [C₂₀H₂₃F₂N₁₀O₁₀P₂S]⁺ [M + H]⁺ 695.076268, found 695.07635.

Characterization of 28

Off-white solid, 22% yield. ¹H NMR (800 MHz, D₂O) δ 8.20 (s, 1H), 8.07 (d, J = 1.9 Hz, 1H), 8.03 (s, 1H), 6.38–6.30 (m, 1H), 6.24 (d, J = 18.6 Hz, 1H), 5.75–5.63 (m, 1H), 5.46 (dd, J = 51.5, 4.0 Hz, 1H), 5.33–5.17 (m, 1H), 5.12–4.96 (m, 1H), 4.53 (t, J = 6.5 Hz, 1H), 4.41 (d, J = 9.5 Hz, 1H), 4.35 (d, J = 12.3 Hz, 1H), 4.06 (d, J = 12.2 Hz, 1H), 3.43 (dt, J = 13.6, 4.4 Hz, 1H), 3.04–2.96 (m, 1H). ¹³C NMR (201 MHz, D₂O) δ 180.04, 158.89, 158.51, 153.88, 150.75, 148.32, 146.01, 140.58, 137.10, 124.03, 116.36, 92.67, 92.15, 91.73, 91.20, 87.37, 87.19, 87.06, 86.89, 78.96, 71.32, 69.33, 61.84, 30.11. HRMS (ESI+) m/z calcd for [C₂₀H₂₂F₂N₉O₁₁P₂S]⁺ [M + H]⁺ 696.060285, found 696.06024.

Characterization of 29

Off-white solid, 24% yield. ¹H NMR (800 MHz, D₂O) δ 8.40 (d, J = 4.1 Hz, 1H), 8.20 (d, J = 4.1 Hz, 1H), 8.17 (d, J = 4.2 Hz, 1H), 8.02 (d, J = 4.4 Hz, 1H), 6.43 (dd, J = 17.0, 4.0 Hz, 2H), 6.33 (dd, J = 20.6, 4.2 Hz, 2H), 5.69 (dd, J = 51.7, 5.3 Hz, 2H), 5.44 (dd, J = 51.4, 4.5 Hz, 2H), 5.26 (ddd, J = 18.7, 11.8, 6.3 Hz, 2H), 5.02 (dd, J = 20.3, 11.2 Hz, 2H), 4.54 (t, J = 6.6 Hz, 1H), 4.49 (d, J = 9.4 Hz, 1H), 4.41 (d, J = 12.3 Hz, 2H), 4.12–4.04 (m, 2H), 3.47–3.36 (m, 2H), 3.03–2.96 (m, 2H). ¹³C NMR (201 MHz, D₂O) δ 181.32, 158.49, 155.55, 152.77, 148.27, 147.98, 145.93, 140.51, 139.21, 124.00, 118.80, 92.65, 92.14, 91.71, 91.20, 87.39, 87.22, 87.06, 79.20, 78.97, 71.37, 69.15, 61.89, 30.07, 23.10. HRMS (ESI+) m/z calcd for [C₂₀H₂₂F₂N₉O₁₀P₂S]⁺ [M + H]⁺ 680.06537, found 680.0654.

Characterization of 30

Off-white solid, 34% yield. ¹H NMR (800 MHz, D₂O) δ 8.32 (s, 1H), 8.14 (s, 1H), 7.86 (s, 1H), 6.42 (d, J = 17.8 Hz, 1H), 6.14 (d, J = 21.0 Hz, 1H), 5.67 (d, J = 52.2 Hz, 1H), 5.50 (d, J = 51.6 Hz, 1H), 5.22 (dd, J = 16.5, 8.4 Hz, 1H), 5.11–5.01 (m, 1H), 4.51–4.44 (m, 2H), 4.38 (d, J = 12.4 Hz, 1H), 4.08 (d, J = 12.4 Hz, 1H), 3.44–3.35 (m, 1H), 3.01 (t, J = 12.1 Hz, 1H). ¹³C NMR (201 MHz, D₂O) δ 180.15, 158.91, 158.52, 153.70, 151.27, 147.86, 146.12, 139.43, 138.24, 124.04, 116.35, 92.84, 91.90, 91.80, 90.86, 87.54, 87.37, 86.89, 86.71, 79.22, 78.59, 71.53, 69.16, 69.08, 61.84. HRMS (ESI+) m/z calcd for [C₂₀H₂₂F₂N₉O₁₁P₂S]⁺ [M + H]⁺ 696.060285, found 696.06054.

