Mitochondrial calcium uniporter promotes MSU crystal-induced inflammation through inducing mitochondrial Ca²⁺ overload and ubiquitination of SIRT5 protein

Abstract

Background

The mitochondrial calcium uniporter (MCU) is the key channel regulating mitochondrial calcium (Ca²⁺) uptake. Growing evidence indicates that mitochondrial Ca²⁺ homeostasis plays a pivotal role in regulating immune cell function. However, how MCU contributes to MSU crystal-driven inflammation and its molecular mechanisms are unclear.

Methods

Using bone marrow-derived macrophages (BMDMs), wild-type (WT, MCU⁺/⁺), and MCU knockout (MCU⁻/⁻) mice, we investigated the role of MCU in MSU crystal-induced inflammation. Co-immunoprecipitation assays were employed to examine interactions among MCU, SIRT5, and TRIM21.

Results

MSU crystals stimulation up-regulated MCU expression and triggered mitochondrial Ca²⁺ overload in macrophages. MCU deficiency reduced mitochondrial Ca²⁺ accumulation, ameliorated mitochondrial dysfunction, and suppressed NLRP3 inflammasome activation in BMDMs treated with MSU crystals. Mechanistically, MCU promoted TRIM21 expression, leading to SIRT5 ubiquitination and degradation. Furthermore, MCU facilitated the interaction between TRIM21 and SIRT5, with MSU crystals enhancing this tripartite association. TRIM21 and SIRT5 were identified as key downstream effectors of MCU, mediating MSU crystal-induced inflammatory responses and oxidative stress. In vivo, MCU deficient mice exhibited diminished immune cell infiltration and IL-1β production in MSU crystal-induced peritonitis and arthritis models.

Conclusion

Our findings demonstrate that MCU drives mitochondrial Ca²⁺ overload in MSU crystal-induced inflammation and promotes SIRT5 degradation via the TRIM21-SIRT5 signaling axis. These insights highlight MCU as a potential therapeutic target in gouty inflammation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13075-025-03627-3.

Background

Gout pathogenesis is initiated by hyperuricemia-driven monosodium urate (MSU) crystal deposition in articular structures, which triggers NLRP3 inflammasome activation and subsequent innate immune responses [1]. Global epidemiological studies indicate a 1–4% prevalence of gout, with an incidence rate of 0.1%-0.3%. Globally, the prevalence of gout is sharply rising concurrently [2, 3]. Epidemiological studies indicate that gout frequently coexists with hypertension, diabetes, and nephropathy, which increases mortality and places a significant financial burden on the condition [4]. Therefore, it has been an important topic to recognize the molecular mechanism of gout and effective prevention strategies.

Loss of mitochondrial Ca²⁺ homeostasis is a key pathogenic driver of mitochondrial dysfunction. Mitochondrial Ca²⁺ uptake relies on MCU complex. MCU co-operates with other regulatory proteins (EMRE, MCUb, MICU1, MICU2, and others) to perform the fine-tuned and highly complex process of transporting Ca²⁺ into mitochondria. Both MICU1 and MICU2 are regulatory proteins that possess Ca²⁺-sensitive EF hand-binding structural domains that sense extra-mitochondrial levels of Ca²⁺ and open only when levels of Ca²⁺ exceed a threshold [5]. EMRE is another regulatory protein that helps MCU function. It serves as a link between MICU1 and MCU [6]. This complex, which is located in the inner membrane of mitochondria and has a major regulatory function in Ca²⁺ homeostasis, is centered on MCU [6–9]. In order to control channel function, MCU can sense the cytoplasmic Ca²⁺ level and accomplish its conformational change [10]. Emerging evidence demonstrates that MCU positively regulates NLRP3 inflammasome activation upon bacterial infection [11, 12] or complement membrane attack complex (MAC) stimulation [13]. MCU promotes NLRP3 inflammasome activation through an ESCRT-mediated phagolysosomal repair mechanism that is strictly dependent on phagocytosis [14].

The development and pathophysiology of gout are closely related to the activation of the NLRP3 inflammasome [15]. Substantial evidence indicates that therapeutic strategies targeting NLRP3, either through NLRP3 knockdown or NLRP3 inflammasome activation blockade, successfully ameliorate MSU crystal-induced inflammation in macrophages [16, 17]. In particular, research has exhibited that people with hyperuricemia express NLRP3 at higher levels than healthy controls in the peripheral blood mononuclear cells (PBMCs) [18]. The formation of IL-1β is closely related to NLRP3 inflammasome activation, which activates the pro-Caspase-1 precursor, resulting in the production of activated Caspase-1. It then leads to the maturation and release of IL-1β, which is involved in the inflammatory response in gout flare [19].

Other triggering stimuli are also required for NLRP3 inflammasome activation in addition to MSU crystals; two such examples found through experimental systems are free fatty acids (FAs) [20] and LPS, which serves as TLR4 agonists [21]. Elevated levels of FAs in serum are correlated with flares of acute joint inflammation in gout patients [22, 23]. Previous studies have demonstrated that FAs treatment significantly enhances IL-1β secretion by murine macrophages and human peripheral blood mononuclear cells (PBMCs) upon MSU crystals stimulation [20]. Furthermore, it has been established that MSU crystals and FAs act synergistically to promote inflammatory signaling pathways, amplifying the overall inflammatory response [24]. In this study, macrophages were co-stimulated with FAs and MSU crystals.

Given the well-established role of MSU crystals in triggering pro-inflammatory responses and their association with oxidative stress, we hypothesize that mitochondrial Ca²⁺ signaling may contribute to MSU crystal-induced inflammation. This hypothesis is based on the crucial function of mitochondrial Ca²⁺ in regulating mitochondrial mtROS generation. In the present study, we specifically investigate: (1) the functional involvement of MCU in MSU crystal-induced mitochondrial dysfunction, and (2) the underlying molecular pathways connecting MCU mediated Ca2 + signaling to inflammatory responses.

Methods and materials

Preparation of fatty acids (FAs, palmitic acid and stearic acid)

The preparation of palmitic acid and stearic acid was conducted through the methods previously mentioned [24]. The Supplemental File provided the specific process.

Mouse bone marrow-derived macrophages (BMDMs) isolation, MSU crystals preparation and treatment

Cells were separated from mouse bone marrow and subsequently cultivated in DMEM medium containing M-CSF (with 10% FBS) for 5 days for BMDM differentiation. On day 6, the cells were re-seeded and used for subsequent experiments. The MSU crystals were prepared in accordance with the earlier instructions [25]. Ru360 (557440; Sigma-Aldrich, MO, USA) at 10 µM was used to treat BMDMs for 1 h, and followed by stimulation with 50 µM FAs and 100 µg/ml MSU crystals for 12 h. The Supplementary File included a comprehensive process for forming MSU crystals.

