ABSTRACT
Duck enteritis virus (DEV) was identified as the etiological agent responsible for an outbreak of morbidity and mortality in adult ducks on a farm in Jiangsu, China. Diagnostic approaches confirmed that the outbreak was caused by the highly pathogenic DEV-JS2024 isolate. The clinical progression of the disease, characterized by lethargy, anorexia, ocular discharge, and high mortality, was accompanied by extensive hemorrhagic lesions in critical organs such as the liver, spleen, lungs, and bursa of Fabricius, consistent with known signs of DEV infection. Genomic analysis of DEV-JS2024 revealed a 45% G+C content and 76 open reading frames. BLASTn analysis revealed that the genome of DEV-JS2024 shares the highest sequence similarity with the Chinese virulent strain CV and the DEV attenuated vaccine strain C-KCE in the database. These results indicate a close genetic relationship between DEV-JS2024 and both the virulent and attenuated strains, suggesting potential similarities in their genomic architecture. Comparative genomic analysis identified 28 nucleotide mutations, including 15 non-synonymous mutations potentially related to virulence factors. The study also highlighted the first reported 528 base pairs deletion in the UL2 gene of a virulent strain, challenging its utility as a marker for distinguishing virulent from attenuated strains. Phylogenetic analysis suggested that DEV-JS2024 may result from recombination between the vaccine and virulent strains, further complicating our understanding of DEV pathogenicity. This study provides new insights into the molecular evolution of DEV and stresses the importance of continued genomic surveillance to enhance vaccine development and control measures for duck plague.
KEYWORDS: Duck enteritis virus, pathogenicity, whole genome sequencing, UL2 gene-deficient, endemic
Introduction
Duck enteritis virus (DEV), also known as duck plague virus (DPV), is a highly contagious pathogen that predominantly affects waterfowl, including ducks, geese, and swans [1,2]. The disease is notorious for its severe impact, with mortality rates reaching up to 100% and egg production in affected birds plummeting by as much as 50% [3–5]. DEV has emerged as a global threat since its first documentation in the Netherlands in 1923, infiltrating duck farms worldwide [6–8]. In China, DEV was initially detected in 1957, and the virus has since become endemic, causing significant losses to the nation’s duck farming industry due to its high morbidity and mortality rates [9]. Taxonomically, DEV is designated as Anatid herpesvirus 1, within the genus Mardivirus, subfamily Alphaherpesvirinae, and family Herpesviridae [10,11]. Infection with DEV typically induces a rapid rise in body temperature above 43°C, along with clinical signs such as lethargy, anorexia, tearful eyes, eyelid edema, and adhesion [12]. Prominent gross lesions include hepatic hemorrhages, necrotic or hemorrhagic bands at the junction of the esophagus and proventriculus, and various degrees of congestion, hemorrhage, necrosis, and detachment of the intestinal mucosa, often accompanied by the formation of button-like ulcers [13,14]. The virulence of DEV varies among isolates, with attenuated or naturally apathogenic strains serving as effective live vaccines under industrial conditions to prevent clinical manifestations of duck plague [10].
Complete genome characterization of DEV is critical for elucidating the molecular mechanisms underlying its pathogenicity and advancing diagnostic tools, therapeutics, and control strategies. The DEV genome is a double-stranded, enveloped DNA virus with icosahedral symmetry, spanning approximately 158–162 kilobase pairs and containing 76 coding genes [15,16]. Of the 76 open reading frames (ORFs), 65 were located in the UL region, 9 in the US region, and the remaining two in the IRS and TRS regions [17].
Only a few complete genomes of Anatid herpesvirus 1 have been reported in GenBank. The sequenced virulent strains include DEV CV, isolated in 1962 in East China [18], 2085 from the 2005 outbreak in Germany [10], CHv from outbreaks in southwestern China in the 2000s [19], SD from the 2012 outbreak in Shandong, China [20], and DP-AS-Km-19 from the 2014 outbreak in Guwahati, Assam, India [5]. The limited availability of whole-genome data underscores the need for additional DEV sequences to enhance our understanding of the virus’s pathogenicity and evolutionary dynamics.
In 2024, a duck farm in Jiangsu Province, China, reported unusual symptoms in 8-week-old breeder ducks, including head and neck swelling, moist eyes with mucus secretion, difficulty in ambulation, neck retraction, and disheveled plumage. The polymerase chain reaction (PCR) analysis confirmed DEV infection. We isolated the virus and conducted whole genome sequencing, aiming to provide a theoretical framework for further investigation into the pathogenic mechanisms of DEV.
Materials and methods
Sample collection and pathogen detection
In 2024, a fatal disease outbreak, suspected to be caused by DEV, occurred on a duck farm in Jiangsu, China. A preliminary diagnosis of duck plague was carried out based on clinical signs and autopsy dissection. During outbreaks, deceased ducks are promptly transported to the laboratory within a few hours using specialized vehicles equipped with ice-filled, airtight containers. Liver samples are collected aseptically in a designated autopsy room. Following external sterilization, the abdominal cavity is opened with sterile instruments to expose the liver, which is then meticulously excised and transported to the testing laboratory in a sterile container maintained on ice. The liver samples used in this study were provided by Qilu Animal Health Products Co., Ltd. Total DNA and RNA were extracted from the samples using the MolPure® Viral DNA/RNA Kit (Cat No. 19321; Yeasen, Shanghai, China). Routine virus detection was conducted using PCR with 2×Phanta UniFi Master Mix (Dye Plus) (Vazyme Biotech Co., Ltd., Nanjing, China). The primers used for amplification are listed in Table 1. The remaining samples were stored at − 80°C in an ultra-low temperature freezer for subsequent virus isolation.