Characterization of 31

Off-white solid, 22% yield. ¹H NMR (800 MHz, D₂O) δ 8.34 (s, 1H), 8.24 (s, 1H), 8.15 (s, 1H), 8.12 (s, 1H), 6.44 (d, J = 18.0 Hz, 1H), 6.38–6.30 (m, 1H), 5.65 (dd, J = 51.5, 4.7 Hz, 1H), 5.51 (dd, J = 51.3, 4.0 Hz, 1H), 5.11 (dddd, J = 40.7, 21.9, 8.3, 4.3 Hz, 2H), 4.56 (t, J = 6.4 Hz, 1H), 4.46 (d, J = 9.6 Hz, 1H), 4.38 (d, J = 12.2 Hz, 1H), 4.11–4.04 (m, 1H), 3.45–3.39 (m, 1H), 3.01 (t, J = 12.3 Hz, 1H). ¹³C NMR (201 MHz, D₂O) δ 158.55, 152.91, 148.57, 147.87, 146.10, 140.00, 139.44, 118.68, 92.80, 92.06, 91.86, 91.11, 87.56, 87.39, 86.65, 86.47, 79.26, 78.88, 61.85. HRMS (ESI+) m/z calcd for [C₂₀H₂₂F₂N₉O₁₀P₂S]⁺ [M + H]⁺ 680.06537, found 680.06515.

Characterization of 32

Off-white solid, 35% yield. ¹H NMR (800 MHz, D₂O) δ 7.99 (s, 1H), 7.86 (s, 1H), 6.22 (d, J = 18.9 Hz, 1H), 6.14 (dd, J = 21.1, 1.9 Hz, 1H), 5.75–5.58 (m, 1H), 5.49 (dd, J = 51.8, 4.1 Hz, 1H), 5.23 (ddd, J = 17.6, 13.3, 8.3 Hz, 1H), 5.05 (dtd, J = 22.5, 8.9, 4.0 Hz, 1H), 4.49 (d, J = 6.8 Hz, 2H), 4.40 (d, J = 9.5 Hz, 2H), 4.35 (d, J = 12.3 Hz, 2H), 4.08–4.02 (m, 2H), 3.40 (dt, J = 13.6, 4.6 Hz, 2H), 3.04–3.00 (m, 2H). ³¹P NMR (203 MHz, D₂O) δ 19.07, −1.30. ¹³C NMR (201 MHz, D₂O) δ 179.58, 158.93, 158.91, 153.93, 153.75, 151.30, 150.79, 138.30, 137.21, 116.42, 116.39, 92.73, 91.88, 91.79, 90.94, 87.20, 87.03, 86.86, 79.10, 79.05, 78.99, 78.69, 78.65, 78.60, 71.60, 71.57, 71.52, 71.50, 69.40, 69.37, 69.32, 69.29, 61.94, 61.92, 42.23. HRMS (ESI-) m/z calcd for [C₂₀H₂₀F₂N₁₀O₁₁P₂S]^2– [M]^2– 354.02440, found 354.02432.

Characterization of 33

Off-white solid, 31% yield. ¹H NMR (800 MHz, D₂O) δ 7.88 (s, 1H), 7.85 (s, 1H), 6.20 (d, J = 20.6 Hz, 1H), 5.91 (s, 1H), 5.35–5.26 (m, 1H), 4.96 (d, J = 8.0 Hz, 1H), 4.35 (d, J = 9.8 Hz, 2H), 4.26 (d, J = 12.2 Hz, 1H), 4.07 (d, J = 8.5 Hz, 1H), 4.06–4.03 (m, 1H), 3.97 (d, J = 8.4 Hz, 1H), 3.33 (d, J = 13.2 Hz, 1H), 3.01 (dd, J = 13.3, 9.9 Hz, 1H). ³¹P NMR (203 MHz, D₂O) δ 18.22, −1.44. ¹³C NMR (201 MHz, D₂O) δ 158.98, 153.83, 153.67, 150.94, 138.13, 136.25, 116.49, 116.37, 92.62, 91.69, 87.40, 87.22, 85.98, 85.27, 79.03, 78.89, 78.83, 73.77, 73.45, 69.73, 69.65, 61.89. HRMS (ESI-) m/z calcd for [C₂₁H₂₁FN₁₀O₁₂P₂S]^2– [M]^2– 359.02657, found 359.02647.

Glossary

Abbreviations

CDNs

Cyclic dinucleotides

TME

Tumor Microenvironments

PDE

Phosphodiesterase

SAR

Structure–Activity Relationship Exploration

STING

Stimulator of Interferon Genes

DAMPs

Damage-Associated Molecular Patterns

PAMPs

Pathogen-Associated Molecular Patterns

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsbiomedchemau.5c00070.

• Synthetic schemes, ¹H/¹³C NMR spectra of new synthetic compounds, HPLC traces of key compounds, and biological evaluations are provided (PDF)

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. CRediT: Simpa K. Yeboah investigation, writing - original draft; Sagarika Meher formal analysis, writing - original draft; Haley Anne Harper investigation; Carli Jacole McMahan investigation; Bennett D Elzey supervision, writing - review & editing; Herman O. Sintim conceptualization, project administration, supervision, writing - review & editing.

The authors declare no competing financial interest.

Published as part of ACS Bio & Med Chem Au special issue “Juneteenth 2025”.