Cell transfection

The pcDNA3.1(+)-mTrim21-Myc, pcDNA3.1(+)-mSirt5-Flag, pcDNA3.1(+)-Ub-HA and pcDNA3.1(+)-mMCU-HA plasmids were derived from the Public Protein/Plasmid Library (China). Following the manufacturer’s instructions, the plasmid transfection was carried out through Lipo8000 kits (C0533, Beyotime Biotechnology, China). The siRNA was ordered from Sanggon Biotech and the sequence was supplied in the Table 1. The siRNA transfection was used LipoRNAi™ (C0535, Beyotime Biotechnology, China) in accordance with the manufacturer’s instructions. In our study, after BMDMs were transfected with plasmids or siRNA for 36 h, then treated with MSUc + FAs for 12 h, and collected the cells for subsequent corresponding experiments.

Table 1.

The sequences of siRNA

Gene	Sense(5’-3’)	Anti-sense (5’-3’)
Mice MCU	UGAUGACGUGACGGUGGUUUATT	UAAACCACCGUCACGUCAUCATT
Mice Trim21	GCCCAAUAGACAUAUAGCCAATT	UUGGCUAUAUGUCUAUUGGGCTT

Measurement of mitochondrial Ca²⁺levels

The mitochondrial Ca²⁺ levels were examined by Rhod-2 AM (R1245MP, Thermo Fisher) probe. Supplementary File presented the detailed procedure.

Evaluation of Mitochondrial ROS, intracellular ROS level, mitochondrial membrane potential (MMP), mitochondrial permeability transition pore (MPTP) opening and mitochondrial morphology

MitoSOX (M36008, Invitrogen), DCFH-DA (S0035S, Beyotime Biotechnology, China), mitochondrial membrane potential assay kit with JC-1 (C2006, Beyotime Biotechnology, China), MPTP Assay Kit (C2009S, Beyotime Biotechnology, China) and MitoTracker Green probe (C1048, Beyotime Biotechnology, China) were respectively used to assess mitochondrial ROS, intracellular ROS, MMP, MPTP opening as well as mitochondrial morphology. Detailed procedure was given in the Supplementary File.

Measurement of total mtDNA, cytosolic mtDNA and oxidized-mtDNA

The detailed procedure was presented in the Supplementary File.

Immunofluorescence assay of MCU

The detailed procedure of immunofluorescence assay was available in the Supplementary File.

The observation of mitochondrial ultra-structure through transmission electron microscopy (TEM)

The cells were treated as described above, collected and then fixed with 1.25% glutaraldehyde/0.1 M phosphate buffer (BL911A; Biosharp, China) in order to analyze mitochondrial structure damage. The mitochondrial ultra-structure was examined using transmission electron microscopy (JEM-400 Plus, JEOL, Tokyo, Japan).

Determination of mitochondrial respiration

Mitochondrial respiration was assessed using a Seahorse XF24 analyzer (Agilent) following the manufacturer protocol. Detailed procedure was given in the Supplementary File.

Determination of antioxidant enzyme activity

For analysis of antioxidant enzyme activities, SOD (Superoxide Dismutase, S0101S, Beyotime Biotechnology, China) and CAT (Catalase Assay Kit, S0051, Beyotime Biotechnology, China) as well as GSH/GSSG ratio (GSH/GSSG Ratio Assay Kit, ab205811, Abcam) were assayed following the manufacturer’s instructions.

DIA proteomics and bioinformatics analysis

Through the data independent acquisition (DIA) proteomics analysis, MCU^−/− and MCU^+/+ mice derived BMDMs were treated with 100 µg/ml MSUc and 50µM FAs (n = 3 for each group). This process was implemented at Shanghai Applied Protein Technology Co. Details of the DIA proteomics and bio-informatics analyses were given in the Supplementary File.

ELISA assay

Mice peritoneal fluid and BMDMs culture supernatants were collected to assess IL-1β production using ELISA (NEOBIOSCIENCE, China).

ATP analysis

As according to the manufacturer’s instructions, ATP production was identified utilizing the Enhanced ATP assay kit (S0027, Beyotime Biotechnology, China, ).

Western blot analysis and Immunoprecipitation (IP) assay

There was a complete protocol for the IP assay and Western blot analysis in the Supplementary File. The information of antibodies was available in the Table 2.

Table 2.

All the antibodies were used in this study

Antibodies	Source	Identifier
Recombinant Rabbit Anti-TUBULIN	HUABIO	Cat#ET1602-4
Recombinant Rabbit Anti-VINCULIN	HUABIO	Cat#ET1705-94
Recombinant Rabbit Anti-GAPDH	HUABIO	Cat#ET1601-4
Rabbit monoclonal CMPK2	ImmunoWay	Cat#YT6811
Rabbit monoclonal P-AMPK	CST	Cat#T172(40H9)
Rabbit monoclonal AMPKα	HUABIO	Cat#ET1608-40
Rabbit monoclonal p-Drp1	CST	Cat#S616
Rabbit monoclonal Anti-Drp1	HUABIO	Cat#HA500487
Rabbit monoclonal NF-κB(p-P65)	CST	Cat#S536
Rabbit monoclonal Anti-P65	HUABIO	Cat#ET1603-12
Rabbit monoclonal p-STAT1	HUABIO	Cat#ET1611-20
Rabbit monoclonal STAT1	HUABIO	Cat#ET1606-39
Rabbit monoclonal p-STAT6	HUABIO	Cat#HA722776
Rabbit polyclonal NLRP3	HUABIO	Cat#ER1706-72
Mouse monoclonal IL-Iβ	CST	Cat#3A6
Mouse monoclonal Caspase-1	AdipoGen	Cat#AG-20B-0042
Rabbit monoclonal COX2	HUABIO	Cat#ET1610-23
Rabbit monoclonal iNOS	Abcam	Cat#AB178945
Rabbit polyclonal CAT	HUABIO	Cat#ER40125
Rabbit monoclonal Anti-SIRT5	HUABIO	Cat#ET1701-6
Rabbit monoclonal Anti-TRIM21	HUABIO	Cat#HA721832
Rabbit monoclonal Anti-MCU	HUABIO	Cat#ER1803-57
Rabbit monoclonal Anti-CD86	HUABIO	Cat#ET1606-50
Rabbit monoclonal Anti-CD206	HUABIO	Cat#ET1702-04
Rabbit monoclonal Ubiquitin Rabbit	PTMab	Cat#PTM-1106RM
Rabbit monoclonal Ac-SOD2	Abcam	Cat#AB137037
Rabbit monoclonal Flag	AlpaVHHs	Cat#016-203-001
Rabbit monoclonal HA	AlpaVHHs	Cat#003-201-001
Rabbit monoclonal Myc	AlpaVHHs	Cat#002-203-001
Mouse monoclonal Myc	proteintech	Cat#60003-2-ig
Mouse monoclonal Flag	HUABIO	Cat#M1403-2
APC anti-mouse Ly-6G	BioLegend	Cat#127,613
Pacific Blue Anti-mouse/human CD11b	BioLegend	Cat#101,263
PE Rat Anti-Mouse F4/80	BD Biosciences	Cat#565,410
FITC Rat Anti-Mouse CD45	BD Biosciences	Cat#553,080
APC Anti-Mouse CD86	Elabscience	Cat#E-AB-F0994E
FITC Anti-Mouse CD206	Elabscience	Cat#E-AB-F1135C
Rabbit monoclonal CD68	Abcam	Cat#AB283654
Rabbit monoclonal Ly6G	Abcam	Cat#AB238132
Rabbit monoclonal MPO	Abcam	Cat#AB208670