Table 1.
Primers used in this study.
| Name | Sequence of primers (5’-3’) | Product size (bp) |
|---|---|---|
| DEV-UL2 [21] | F: ACGAGGGAGACCCAAATGAC | 1018/493a |
| R: TTTATACTGTTCCACAAGGAAGTTG | ||
| DEV-LORF5 [9] | F: GATGAATCTCCTCCGCCAT | 2454/525b |
| R: GTACGTGGTGTAGCCGAAT | ||
| MDPV [22] | F: AATGCTGTAGTGCAGGAGGA | 1197 |
| R: ACAATCATACCACCCATGTT | ||
| DHAV [23] | F: CTTTCCACTCCCTGCTCCC | 140 |
| R: TTGGCTTCCACATCCTCTTCA | ||
| AIV [23] | F: GGCGACTACTACCAACCCA | 435 |
| R: CTGCTGTTCCTGCCGATAT | ||
| DuCV [24] | F: GCACGCTCGACAATTGCAAGT | 338 |
| R: GCCACGCCCAAAGATTACATAAG | ||
| DTMUV [23] | F: AATCGGTAGTGGCTTTGG | 288 |
| R: AGTCTGCCGACATGGATAT | ||
| WRV [25] | F: TGAATGGTGGAACGCCTGTGCACGAG | 300 |
| R: ACGCCTAGACGGTAAAAGTGGCTAG | ||
| DAstV [26] | F: CTTGGACTGTGGAAGCATATACC | 763 |
| R: GTTGAAAACTGCCCTGAAGG | ||
| GPV [22] | F: AGCCTAAGAGAAGCARGAACA | 161 |
| R: ACAATCATACCACCCATGTT | ||
| DAdV-1 [27] | F: CTGACCCAAGATGGTGAAT | 403 |
| R: GCAACCTTTGCTGCTTTGTTC | ||
| DAdV-2 [27] | F: GGTCTTGGAGTAGTAGTAAAC | 418 |
| R: CCAACCCGTCATTATTTCTTATC | ||
| DAdV-3 [27] | F: ATGGCCGCTCTGACCCCTGA | 640 |
| R: ATTCAGCCTTAGCTACTTTC | ||
| DAdV-4 [27] | F: TCCACCTAGACGAAACTATG | 532 |
| R: GTCGTGGCGTCGTTGTCGC |
aThe PCR fragment is 1018 bp for the virulent DEV strain and 493 bp for the attenuated strain.
bThe PCR fragment is 2454 bp for the virulent DEV strain and 573 bp for the attenuated strain.
Furthermore, a statistical analysis was also performed on DEV-positive tissue samples collected from various provinces in China during 2024. A total of 49 DEV-positive samples were obtained from the provinces of Shandong, Anhui, Henan, Liaoning, Jiangxi, Zhejiang, and Hubei. These samples were derived from tissues of ducks that succumbed to the disease, and were submitted for diagnostic testing following mortality events on affected farms. To assess the prevalence of DEV, PCR detection was conducted using two primer pairs, DEV-UL2 and DEV-LORF5 (Table 1). These primers were specifically designed to differentiate between virulent and attenuated strains of the virus [9,21].
Virus isolation
Liver samples were homogenized with twice their volume of physiological saline, followed by three cycles of freezing and thawing at − 80°C. The homogenate was centrifuged, and the supernatant was filtered through a 0.45 μm bacterial filter to eliminate bacterial contaminants. The filtered suspension was inoculated into the chorioallantoic membrane of 10-day-old specific pathogen-free (SPF) duck embryos (0.2 ml per embryo). The chorioallantoic membrane and fluid from duck embryos that died 24 h later were collected, homogenized in physiological saline, and subjected to three freeze-thaw cycles. After three consecutive passages, the allantoic fluid was harvested and stored at − 80°C for future analyses.
Whole genome sequencing
The complete genome sequence was obtained using the next generation sequencing (NGS) conducted by Insight Biotechnology Co., Ltd (Qingdao, China). Large gene fragments, identified based on known sizes of the DEV genome, were extracted and submitted to the BLAST module of NCBI. DEV-related genes were selected from the BLAST search results to construct the full-length DEV genome. The Map Reads to Reference module was employed to remap all NGS raw reads to these DEV-related genes, enhancing the length and coverage of each assembled fragment. The consensus sequence derived from the remapped reads was considered the final assembly of the DEV whole genome. The highest sequence similarity between the studied DEV genomic fragments and published sequences was determined using the BLAST online search program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The Neighbor-Joining method implemented in MEGA version 11.0 software was employed to construct a phylogenetic tree based on whole-genome data.
Experimental reproduction of this disease with experimental DEV infection
20-day-old SPF ducks were sourced from Shandong Health-tech Laboratory Animal Breeding Co., Ltd. (Jinan, China) and housed in isolators until use, with unrestricted access to feed and water. To evaluate the pathogenicity of the isolated DEV strains, 20 healthy 26-day-old SPF ducks were randomly divided into two groups for experimental infection. 10 ducks in the experimental group were subcutaneously injected with 1000 minimum lethal doses (MLD) of the isolated virus, while the remaining 10 ducks in the control group were inoculated with the same volume of phosphate-buffered saline (PBS) [28,29]. All ducks were grouped separately and monitored daily for mortality. Tissue samples, including kidneys, spleens, and livers, were collected for pathological examination and viral isolation. The tissues were fixed in 10% formaldehyde, embedded in paraffin, and sectioned into 4-μm slices. Histopathological analysis was performed following hematoxylin and eosin (H&E) staining [30].
Immunization and challenge assays
The commercial Duck Enteritis Virus (DEV) vaccine, DEV C-KCE, and the reference virulent strain AV1221 used in this study were provided by the China Institute of Veterinary Drug Control (Beijing, China). To evaluate the efficacy of existing vaccines against currently circulating virulent and novel DEV isolates, 100 healthy 26-day-old SPF ducks were selected and randomly assigned to five groups of 20 animals each. Each group of animals were kept separately in SPF duck isolators. Groups A and B were immunized intramuscularly with 1 × 105 TCID₅₀ of the DEV vaccine at 26 days of age, while Groups C and D were injected with PBS as controls. Fourteen days post-immunization, ducks in Groups A and C were challenged with 1000 MLD of the virulent DEV strain AV1221, while ducks in Groups B and D received the novel DEV isolate JS2024 at the same dose. Group E served as a blank control. Daily observations were made to record mortality and clinical symptoms across all groups.
ARRIVE statement
In this study, all experiments involving live animals were conducted in accordance with the ARRIVE guidelines.
Results
Clinical and pathological features
In 2024, a fatal outbreak occurred on a duck farm in Jiangsu, China, suspected to be caused by DEV, resulting in a mortality rate of up to 50% among 8-week-old ducks. Affected ducks exhibited clinical signs including inappetence, ataxia, crowding in corners and against walls, head and neck swelling, ocular edema with viscous discharge, reluctance to move, and lethargy. Necropsy revealed petechial hemorrhages in the liver, intestines, and lungs, along with subcutaneous edema in the neck, hemorrhages in the esophageal mucosa and tracheal rings, and abundant inflammatory exudates. Additionally, white necrotic foci were observed in the enlarged liver (Figure 1). Diagnostic tests for common duck pathogens, including DEV, Muscovy duck parvovirus (MDPV), Duck Hepatitis A Virus (DHAV), avian influenza virus (AIV), Duck circovirus (DuCV), Duck Tembusu virus (DTMUV), Waterfowl-originated reovirus (WRV), duck astrovirus (DAstV), Goose parvovirus (GPV), and duck adenovirus (DAdV), confirmed the presence of DEV, while all other pathogens tested negative.
Figure 1.
Clinical and pathological observations in ducks infected with DEV on a farm. (A) swollen head and neck. (B) severe lung hemorrhage. (C) white necrotic spots on the enlarged liver. (D) neck subcutaneous edema. (E) extensive esophageal hemorrhage. (F) intestinal hemorrhages. (G) severe tracheal ring hemorrhage.
Virus isolation and characterization
Liver samples exhibiting prominent lesions were collected, processed, and inoculated into duck embryos for further culture. Embryonic development was monitored daily, and any embryos that died within 24 hours were discarded. Most inoculated embryos succumbed within 72–96 hours of incubation and tested positive for DEV. The deceased embryos exhibited thickened cystic membranes and widespread hemorrhaging throughout the body (Figure 2).
Figure 2.
Pathological changes in duck embryos due to DEV infection. (A) DEV-JS2024 infected duck embryo displaying severe hemorrhage. (B) uninfected control duck embryo with normal development.
Reproduction of the disease with experimental DEV infection
Following infection with the DEV strain, the infected animals exhibited marked clinical symptoms within 2–4 days, including lethargy, loss of appetite, and ocular discharge (Figure 3A). Necropsy revealed punctate hemorrhages in the liver, spleen, lungs, bursa of Fabricius and cecum, as well as extensive hemorrhaging in the thymus. Severe hemorrhages were also observed in the esophageal mucosa and tracheal rings, accompanied by significant inflammatory exudate (Figure 3B–I). These findings suggest that the outbreak on the farm was caused by a virulent strain of duck plague. To further investigate the tissue and organ damage caused by DEV, histopathological analysis using H&E staining was conducted. As shown in Figure 4A,B, liver and spleen tissues exhibited widespread hemorrhage and necrosis. In the lung, there was a significant accumulation of exudate fluid in the bronchioles, and numerous red blood cells were observed in the pulmonary alveolar walls (Figure 4C). The bursa of Fabricius displayed central hemorrhage within the lymphoid follicles, with mild infiltration of inflammatory cells in some of the follicles (Figure 4D). In the thymus, parenchymal cells in the thymic lobules were markedly reduced, and a considerable amount of pale pink fluid was present in the stroma. Additionally, the epithelial cells of the thymic corpuscles showed pronounced keratinization (Figure 4E). In the esophagus, there was epithelial detachment of the mucosal layer, accompanied by mild hemorrhage, necrosis, and surrounding inflammatory cell infiltration (Figure 4F). Disruption of the intestinal villi was observed, with hemorrhage in the mucosal layer and inflammatory cell infiltration throughout the affected tissue (Figure 4G). The tracheal tissue exhibited submucosal edema with a small infiltration of inflammatory cells, resulting in mild congestion (Figure 4H). These histopathological findings from the regression study strongly suggest that the DEV-JS2024 strain exhibits high virulence, capable of inducing disease and mortality in affected duck populations.
Figure 3.
Clinical and pathological signs in 26-day-old ducks infected with DEV: (A) eye swelling and discharge; (B) thymus hemorrhages; (C) tracheal ring hemorrhages; (D) enlarged liver with hemorrhage; (E) pulmonary hemorrhages; (F) enlarged spleen with hemorrhagic areas; (G) punctate hemorrhages in the bursa of Fabricius; (H) punctate hemorrhages in the cecum; (I) severe esophageal hemorrhage.