Quantitative PCR (qPCR)

The extraction of total RNA was implemented with the application of RNA simple Total RNA Kit (TIANGEN, China, DP419). The synthesis of cDNA from total RNA using a reverse transcriptase kit (TIANGEN, China, KR103). The detection of qPCR was performed with SYBR Green premix (TIANGEN, China, FP209) and real-time PCR system (Applied Biosystems), respectively. GAPDH was provided as an internal control gene. For all primers, the sequences are available in the Table 3.

Table 3.

The sequences of primer for PCR amplification

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
Mice D-loop	AATCTACCATCCTCCGTGAAACC	TCAGTTTAGCTACCCCCAAGTTTAA
Mice 18 S	TAGAGGGACAAGTGGCGTTC	CGCTGAGCCAGTCAGTGT
Mice Tert	CTAGCTCATGTGTCAAGACCCTCTT	GCCAGCACGTTTCTCTCGTT
Mice Cox	GCCCCAGATATAGCATTCCC	GTTCATCCTGTTCCTGCTCC
Mice Non-Numt	CTAGAAACCCCGAAACCAAA	CCAGCTATCACCAAGCTCGT
Mice B2m	ATGGGAAGCCGAACATACTG	CAGTCTCAGTGGG GGTGAAT
Mice Sirt5	TCCCCACAAAGCAAGATCTG	CGTTCGCAAAACACTTCCG

Mice and modeling

MCU knock-out and wild-type (C57BL/6Smoc-Mcuem1Smoc, NM-KO-2114415) mice were ordered from Shanghai Model Organisms (China). Experiments on animals were implemented as per protocols granted by the Animal Committee of North Sichuan Medical College. The detailed protocol for MSU crystal-induced arthritis and peritonitis models, histological hematoxylin-eosin (HE) and immunofluorescence staining were supplied in the Supplementary File. The information of antibodies is available in the Table 2.

Statistical analysis

All the data were presented as the mean ± SD. One-way ANOVA was exploited for the statistical analysis. GraphPad Prism software (Version 6.0) was employed for the calculation of the statistical analyses. To conduct analyses between both groups, the Student’s t-test was employed. Tukey’s post hoc test was employed after one-way ANOVA for comparisons involving exceed two groups. The following groups were exhibited by the symbols in the graphs as being considerably different: *P < 0.05; **P < 0.01, **P < 0.001.

Results

MSU crystals up-regulate MCU expression and induce mitochondrial Ca²⁺ overload

To investigate the effects of FAs or MSU crystals on MCU expression, we performed Western blotting and immunofluorescence assays. Co-treatment of macrophages with MSU crystals and FAs significantly up-regulates MCU protein levels compared to treatment with MSU crystals or FAs alone (Fig. 1a and b). Given the established role of MCU in mitochondrial Ca²⁺ uptake, we assessed whether MSU crystal-induced MCU up-regulation contributes to mitochondrial Ca²⁺ overload. Using Rhod-2 AM, a mitochondrial Ca²⁺-sensitive fluorescent probe, we observed a substantial increase in mitochondrial Ca²⁺ levels following MSU crystals exposure (Fig. 1c and d). Strikingly, MCU knockdown markedly attenuated this Ca²⁺ overload (Fig. 1c and d). Consistent with these findings, pharmacological inhibition of MCU with Ru360 similarly suppressed MSU crystal-induced mitochondrial Ca²⁺ accumulation (Fig. 1e).

Fig. 1.

MSU crystal stimulates MCU expression and MCU knockdown decreases mitochondrial Ca^2 + levels in BMDMs treated with FAs + MSU_C. (a) Representative LCM imaging of BMDMs co-stained with Mito-Tracker Red probe and MCU immunofluorescence, Hoechst33342 stains nuclei. Scale bar, 20 μm (Left). MCU fluorescence intensity (Right). (b) Western blotting analysis to measure the expression levels of MCU. (c) Representative fluorescence images of BMDMs co-stained with Mito-Tracker Green and Rhod-2 fluorescent probe, Hoechst33342 stains nuclei. Scale bar, 20 μm (Left). Rhod-2 fluorescence intensity (Right). (d) and (e) The mitochondrial Ca²⁺ levels was detected by flow cytometry after BMDMs staining with Rhod-2 fluorescent probe

MCU knockdown preserves mitochondrial structure and dynamics

Previous studies indicate that MSU crystal disrupt mitochondrial dynamics, promoting excessive fission and fragmentation. To determine whether MCU knockdown confers protection against mitochondrial structure damage, we quantified mitochondrial aspect ratio (AR)-a morphological indicator of mitochondrial elongation versus fragmentation. MitoTracker green FM and laser confocal microscopy (LCM) revealed that MCU knockdown ameliorated MSU crystal-induced mitochondrial fragmentation (Fig. 2a). Transmission electron microscopy (TEM) further confirmed that MSU crystals challenge induced severe ultra-structural damage, including cristae breakdown and reduced mitochondrial AR, whereas MCU knockdown preserved mitochondrial integrity (Fig. 2b). Mechanistically, MCU inhibition has been reported to suppress Drp1-dependent mitochondrial fission [26]. Since AMPK serves as a key upstream regulator of mitochondrial homeostasis [27], and Drp1 phosphorylation at Ser616 (p-Drp1) is critical for mitochondrial fission [28], we examined these signaling molecules. MCU knockdown enhanced AMPK phosphorylation (p-AMPK) while reducing p-Drp1(Fig. 2c), suggesting a shift toward mitochondrial fusion.