Figure 4.
Histopathological analysis of ducks infected with the DEV JS2024 isolate reveals: (A) liver cell swelling and necrosis with inflammatory cell infiltration; (B) reduced white pulp and necrosis in spleen cells; (C) fluid and red blood cell accumulation in lung alveolar walls; (D) hemorrhage and mild inflammatory cell infiltration in bursa of Fabricius lymphoid follicles; (E) pale fluid in thymic lobules and epithelial cell keratinization; (F) esophageal mucosal detachment with bleeding, necrosis, and inflammatory cell infiltration; (G) intestinal villi necrosis and shedding with bleeding and inflammatory infiltration; (H) tracheal submucosal edema, cilia loss, and mononuclear cell infiltration. (Magnification = 200x).
Immunization and challenge assays
Survival curves of ducks were analyzed using GraphPad Prism 10 (Figure 5A). Following infection, all ducks in the challenged group developed severe acute clinical disease. The challenged group exhibited a marked peak in mortality between days 4 and 6 post-infection. All ducks infected with the classic virulent strain AV1221 died by day 5 post-infection, while those infected with the novel DEV isolate JS2024 displayed a mortality rate of 95% (19/20). In contrast, ducks immunized with the DEV vaccine (C-KCE strain) demonstrated a survival rate of 75% (15/20) following infection with AV1221 and 95% (19/20) following infection with JS2024. These immunization and challenge assays results suggest that the current DEV vaccine (C-KCE strain) provides a notable level of protection against both classic and the novel DEV strains.
Figure 5.
Summary of vaccine efficacy and DEV strain distribution. (A) survival rates of ducks vaccinated with the C-KCE strain and exposed to virulent AV1221 or JS2024 strains. (B) comparison of novel versus classical DEV isolates, with black bars for classic isolates and gray bars for novel isolates, indicating the number identified in each category.
Genomic characterization of DEV-JS2024 isolate
The complete genome sequence of strain JS2024 (Supplemental material) comprises 161,603 nucleotides (nt), with a G+C content of 45%. A total of 76 ORFs were predicted to encode potential functional proteins. The BlastN analysis revealed that the most related genome sequences to JS2024 genome in the database were Chinese virulent strain CV (accession JQ673560.1, 100% query coverage and 99.99% identity) and DEV attenuated vaccine strain C-KCE (accession KF263690.1, 97% query coverage and 99.99% identity). In comparison to the Chinese virulent strain CV and the vaccine strain C-KCE, the isolated strain JS2024 exhibited a total of 28 nucleotide variations (Figure 6A). Five of these were synonymous mutations located in the UL49.5, UL49, UL29, UL21, and UL14 genes, while the changes in the remaining coding regions were non-synonymous. Notably, JS2024 harbors a distinct single nucleotide mutation in the UL7, along with two unique single nucleotide alterations in noncoding regions. The mutations in the other nucleotides were identical to those observed in either CV or C-KCE strains.
Figure 6.
Genomic analysis of the novel DEV isolate. (A) the complete genome sequence of the isolated DEV strain JS2024 was compared with the Chinese virulence representative strain CV and the vaccine strain C-KCE using SnapGene software. Nucleotides identical to those in CV are highlighted in red, those matching C-KCE are highlighted in blue, and those differing from both reference strains are marked in black. (B) phylogenetic analysis of the DEV isolate and reference strains was performed. Phylogenetic trees were generated using the distance-based, neighbour-joining method implemented in the MEGA program. The reliability of the tree was assessed using the bootstrap analysis with 1000 replications. Red triangles indicate new isolate. (C) sequence alignment of LORF11 from 15 DEV strains. (D) sequence alignment of UL2 from 22 DEV strains.
Wu et al. investigated the LORF5 gene and partial 5’ untranslated region (UTR) sequences of DEV virulent and attenuated strains prevalent in China, revealing significant length variations between the two forms in this genomic region [9]. Building on these sequence differences, they developed a PCR-based diagnostic method to distinguish virulent from attenuated DEV strains. The LORF5 gene and partial 5’UTR sequences of the DEV 2085 and DP-AS-Km-19 strains were collectively designated as LORF11 [5,10]. In keeping with this nomenclature, the present study adopts the same convention, referring to the combined LORF5 and partial 5’UTR sequences as LORF11.
The LORF11 region of the DEV-JS2024 strain spans 4341 base pairs (bp) and encodes a protein of 1447 amino acids. This sequence exhibits 100% nucleotide homology with the Chinese virulent strain CV (accession JQ673560.1). Using the PCR detection method developed by Wu et al. to differentiate virulent and attenuated DEV strains, we classified the DEV-JS2024 isolate as a virulent strain [9]. Wu et al. had previously observed an additional non-target band of 1596 bp (designated fragment X) during PCR amplification of a commercial DEV vaccine (CVCC AV1222) and an attenuated DEV strain (CHa) [9]. At present, there is no DEV virulent strain lacking LORF11 in China. Building on these findings, we performed a comparative analysis of the LORF11 gene sequences from 10 virulent and 5 attenuated strains. This analysis revealed a 901 bp region (nt 1663 to 2564) that serves as a reliable marker for distinguishing between virulent and attenuated DEV strains in China (Figure 6C).
The UL2 gene of DEV strain JS2024 is 474 bp in length, encoding a 158 amino acid protein. It exhibits complete nucleotide identity (100%) with the DEV Chinese vaccine strain C-KCE (accession KF263690.1). Xie et al. previously compared the UL2 genes of 10 virulent and 11 attenuated DEV strains, revealing that the UL2 ORF in attenuated DEV strains is 474 bp, while in virulent strains it is 1002 bp [4]. Based on these observations, a PCR assay targeting the DEV UL2 gene was developed for the simultaneous detection of both virulent and attenuated strains [4]. However, whole-genome sequencing of the virulent isolate JS2024 revealed a 528 bp deletion within the UL2 gene. Comparative analysis of UL2 genes from 15 virulent and 7 attenuated strains deposited in GenBank highlighted that this is the first reported instance of a deletion in the UL2 gene of virulent DEV strains in China (Figure 6D).
Whole-genome sequence evolutionary relatedness showed that JS2024 isolate was closely related to DEV attenuated vaccine strain and forming one clade (Figure 6B). Combined with the clinical and pathological features analysis, it was suggested that the JS2024 isolate may be a recombinant strain of the virulent and attenuated vaccine strains.
Clinical sample testing
A statistical analysis was performed on DEV-positive samples collected in 2024, which identified the presence of JS2024-like novel DEV strains across several provinces in China (Figure 5B). Out of 49 DEV-positive samples, 13 were identified as classic DEV strains, while 36 were classified as novel DEV strains. Notably, the prevalence of novel DEV strains has surpassed that of the classic strains, establishing the novel strains as the predominant group.
Discussion
The DEV was identified as the etiologic agent responsible for the morbidity and mortality observed in adult ducks on this farm. The gross and histopathological lesions were consistent with previously documented symptoms of DEV infection [14,31,32]. Diagnostic analyses, including PCR identification, pathogen isolation, culture, and whole-genome sequencing, confirmed that the outbreak was caused by DEV. The virulence of the isolated DEV-JS2024 strain was evident from the rapid onset of clinical signs, with affected ducks exhibiting lethargy, anorexia, and ocular discharge within 2 to 4 days post-infection. This timeline coincided with the peak mortality observed between days 4 and 6, highlighting the aggressive nature of the strain. Pathological examination revealed extensive hemorrhagic lesions in critical organs, including the liver, spleen, lungs, and bursa of Fabricius, confirming the strain’s ability to induce severe systemic damage and immunosuppression, which predisposes to secondary infections. Histopathological analysis, including H&E staining, further delineated the extent of tissue damage, with diffuse hemorrhage and necrosis observed in both the liver and spleen. Pulmonary involvement was particularly pronounced, characterized by fluid accumulation in the bronchioles and red blood cell infiltration in the alveolar walls, indicative of a strong inflammatory response. Notably, the observed hemorrhage within the bursa of Fabricius and thymus suggests a significant immunocompromise, with a reduction in parenchymal cells in thymic lobules raising concerns about the long-term impact on avian immunity. The multifocal lesions, including severe hemorrhagic necrosis in the esophagus and trachea, indicate that the DEV-JS2024 isolate possesses distinct pathogenic features warranting further investigation. The inflammatory response in the tracheal submucosa, characterized by edema, underscores the respiratory involvement of the infection and its potential to exacerbate disease transmission within the flock.
The complete genome sequence of the DEV JS2024 strain comprises 161,603 nucleotides with a G+C content of 45%. The G+C content of a viral genome is not merely a structural feature-it plays a significant role in shaping the virus’s replication strategy and gene expression patterns. DNA molecules with higher G+C content exhibit greater thermal stability due to the presence of three hydrogen bonds between guanine and cytosine. A G+C content of 45% suggests that the DEV genome maintains moderate stability, which may help balance the need for robust replication fidelity with the flexibility required for rapid genome unwinding during transcription and replication. This balance is critical in the context of the herpesvirus life cycle, which includes both lytic replication and latent infection phases. The G+C content can affect codon usage bias, which in turn can influence the efficiency of viral protein synthesis in the host. A G+C content of 45% suggests that DEV may have evolved codon preferences that partially match the host duck’s cellular machinery, optimizing translation without significantly triggering host immune defenses. This adaptation may enhance the virus’s ability to persist and replicate in avian hosts. A total of 76 open reading frames (ORFs) were predicted, suggesting a robust potential for functional protein expression. These likely include structural proteins essential for virion assembly, enzymes involved in DNA replication (such as DNA polymerase), and regulatory proteins that manipulate host immune responses and promote viral persistence. The relatively large number of ORFs is consistent with the complex replication strategies employed by herpesviruses, which often include the ability to establish latency and modulate host cellular pathways. The isolate shows a striking 99.99% nucleotide identity with the Chinese virulent strain CV (accession JQ673560) and the DEV attenuated vaccine strain C-KCE (accession KF263690), underscoring its close genetic relationship and confirming its role as the causative agent of the recent outbreak on a farm in Jiangsu. Detailed comparative genomic analysis identified only 28 nucleotide mutations in the JS2024 isolate compared to the Chinese virulent strain CV and the vaccine strain C-KCE, indicating that the genome of DEV, as a DNA virus, is relatively stable, with only minor genetic changes occurring under passage and environmental pressure. Notably, 15 of these mutations were non-synonymous and located within coding regions, suggesting potential impacts on viral protein function. Further functional annotation and literature-supported insights point to several of these mutations being in genes associated with viral replication, cell-to-cell spread, and host interaction-critical determinants of viral fitness and pathogenicity. Among these, mutations in the US7 and US8 genes, which encode glycoprotein I (gI) and glycoprotein E (gE) respectively, are of particular interest. Deletion of gI results in impaired viral envelopment and the accumulation of nucleocapsids around cytoplasmic vesicles, indicating a disruption in virion maturation and intercellular transmission [33]. Although gE/gI are not essential for replication in vitro, their contributions to virulence and spread in vivo are well-documented [34]. Whether the non-synonymous mutations of these genes are involved in regulating the balance between viral attenuation and transmission efficiency needs to be further verified. We also identified mutations in UL47, a tegument protein known to influence virion release and propagation. Experimental deletion of UL47 has been shown to reduce virulence and inhibit effective cell-to-cell spread, though immunogenicity remains intact [35]. Mutations within UL47 in the JS2024 isolate may represent natural genetic adaptations that contribute to altered virulence or immune evasion strategies. In addition to the aforementioned genes, our findings also identified a non-synonymous mutation in the UL42 gene. Mechanistic studies have shown that UL42 interacts with the long noncoding RNA BTU (Lnc BTU), leading to its upregulation. In turn, Lnc BTU enhances the expression of UL42, creating a positive feedback loop that facilitates viral DNA polymerase production and accelerates viral replication [36]. Thus, mutations in UL42 may have downstream effects not only on the polymerase complex directly but also on regulatory host-virus interactions that fine-tune viral genome replication. Overall, the distribution of non-synonymous mutations in genes like US7, US8, UL47, and UL42 reflects evolutionary pressure shaping the virus’s capacity for spread and survival, likely balancing between attenuation and immunogenicity. Future functional validation of these mutations will be essential to delineate their precise roles in virulence modulation and to inform rational vaccine design.