Fig. 2.

MCU knockdown improves mitochondrial fragmentation, meanwhile decreases mtDNA levels, cytosolic mtDNA and cytosolic Ox-mtDNA release. (a) Representative LCM imaging of Mito-Tracker green probe staining in live BMDMs, Hoechst33342 stains nuclei. Scale bar, 40 μm (Left). Aspect ratio analysis (Right). (b) Representative TEM images of mitochondrial (white box) ultrastructure in BMDMs (Left). Scale bar: 1 μm. Image is representative of 10 images/sample; n = 3 samples/condition. Aspect ratio analysis (Right). (c) Western blotting analysis to detect p-Drp1 and p-AMPK protein levels. (d) FCM was used to detect mitochondrial permeability transition pore (MPTP) opening using Calcein AM probe. (e) Total mitochondrial DNA levels were detected by quantitative PCR (qPCR). (f) Evaluation of cytoplasmic mitochondrial DNA (mtDNA) by qPCR. (g) Detection of cytoplasmic oxidized mtDNA by ELISA assay. (h) Western blotting was used to assess CMPK2 protein levels

MCU knockdown attenuates MPTP opening and mtDNA release

Given that MCU mediated mitochondrial Ca²⁺ uptake triggers mitochondrial permeability transition pore (MPTP) opening in inflammatory contexts [29]. We assessed MPTP status using calcein-AM probe. MCU knockdown inhibited MPTP opening (Fig. 2d), concomitant with reduced mitochondrial DNA (mtDNA) levels (Fig. 2e), cytosolic mtDNA leakage (Fig. 2f), and oxidized mtDNA (Ox-mtDNA) release (Fig. 2g). Furthermore, since cytidine/uridine monophosphate kinase 2 (CMPK2) regulates mtDNA synthesis [30], we evaluated its expression. MCU mediates MSU crystal-induced CMPK2 up-regulation, as MCU knockdown blunts this response (Fig. 2h), implicating MCU in mtDNA biogenesis control.

MCU knockdown rescues MSU crystal-induced mitochondrial dysfunction by attenuating Ca²⁺ overload

Persistent mitochondrial Ca²⁺ overload is a critical mediator of mitochondrial dysfunction, to assess the impact of MCU knockdown on mitochondrial function during MSU crystals challenge, we evaluated key mitochondrial parameters. Given that Mitochondrial Ca²⁺ overload exacerbates reactive oxygen species (ROS) production, we explored whether MCU knockdown modulates intracellular ROS (measured by DCFH-DAprobe) and mitochondrial ROS (MitoSOX probe). We noticed that MCU knockdown effectively blunted the MSU crystal-induced increase in both ROS and mitochondrial ROS levels (Fig. 3a and c). Since mitochondrial ROS generation is closely linked to mitochondrial membrane potential (MMP) collapse, we quantified MMP using the JC-1 probe. MSU cystals treatment reduced MMP, as evidenced by a decreased red/green fluorescence ratio (Fig. 3d). MCU knockdown restored MMP, indicated by a significant increase in the red/green fluorescence ratio (Fig. 3d). Conversely, MCU over-expression in macrophages exacerbated MSU crystal-induced mitochondrial dysfunction, manifested as elevated intracellular ROS, mitochondrial ROS and MMP depolarization (Sup Fig. 1a-1c). Consistent with ROS generation and MMP recovery, MCU knockdown enhanced ATP production in BMDMs treated with MSU crystals (Fig. 3e), underscoring its involvement in mitochondrial energy metabolism.

Fig. 3.

MCU knockdown attenuates oxidative stress induced by MSU crystals. (a) and (b) FCM was used to analysis intracellular total ROS and mitochondrial ROS generation. NC siRNA group: NC siRNA⁺ vehicle, MCU siRNA group: MCU siRNA + vehicle, NC siRNA + group: NC siRNA + FAs + MSUc, MCU siRNA + group: MCU siRNA + FAs + MSUc. (c) Representative LCM imaging of BMDMs co-stained with Mito-Tracker Green and MitoSOX probe, Hoechst33342 stains nuclei. Scale bar, 40 μm (Left). MitoSOX fluorescence intensity (Right). (d) FCM was used to measure mitochondrial membrane potential (JC-1 probe). (e) ATP levels (f) Western blotting was used to detect Ac-SOD2 and CAT protein levels. (g) Evaluation of the activities of antioxidant enzymes catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px)

We further assayed the impacts of MCU knockdown on the antioxidant defense system. MSU crystals challenge impaired antioxidant capacity. MCU knockdown enhanced CAT protein expression, while reduced SOD2 acetylation (Ac-SOD2), which inversely correlates with SOD2 activity (Fig. 3f ). More importantly, MCU knockdown restored endogenous antioxidant enzyme activities, including superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and CAT (Fig. 3g). Collectively, these findings demonstrate that MCU knockdown mitigates MSU crystal-induced oxidative stress and mitochondrial damage, preserving redox homeostasis and metabolic function.

MCU deficiency suppresses NLRP3 inflammasome activation and promotes M2 macrophage polarization

The acute inflammatory response associated with gout is primarily mediated by NLRP3 inflammasome activation. To explore the role of MCU in this process, we examined the effects of MCU deficiency on NLRP3 inflammasome activation and pro-IL-1β processing. While MCU deficiency had minimal impact on the protein levels of pro-Caspase1 and pro-IL-1β, it greatly reduced NLRP3 expression (Fig. 4a and Sup Fig. 2a). Importantly, MCU deficiency impaired Caspase1 activation (as indicated by reduced Casp1 p20 cleavage) and maturation of IL-1β (decreased IL-1β p17) in BMDMs treated with MSU crystals. In line with this data, MCU deficiency also suppressed IL-1β secretion upon MSU crystals stimulation (Fig. 4b). To further assess NLRP3 inflammasome assembly, we evaluated ASC oligomerization, a hallmark of inflammasome activation. The ASC speck formation induced by MSU crystals was reduced by MCU deficiency, consistent with its influence on Casp1 p20 and IL-1β p17 (Fig. 4c). Conversely, MCU over-expression in BMDMS treated with MSU crystals potentiated NLRP3 inflammasome activation, showing increased NLRP3 expression, Caspase1 activation, IL-1β maturation and ASC speck formation (Sup Fig. 2b-2c). Notably, neither MCU deficiency nor over-expression altered pro-Caspase1 or pro-IL-1β levels, indicating MCU specifically regulates inflammasome activation rather than precursor synthesis. Additionally, MCU deficiency mitigated the up-regulation of key inflammatory mediators, including cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS), in response to MSU crystal-induced inflammation (Fig. 4d). Conversely, MCU over-expression in macrophages significantly up-regulated both COX-2 and iNOS protein levels (Sup Fig. 2d).