Building on methodologies established by Wu et al., the LORF11 gene can be used as a molecular marker to distinguish between virulence and attenuated DEV strains [9]. The LORF11 gene of the DEV-JS2024 isolate comprises 4,341 bp and exhibits 100% nucleotide homology with the Chinese virulent representative strain CV, reinforcing its classification as a highly pathogenic variant. Additionally, the unexpected amplification of a nontarget band (X fragment) during PCR, as observed by Wu et al., further underscores the genetic complexity of DEV strains [9]. Sequencing revealed this fragment to be approximately 1,596 bp, and comparison of LORF11 across multiple strains confirmed that the 1,663 to 2,564 nt region reliably differentiates virulent from attenuated strains in China (Figure 6C). Moreover, the analysis of the UL2 gene has further deepened our understanding of DEV genetics. A 528 bp deletion in the UL2 gene of JS2024 isolate represents the first such deletion identified in virulent DEV strains in China. This contrasts with previous findings, which only identified partial deletions of the UL2 gene in attenuated strains [21]. Despite this deletion, the newly isolated JS2024 strain retains strong pathogenicity, suggesting that the UL2 gene is no longer a reliable marker for distinguishing between virulent and attenuated strains. These findings also imply that the partial deletion of the UL2 gene in DEV vaccine strains may not be the primary factor responsible for their reduced virulence. The UL2 gene is often targeted in PCR assays for DEV identification due to its specificity and relevance to viral function [4]. However, the presence of a major deletion within UL2 in a virulent strain challenges the assumption that deletions are exclusive to attenuated strains, thereby undermining its utility as a differentiating marker. If the UL2 gene is incomplete, PCR assays targeting this region may fail to amplify viral DNA, resulting in false-negative results or inaccurate assessment of viral load. This limitation not only compromises diagnostic sensitivity but also impacts clinical monitoring and outbreak control efforts. Therefore, these findings highlight the critical need for the development of new diagnostic primers or methodologies to improve the sensitivity and accuracy of DEV detection assays. Additionally, ongoing genomic surveillance is essential to track emerging variations and ensure the robustness of diagnostic tools. Collectively, these measures will improve the accuracy and reliability of DEV detection assays, which is vital for effective disease management in affected regions.
The Chinese virulent strain of DEV, designated CV (accession JQ673560.1), was subsequently renamed DEV C20E85 (accession KU216226.1) following continuous attenuation [37]. Phylogenetic analysis indicated that the attenuated strain, DEV C20E85, remained within the same clade as the virulent DEV CV strain (Figure 6B). Similar to the above results, the clinical and pathological outcomes of experimental infection with the DEV JS2024 isolate in 26-day-old ducks confirmed its virulence. However, whole-genome sequence analysis revealed that the JS2024 isolate was closely related to the attenuated DEV vaccine strain, clustering within the same phylogenetic clade (Figure 6B). The JS2024 isolate may have originated from recombination between the vaccine strain and the virulent strain. Specifically, the JS2024 isolate may have been generated through recombination at specific loci, such as the UL2 gene, with the vaccine strain serving as the template. Further research is needed to investigate this hypothesis in greater detail.
The statistical analysis of DEV-positive samples collected in 2024 indicates a significant transformation in the epidemiological landscape of duck plague in China. Of the 49 DEV-positive samples, 36 (73.5%) were identified as novel JS2024-like strains, whereas only 13 (26.5%) were categorized as classic DEV strains. This predominance of novel strains across various provinces highlights their enhanced adaptability and potential evolutionary advantage over traditional variants. The extensive geographical distribution of JS2024-like strains, detected in Jiangsu, Shandong, Jiangxi, and Henan provinces, suggests increased transmissibility or environmental persistence, potentially facilitated by genetic recombination or mutations that enhance viral fitness. Such a shift may pose challenges to existing biosecurity protocols, particularly if the novel strains exhibit altered tropism or immune evasion capabilities.
In summary, these findings not only provide a comprehensive understanding of the genetic landscape of JS2024 isolate but also highlight the critical need for ongoing genomic surveillance of DEV. The observed attenuation of virulence may result from a complex interplay of genetic variations within the DEV genome, but attributing this attenuation to any single gene remains challenging. The molecular basis for the differential pathogenicity of DEV strains is still unclear, likely arising from multiple genetic factors. A deeper understanding of these molecular variations is essential for the development of more effective vaccines and control strategies to mitigate the impact of duck plague on avian populations. Future research should prioritize investigating the functional consequences of the identified mutations and deletions, thereby advancing our ability to combat this emerging threat to poultry health.
Conclusion
In summary, this study characterizes the JS2024 isolate as a virulent strain of DEV with significant pathogenicity. Genomic analysis shows that JS2024 is closely related to virulent strains but contains key mutations in the genome, which may enhance its virulence and immune evasion. Notably, a 528 bp deletion was identified for the first time in the UL2 gene of the virulent strain, presenting potential challenges to current diagnostic methods. The widespread distribution of JS2024-like strains across multiple regions of China indicates an evolving epidemiological trend, thereby presenting potential challenges to existing biosecurity measures. Furthermore, the potential for genetic recombination between vaccine and virulent strains adds complexity to the understanding of DEV evolution. Ongoing research is imperative to enhance the comprehension of the virus’s adaptability and transmissibility, and to facilitate the development of more effective control strategies.
Supplementary Material
Acknowledgments
The study was designed by YFL and DY. YHG, MQX, JHW and FH screened and organized data from the database. XFS, ZL, JYP and JFL were involved in animal experiments. DY wrote the manuscript. YFL, ZMQ, MK, BW, CDY, YJQ and YSJ revised and reviewed the article. All authors have read and approved the final manuscript.
Funding Statement
This work was supported by Agricultural Science and Technology Innovation Project of Shandong Academy of Agricultural Sciences [No.CXGC2025C11]; Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through High-Risk Animal infectious Disease Control Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) [RS-2024-00398364]; Shandong Province Poultry Industry Technology System [SDAIT-11–01].
Disclosure statement
No potential conflict of interest was reported by the author(s).
Data availability statement
All datasets generated for this study are included in the article/Supplementary Material. Raw date and supplemental data for this article can be openly available in figshare (https://figshare.com) at https://doi.org/10.6084/m9.figshare.28777178.
Ethics statement
This study was approved by the Animal Care and Use Committee of Shandong Academy of Agricultural Sciences (permit number: JQS-2024-Q001) and performed in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China). All ducks in this study were bred and cared for in accordance with humane procedures.
Supplementary Information
Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2025.2547325
References
- [1].Ji J, Du LQ, Xie QM, et al. Rapid diagnosis of duck plagues virus infection by loop-mediated isothermal amplification. Res Vet Sci. 2009;87(1):53–12. doi: 10.1016/j.rvsc.2008.11.003 [DOI] [PubMed] [Google Scholar]
- [2].Sarmah H, Shah M, Pathak M, et al. Pathodynamics of circulating strains of duck enteritis virus: a step forward to understand its pathogenesis. Avian Dis. 2020;64(2):166–173. doi: 10.1637/0005-2086-64.2.166 [DOI] [PubMed] [Google Scholar]
- [3].Campagnolo ER, Banerjee M, Panigrahy B, et al. An outbreak of duck viral enteritis (duck plague) in domestic muscovy ducks (Cairina moschata domesticus) in Illinois. Avian Dis. 2001;45(2):522–528. doi: 10.2307/1592999 [DOI] [PubMed] [Google Scholar]
- [4].Xie L, Xie Z, Huang L, et al. A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus. J Virol Methods. 2017;249:66–68. doi: 10.1016/j.jviromet.2017.08.021 [DOI] [PubMed] [Google Scholar]
- [5].Aasdev A, Pawar SD, Mishra A, et al. First complete genome characterization of duck plague virus from India. Virus Dis. 2021;32(4):789–796. doi: 10.1007/s13337-021-00748-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Wu Y, Cheng A, Wang M, et al. Complete genomic sequence of Chinese virulent duck enteritis virus. J Virol. 2012;86(10):5965. doi: 10.1128/JVI.00529-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Mukerji A, Das MS, Ghosh BB, et al. Duck plague in West Bengal. 3. Indian Vet J. 1965;42(11):811–815. [PubMed] [Google Scholar]
- [8].Hall SA, Simmons JR.. Duck plague (duck virus enteritis) in Britain. Vet Rec. 1972;90(24):691. doi: 10.1136/vr.90.24.691 [DOI] [PubMed] [Google Scholar]
- [9].Wu Y, Zhang S, Li Y, et al. Establishment and application of a PCR assay for the identification of virulent and attenuated duck plague virus DNA in cotton swabs. Poult Sci. 2023;102(5):102555. doi: 10.1016/j.psj.2023.102555 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Wang J, Hoper D, Beer M, et al. Complete genome sequence of virulent duck enteritis virus (DEV) strain 2085 and comparison with genome sequences of virulent and attenuated DEV strains. Virus Res. 2011;160(1–2):316–325. doi: 10.1016/j.virusres.2011.07.004 [DOI] [PubMed] [Google Scholar]