Fig. 4.

MCU deficiency suppresses NLRP3 infammasome activation and decreases the ratio of M1/M2 macrophage. (a) Western blotting for IL-1β (p17), Casp1(p20), MCU, NLRP3, Pro-Casp-1 and Pro-IL-1β protein levels. (b) ELISA for detection of IL-1β level in the cell supernatants. (c) Immunofuorescence detection of ASC speck formation. DAPI stains nucleus. Scale bar: 40 μm. (d) and (e) Western blotting was used to detect iNOS, COX-2, CD86 and CD206 protein levels. (f) and (g) FCM was used to analyze the number of M1 (f) and M2 (g) macrophage in BMDMs treated with FAs + MSUc

Macrophage polarization plays a pivotal role in the pathogenesis of inflammatory diseases, and the M1/M2 macrophage ration is dynamically altered during the acute phase of gout [31]. To investigate the impact of MCU deficiency on macrophage polarization, we analyzed macrophage sub-types and their associated markers following MSU crystal stimulation. Upon MSU crystals treatment, M1 macrophages and the expression of the M1 marker CD86 were elevated, whereas M2 macrophages and the M2 marker CD206 were markedly reduced (Fig. 4e and g). Strikingly, MCU deficiency effectively reversed the MSU crystal-induced polarization shifts (Fig. 4e and g). MCU over-expression in BMDMs further promotes MSU crystal-induced macrophage polarization toward the M1 phenotype (Sup Fig. 3a-3c). Consistent with these findings, quantitative PCR data indicated that MCU deficient BMDMs exhibited substantially lower expression of M1 associated cytokines (IL-6, IL-1β, MCP-1 and TNF-a) compared to MCU^+/+ BMDMs after MSU crystal challenge (Sup Fig. 4a). Furthermore, MCU deficiency decreased the MSU crystal-induced up-regulation of phosphorylated STAT1(p-STAT1) and NF-κB phosphorylated p65 (p-p65), key regulators of M1 macrophage polarization (Sup Fig. 4b). Conversely, MSU crystals stimulation suppressed M2 associated Markers, including p-STAT6 and M2 cytokines (IL-4 and Arg1). However, these markers were highly up-regulated in MCU deficient BMDMs (Sup Fig. 4c and 4d), suggesting that MCU ablation promotes an M2-like anti-inflammatory phenotype.

MCU deficiency accelerates Sirt5 expression by disrupting TRIM21-SIRT5 signaling axis

To unravel the molecular mechanism of MCU involved in MSU crystal-induced inflammation, the MCU^+/+ and MCU^−/− mice derived BMDMs was stimulated with MSUc + FAs, following by mass spectrometry and proteomic analysis. The six samples (three replicates each group) from the MCU^−/− and MCU^+/+ groups, we identified 6781 proteins in total (Fig. 5a). 6777 of these proteins were expressed in the two sample groups (Fig. 5a). We next exploited the Student’s t-test and R programming language for quantification to further examine the 6777 proteins that were expressed in both groups. This allowed us to identify the proteins that were differently expressed for the comparison group. The fold-change of more than 1.2, t-test P-value of less than 0.05, and the existence of at least one distinct peptide segment were the criteria for screening. As a result, 339 differential proteins were found (Fig. 5b). In the MCU^−/− group, 167 proteins were substantially elevated whereas 172 proteins were considerably attenuated when comparing with the MCU^+/+ groups (Fig. 5b and c).

Fig. 5.

Proteomic analysis and Western blotting identification of Sirt5 expression up-regulated by MCU deficiency. (a) Venn diagram of the number of proteins detected by unlabeled protein profiles for MCU^+/+ and MCU^−/− group. (b) The number of proteins with high and low expression between MCU^+/+ group and MCU^−/− group. (c) Volcanic map of diferentially expressed protein MCU^+/+ and MCU^−/− group. (d) GO signaling pathway analysis of MCU^+/+ and MCU^−/− proteins. BP: Biological process, CC: Cellular component, MF: Molecular function. (e) KEGG signal analysis of MCU^+/+ and MCU^−/− proteins. (f) GSEA analysis revealed enrichment of the oxidative phosphorylation pathway. (g) Heat maps of 5 proteins significantly up-regulated in MCU^−/− group. (h) Mass spectrometry quantification of SIRT5 in MCU^+/+ and MCU^−/− group. (i) Western blotting to detect the protein level of SIRT5

These differentially expressed proteins were implicated in oxidative phosphorylation and the mitochondrial respiratory chain, according to the Gene Ontology (GO) study (Fig. 5d). KEGG bubble map analysis suggested that proteins linked to oxidative phosphorylation exhibited significant differences in the MCU knockdown group (Fig. 5e). In accordance with gene set enrichment analysis (GSEA), there is a raised oxidative phosphorylation in MCU knockdown group (Fig. 5f). In proteins that participate in the oxidative phosphorylation, 5 proteins exhibited significant differences in MCU deficient group (Fig. 5g). Interestingly, SIRT5 exhibited the most significant difference between the two groups (Fig. 5h). We further validated the high expression of SIRT5 in MCU deficient group using western blotting (Fig. 5i). Thus, these data suggest that MCU deficiency-induced high SIRT5 expression may be related to its function in MSU crystal-induced inflammation.

Extensive evidence has established that SIRT5 functions in mitochondrial oxidative stress response [32]. Among these potential MCU targets, we were particularly interested in SIRT5. Next, we sought to determine whether MCU deficiency impacts SIRT5 mRNA level. MSU crystals stimulation elicited a modest but significant reduction in Sirt5 mRNA levels, which remained unaltered by MCU deficiency (Sup Fig. 5). Previous study has demonstrated that TRIM21, a RlNG-containing E3 ubiquitinligase of the TRIM protein family, can promote ubiquitin-dependent degradation of SIRT5 [33]. We also noticed that MSU crystals challenge enhanced SIRT5 ubiquitination, whereas MCU knockdown substantially attenuated this post-translational modification under identical treatment conditions (Fig. 6a and d, Sup Fig. 6a-6d). Interestingly, TRIM21 was strongly up-regulated by MSU crystals challenge, while MCU deficiency markedly inhibited this induction at the protein level (Fig. 6e, Sup Fig. 6e). Conversely, the over-expression of MCU in BMDMs produced the reciprocal effect (Sup Fig. 7a). TRIM21 knockdown abrogated the MSU crystal-induced suppression of SIRT5 expression (Fig. 6f and Sup Fig. 7b). It was worth noting that TRIM21 over-expression exacerbated the inhibition of Sirt5 protein levels induced by MSU crystals (Sup Fig. 7c). More important, the over-expression of TRIM21 also reversed the up-regulation of SIRT5 protein in MCU deficient BMDMs treated with MSU crystals (Fig. 6g and Sup Fig. 7d).

Fig. 6.

MCU inhibits Srit5 protein levels through up-regulation of Trim21. (a) and (b) BMDMs were transiently co-transfected with Sirt5-Flag and Ub-HA, and then treated with or without FAs + MSUc, MG132 for`12 h. IP was performed with anti-Flag antibody and the ubiquitination of SIRT5 was detected using the anti-Ub through Western blotting (a). Ubiquitination of intracellular total protein was detected through Western blotting using anti-Ub (b). (c) and (d) After BMDMs were transfected with NC siRNA or MCU siRNA for 6 h, co-transfected with Sirt5-Flag and Ub-HA, and then treated with FAs + MSUc, MG132 for`12 h. IP was performed with anti-Flag antibody and the ubiquitination of SIRT5 was detected using the anti-Ub through Western blotting (c). Ubiquitination of intracellular total protein was detected through Western blotting using anti-Ub (d). (e) The effects of MCU knockout on TRIM21 protein levels were detected by Western blotting. (f) The effects of TRIM21 knockdown on the SIRT5 protein levels by Western blotting. (g) Western blotting was used to assess the SIRT5 and TRIM21 protein levels. (h) Western blotting was used to assess the effects of Ru360 treatment on SIRT5 and TRIM21 protein levels

Given that Ru360 is a potent inhibitor of MCU mediated mitochondrial Ca²⁺ uptake, we intend to investigate its effects on SIRT5 and TRIM21 protein expression in BMDMs exposed to MSU crystals.

Pharmacological inhibition of MCU mediated mitochondrial calcium uptake by Ru360 failed to significantly reverse MSU crystal-induced modulation of TRIM21 and SIRT5 protein levels (Fig. 6h and Sup Fig. 7e), suggesting that the effects of MSU crystals on TRIM21 and SIRT5 expression are not entirely dependent on MCU mediated mitochondrial calcium uptake. Extensive research has elucidated the indispensable role of SIRT5 in maintaining mitochondrial function, we employed Seahorse XF extracellular flux analysis to assessed the impact of SIRT5 over-expression on mitochondrial respiratory capacity. In BMDMs treated with MSU crystals, as displayed in Fig. 7a, SIRT5 over-expression raised mitochondrial respiratory parameters, including basal respiration, ATP-linked oxygen consumption, maximal respiratory capacity, and proton leak. Furthermore, both SIRT5 over-expression and TRIM21 knockdown attenuated mitochondrial ROS production, IL-1β secretion, and the protein expression of COX-2 and iNOS (Sup Fig. 8a-8e). As the important targets of MCU, these findings demonstrate that TRIM21 and SIRT5 modulate MSU crystal-induced the oxidative stress and inflammatory responses, suggesting their pivotal roles in this pathogenic cascade.

Fig. 7.

Sirt5 over-expression improves mitochondria respiration, and TRIM21 affect the stability the SIRT5 protein. (a) Mitochondria respiration (oxygen consumption rate, OCR) was measured using Seahorse XFe24 Analyzer. Statistical analysis of basal respiration, ATP production, maximal respiration rate and H+ proton leak (n = 5 biological replicates). (b) After BMDMs were transfected with NC siRNA or Trim21 siRNA for 36 h, then treated with CHX (20 µg/ ml) for the indicated time. The protein stability of SIRT5 was detected by western blotting. (c) After BMDMs were transfected with pcDNA3.1 or Trim21-Myc for 36 h, then treated with CHX (20 µg/ ml) for the indicated time. The protein stability of SIRT5 was detected by western blotting. (d) After BMDMs were transfected with NC siRNA or MCU siRNA for 36 h, then treated with CHX (20 µg/ ml) for the indicated time. The protein stability of SIRT5 was detected by western blotting. (e) After BMDMs were transfected with NC siRNA or MCU siRNA for 36 h, then treated without or with FAs + MSUc, HCQ (10 µg/ ml), MG132 (10 µM) for 12 h. The protein levels of TRIM21 and SIRT5 were detected by western blotting

To investigate the regulation of SIRT5 protein stability, we performed cycloheximide (CHX) chase assays. Western blot analysis revealed that the over-expression of TRIM21 significantly accelerated SIRT5 degradation rate (Fig. 7b), whereas TRIM21 knockdown slowed down SIRT5 degradation rate (Fig. 7c). Notably, MCU knockdown also stabilized SIRT5 protein in CHX chase assays, suggesting cross-talk between these pathways (Fig. 7d). Consistent with proteasomal degradation, MSU crystal-induced SIRT5 reduction in TRIM21-overexpressing BMDMs was rescued by the proteasome inhibitor MG132 (Fig. 7e), but unaffected by the autophagy inhibitor hydroxychloroquine (HCQ). Taken together, these data suggest that TRIM21 promotes proteasome dependent degradation of SIRT5 in MSU crystal-induced inflammation.

MSU crystals promote ternary complex formation of MCU-TRIM21-SIRT5

The over-expression of TRIM21 in BMDMs, Co-IP analysis suggested that TRIM21 could interact with endogenous MCU protein (Fig. 8a). Furthermore, immunofluorescence staining confirmed co-localization of exogenous TRIM21 with endogenous MCU (Fig. 8b). Through combined Co-IP and immunofluorescence assay analysis, the over-expression of MCU in BMDMs was shown to interact with and spatially co-localize with endogenous SIRT5 (Fig. 8c and d). In BMDMs co-expressing MCU with either TRIM21 or SIRT5, Co-IP assays detected specific interactions between the exogenous MCU and TRIM21/SIRT5 proteins (Fig. 8e and f). Co-localization was observed between MCU and TRIM21, as well as between MCU and SIRT5, by immunofluorescence assay (Fig. 8g and h). Considering the demonstrated interaction between TRIM21 and SIRT5, Co-IP assays revealed that simultaneous over-expression of SIRT5 and TRIM21 in BMDMs significantly enhanced their interaction upon MSU crystal stimulation (Fig. 9a). Consistently, immunofluorescence analysis indicated increased co-localization between TRIM21 and SIRT5 under the same conditions (Fig. 9b).

Fig. 8.

MCU can interact with TRIM21 and SIRT5, and the MSU crystal challenge promotes the interaction between TRIM21 and SIRT5. (a) and (b) BMDMs were transiently transfected with Trim21-Myc. IP was performed with Myc antibody, and the TRIM21 interaction with endogenous MCU detected through Western blotting using anti-MCU (a). The cells were immunostained with anti-MYC and anti-MCU antibodies. The sub-cellular localizations of TRIM21 (red), MCU (green), and nucleus marker DAPI (blue) were analyzed under confocal microscopy. The scale bar represents 20 μm (b). (c) and (d) BMDMs were transiently transfected with MCU-HA. IP was performed with HA antibody, and the MCU interaction with endogenous SIRT5 detected through Western blotting using anti-SIRT5 (c). The cells were immunostained with anti-HA and anti-SIRT5 antibodies. The sub-cellular localizations of MCU (red), SIRT5 (green), and nucleus marker DAPI (blue) were analyzed under confocal microscopy. The scale bar represents 20 μm (d). (e) and (f) BMDMs were transiently co-transfected with Trim21-Myc and MCU-HA. (e) IP was performed with MYC antibody, and the interaction between TRIM21 and SIRT5 was detected through Western blotting using anti-HA antibody. The cells were immunostained with anti-MYC and anti-HA antibodies. The sub-cellular localizations of MCU (red), TRIM21 (green), and nucleus marker DAPI (blue) were analyzed under confocal microscopy. The scale bar represents 20 μm (f). (g) and (h) BMDMs were transiently co-transfected with Sirt5-Flag and MCU-HA. IP was performed with FLAG antibody, and the interaction between SIRT5 and MCU was detected through Western blotting using anti-HA antibody (g). The cells were immunostained with anti-FLAG and anti-HA antibodies. The sub-cellular localizations of SIRT5 (red), MCU (green), and nucleus marker DAPI (blue) were analyzed under confocal microscopy. The scale bar represents 20 μm (h)

Fig. 9.

MCU knockdown inhibits the interaction between TRIM21 and SIRT5, and MSU crystals challenges accelerates the complex of TRIM21, SIRT5 and MCU. (a) and (b) After BMDMs were transiently co-transfected with Sirt5-Flag and Trim21-Myc for 36 h, then treated without or with FAs + MSUc for 12 h. IP was performed with Flag antibody, and the interaction between SIRT5 and TRIM21 was detected through Western blotting using anti-Myc antibody. The relative interaction between SIRT5 and TRIM21 (MYC/Tubulin) was displayed in the right (a). The cells were immunostained with anti-Flag and anti-Myc antibodies. The sub-cellular localizations of TRIM21 (red), SIRT5 (green), and nucleus marker DAPI (blue) were analyzed under confocal microscopy. The scale bar represents 20 μm (b). (c) After BMDMs were transfected with NC siRNA or MCU siRNA for 6 h, co-transfected with Sirt5-Flag and Trim21-Myc for 36 h, then treated with FAs + MSUc for 12 h, IP was performed with Flag antibody, and the interaction between SIRT5 and TRIM21 was detected through Western blotting using anti-Myc antibody. The relative interaction between TRIM21 and SIRT5 (Myc/Tubulin) was displayed in the right. (d) After BMDMs were transiently co-transfected with Sirt5-Flag and Trim21-Myc for 36 h, treated with or withou Ru360 for 1 h, then treated with FAs + MSUc for 12 h, IP was performed with Flag antibody, and the interaction between SIRT5 and TRIM21 was detected through Western blotting using anti-Myc antibody. The relative interaction between SIRT5 and TRIM21 (MYC/Tubulin) was displayed in the right. NS means no statistical difference. (e) BMDMs were transiently co-transfected with Sirt5-Flag and Trim21-Myc or MCU-HA for 36 h. IP was performed with Flag antibody, and the interaction between SIRT5 and TRIM21 was detected through Western blotting using anti-Myc antibody. The relative interaction between SIRT5 and TRIM21 (MYC/Tubulin) was displayed in the right. (f) BMDMs were transiently co-transfected with SIRT5-Flag, TRIM21-Myc and MCU-HA for 36 h, then treated without or with FAs + MSUc for12 h. IP was performed with Flag antibody, and the interaction among SIRT5, TRIM21 and MCU was detected through Western blotting using anti-Myc and anti-HA antibody. The relative interaction SIRT5 and TRIM21 (Myc/Tubulin), SIRT5 and MCU (HA/Tubulin) was displayed in the right

Based on the fact that MCU can interact with TRIM21 or SIRT5, we sought to survey the influence of MCU knockdown on the TRIM21-SIRT5 interaction. Strikingly, MCU knockdown suppressed the interaction between exogenously expressed TRIM21 and SIRT5 in BMDMs treated with MSU crystals (Fig. 9c). However, Ru360 treatment had no significant effect on the TRIM21-SIRT5 interaction (Fig. 9d). Over-expression of MCU facilitated the interaction between exogenous TRIM21 and SIRT5 in BMDMs (Fig. 9e). More importantly, simultaneous over-expression of MCU, TRIM21 and SIRT5 in BMDMs, our data indicated that ternary complex formation among these exogenous proteins (Fig. 9f). Furthermore, stimulation with MSU crystals significantly potentiated this three-way interaction (Fig. 9f). The above results imply that MCU, TRIM21 and SIRT5 may form a functional complex to mediate SIRT5 protein stability.

MCU deficiency alleviated MSU crystal- induced inflammation in vivo

Given that MCU is associated with mitochondrial dysfunction and NLRP3 inflammasome activation in vitro, we further investigated whether MCU deficiency could ameliorate peritonitis and arthritis induced by MSU crystal in mouse models. The number of macrophages, neutrophils and leukocytes in the peritoneal fluid of the mouse peritonitis model was determined through flow cytometry utilizing macrophage marker (F4/80), neutrophil marker (Ly6G) and leukocyte marker (CD45) staining for cells. As illustrated in Fig. 10a and c, in contrast to MCU^+/+ mice with MSU crystals injection, lower numbers of leukocytes, neutrophils, and macrophages were detected in the peritoneal lavage fluid of MCU^−/− mice injected with MSU crystals, along with decreased secretion of IL-1β (Sup Fig. 9a). We also examined the impacts of MCU deficiency on the inflammatory cell infiltration and paw swelling induced by MSU crystal in mouse arthritis model. In comparison with MCU^+/+ mice injected with MSU crystals, we found a lower paw swelling index in MCU^−/− mice injected with MSU crystals (Sup Fig. 9b). In line with paw swelling index, H&E staining indicated a reduction in the distribution of immune cells (Sup Fig. 9c). Immunofluorescence staining revealed that MCU deficiency restricted the distribution of MPO, Ly6G, and CD68 positive cells in tissue sections of paw injected with MSU crystals (Fig. 10d). Simultaneously, MCU deficiency decreased TRIM21 protein levels, but up-regulated SIRT5 protein expression in paw tissue injected with MSU crystals (Fig. 10e).

Fig. 10.

MCU deficiency decreases the inflammatory cell infiltration, meantime affects TRIM21 and SIRT5 protein levels of paw tissue in the mice model. (a-c) Representative plots of migrated leukocytes (CD45+), neutrophils (CD11b+ Ly6G+) and macrophages (CD11b+F4/80+) in peritoneal fluid were detected by flow cytometry analysis. The number of migrated leukocytes, macrophages and neutrophils were quantified and compared among the groups on the right. n = 6 mice for each group. (d) The distribution of Ly6G, CD68 and MPO positive cells in the paw tissue sections was detected by immunofluorescence. (e) Western blotting detection of MCU, SIRT5 and TRIM21 protein levels in the paw tissue of mice model

Discussion

The NLRP3 inflammasome serves as the central molecular driver of gout flares induced by MSU crystals, with its activation being intimately coupled to mitochondrial dysfunction. Our study identifies the mitochondrial calcium uniporter (MCU) as a pivotal regulator of this process, operating through two distinct yet complementary mechanisms: its canonical role in maintaining mitochondrial Ca²⁺ homeostasis and a newly uncovered TRIM21-SIRT5 signaling axis that modulates inflammasome activity independently of Ca²⁺ flux. This dual regulatory capacity positions MCU as a key metabolic checkpoint in gout pathogenesis.

The present study demonstrated that MSU crystal challenge significantly up-regulated MCU expression. Pharmacological inhibition or genetic knockdown of MCU effectively attenuated MSU crystal-induced mitochondrial Ca²⁺ overload, which has been established as a critical regulator of multiple immune pathways. Excessive mitochondrial Ca²⁺ uptake impairs macrophage bactericidal activity during infection [34]. In the inflammatory response, blocking mitochondrial Ca²⁺ uptake suppressed the activation of NLRP3 inflammasome and subsequent pro-inflammatory cytokines production [12]. Furthermore, MCU is particularly necessary for maximum activation of the NLRP3 inflammasome through a phagocytosis pathway by inhibiting phagolysosomal membrane repair [14]. Our findings further revealed that MCU mediated mitochondrial Ca²⁺ accumulation promoted excessive mitochondrial ROS generation, which subsequently facilitated mitochondrial permeability transition pore opening and mitochondrial DNA release in response to MSU crystals. These pathological alterations collectively contribute to mitochondrial dysfunction and robust NLRP3 inflammasome activation in MSU crystal-induced inflammation. Beyond the activation of NLRP3 inflammasome, mitochondrial Ca²⁺ overload-driven ROS overproduction along with mitochondrial DNA (mtDNA) release also aggregate this process through activating various inflammatory pathways, encompassing NF-κB and STAT1 signaling pathway [35]. Consistent with this mechanism, our data also showed MCU deficiency blunted the activation of both STAT1 and NF-κB pathways, decreased downstream cytokine production, and shifted macrophage polarization from pro-inflammatory M1 to anti-inflammatory M2 phenotype.

Subsequently, our study revealed that MCU deficiency enhanced SIRT5 protein levels by promoting its stability. It has been studied that TRIM21 can interact with SIRT5 to promote its ubiquitination and proteasomal degradation [33]. Our data indicate that during MSU crystal-induced inflammation, MCU modulates the TRIM21-SIRT5 signaling axis in a manner not fully dependent on its canonical mitochondrial Ca²⁺ uptake activity. Co-IP assay detected interactions among MCU, SIRT5 and TRIM21. Interestingly, Not only could MCU promote the interaction between TRIM21 and SIRT5, but also MCU could form a complex with TRIM21 and SIRT5. Notably, MCU not only facilitated the interaction TRIM21 and SIRT5 but also formed a ternary complex with these proteins. MSU crystals challenge accelerated the formation of a complex involving the MCU, TRIM21, and SIRT5. Consequently, the role of MCU in MSU crystal-induced inflammation should not be limited to its canonical function in mitochondrial Ca²⁺ uptake but should also encompass its role as a substrate. However, the precise molecular mechanism by which MCU modulates TRIM21 expression remains to be elucidated.

As an important downstream factor mediated by MCU, extensive data has demonstrated the critical function of TRIM21 in several biological processes, including cell autophagy, carcinogenesis, and the innate immune response [36–38]. Mice with TRIM21 deficiency are protected against cardiac oxidant response damage induced by transverse aortic constriction (TAC) [39]. It has been demonstrated that TRIM21 regulates the PI3K/AKT signaling pathway, thereby modulating macrophage polarization [40]. There have been several reports that PI3K/AKT signaling pathway is closely related to inflammation and macrophage polarization in MSU crystal-induced inflammation [41–43]. As the predominant mitochondrial desuccinylase, SIRT5 is a crucial liver I/R mediator that modulates mitochondrial oxidative stress by desuccinylating PRDX3 [32]. Therefore, MCU facilitates NLRP3 inflammasome activation, oxidative stress, and macrophage polarization in MSU crystal-induced inflammation, with the TRIM21-SIRT5 signaling axis serving as a critical regulatory mechanism in this process.

Taken together, in MSU crystal-induced inflammation, MCU acts as an essential player in mitochondrial Ca²⁺ homeostasis. Importantly, MCU facilitates the TRIM21-SIRT5 interaction, thereby promoting SIRT5 protein degradation. While further investigation is required, our proof-of-concept study highlights the therapeutic potential of targeting MCU for the prevention and treatment of gouty arthritis.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Study hypothesis and design: QQY, RJL, GZY, YX, Xinyu, L, QD, MZ. Acquisition of data: QQY, YXD, Xinyu, L. Data analysis and interpretation: QQY, YXD, Xiongyan L, QD. Preparation and editing of figures: QQY, RJL, GZY, YX, Xinyu, L. Manuscript preparation and editing: QQY, Xiongyan L, QD, MZ.

Funding

This research was supported by grants (No. 81972119) from the National Natural Science Foundation of China; the Sichuan Province Science and Technology Support Project (2023ZYD0060); the Nanchong City Science and Technology Support Project (22SXQT0372); and the Scientific Project of Affiliated Hospital of North Sichuan Medical College (2023PTZK007).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval

The animal experiments were approved by the Institutional Animal Care and Use Committee of North Sichuan Medical College (NSMC 202155).

Competing interests

The authors declare no competing interests.