- [11].Yang C, Li J, Li Q, et al. Complete genome sequence of an attenuated duck enteritis virus obtained by in vitro serial passage. Genome Announc. 2013;1(5):1. doi: 10.1128/genomeA.00685-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Aravind S, Kamble NM, Gaikwad SS, et al. Adaptation and growth kinetics study of an Indian isolate of virulent duck enteritis virus in Vero cells. Microb Pathog. 2015;78:14–19. doi: 10.1016/j.micpath.2014.11.008 [DOI] [PubMed] [Google Scholar]
- [13].Converse KA, Kidd GA. Duck plague epizootics in the United States, 1967–1995. J Wildl Dis. 2001;37(2):347–357. doi: 10.7589/0090-3558-37.2.347 [DOI] [PubMed] [Google Scholar]
- [14].El-Tholoth M, Hamed MF, Matter AA, et al. Molecular and pathological characterization of duck enteritis virus in Egypt. Transbound Emerg Dis. 2019;66(1):217–224. doi: 10.1111/tbed.13002 [DOI] [PubMed] [Google Scholar]
- [15].Dandapat S, Bindu S, Sharma GK, et al. Complete genome sequence of a virulent duck enteritis virus (DEV/India/IVRI-2016) isolated from Southern India. Microbiol Resour Announc. 2022;11(7):e0124421. doi: 10.1128/mra.01244-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Dhama K, Kumar N, Saminathan M, et al. Duck virus enteritis (duck plague) – a comprehensive update. Vet Q. 2017;37(1):57–80. doi: 10.1080/01652176.2017.1298885 [DOI] [PubMed] [Google Scholar]
- [17].Li Y, Huang B, Ma X, et al. Molecular characterization of the genome of duck enteritis virus. Virology. 2009;391(2):151–161. doi: 10.1016/j.virol.2009.06.018 [DOI] [PubMed] [Google Scholar]
- [18].Yang C, Li Q, Li J, et al. Comparative genomic sequence analysis between a standard challenge strain and a vaccine strain of duck enteritis virus in China. Virus Genes. 2014;48(2):296–303. doi: 10.1007/s11262-013-1009-9 [DOI] [PubMed] [Google Scholar]
- [19].Wu Y, Cheng A, Wang M, et al. Comparative genomic analysis of duck enteritis virus strains. J Virol. 2012;86(24):13841–13842. doi: 10.1128/JVI.01517-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Zhang B, Huang X, Yang Y, et al. Complete genome sequence of an isolate of duck enteritis virus from China. Arch Virol. 2020;165(7):1687–1689. doi: 10.1007/s00705-020-04594-7 [DOI] [PubMed] [Google Scholar]
- [21].Xie L, Huang L, Xie Z, et al. An attempt to develop a detection method specific for virulent duck plague virus strains based on the UL2 gene B fragment. Avian Pathol: j WVPA. 2017;46(6):652–657. doi: 10.1080/03079457.2017.1341622 [DOI] [PubMed] [Google Scholar]
- [22].Wan C, Cheng L, Chen C, et al. A duplex PCR assay for the simultaneous detection and differentiation of muscovy duck parvovirus and goose parvovirus. Mol Cell Probes. 2019;47:101439. doi: 10.1016/j.mcp.2019.101439 [DOI] [PubMed] [Google Scholar]
- [23].Yao M, Zhang X, Gao Y, et al. Development and application of multiplex PCR method for simultaneous detection of seven viruses in ducks. BMC Vet Res. 2019;15(1):103. doi: 10.1186/s12917-019-1820-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Wang X, Yu H, Zhang W, et al. Molecular detection and genetic characterization of vertically transmitted viruses in ducks. Animals (Basel). 2023;14(1):14. doi: 10.3390/ani14010006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25].Zhang S, Dong H, Lin F, et al. Development and application of a multiplex PCR method for the simultaneous detection of goose parvovirus, waterfowl reovirus, and goose astrovirus in muscovy ducks. J Virol Methods. 2024;324:114857. doi: 10.1016/j.jviromet.2023.114857 [DOI] [PubMed] [Google Scholar]
- [26].Wei F, Wang Y, Wang Q, et al. The isolation and characterization of duck astrovirus type-1 remerging in China. Transbounding Emerging Dis. 2022;69(5):2890–2897. doi: 10.1111/tbed.14444 [DOI] [PubMed] [Google Scholar]
- [27].Zhang X, Xu B, Zhou H, et al. Pathogenicity of duck adenovirus type 3 in chickens. Animals (Basel). 2024;14(16):14. doi: 10.3390/ani14162284 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Committee CVP. Veterinary pharmacopoeia of the people’s Republic of China. Beijing: China Agriculture Press; 2020. [Google Scholar]
- [29].Yang F, Liu P, Li X, et al. Recombinant duck enteritis virus-vectored bivalent vaccine effectively protects against duck hepatitis a virus infection in ducks. Front Microbiol. 2021;12:813010. doi: 10.3389/fmicb.2021.813010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Zhang Y, Wu Y, Zhang X, et al. Poly I: C alleviated duck intestinal injury infected with duck viral enteritis by inhibiting apoptosis. Curr Microbiol. 2024;81(9):296. doi: 10.1007/s00284-024-03716-7 [DOI] [PubMed] [Google Scholar]
- [31].Tang W, Yuan M, Mao M, et al. Pathogenicity studies and molecular characterization of DPV infection in ducklings. Poult Sci. 2024;103(9):103919. doi: 10.1016/j.psj.2024.103919 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Liang Z, Guo J, Yuan S, et al. Pathological and molecular characterization of a duck plague outbreak in Southern China in 2021. Animals (Basel). 2022;12(24):12. doi: 10.3390/ani12243523 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Liu T, Wang M, Cheng A, et al. Research note: duck plague virus glycoprotein I influences cell–cell spread and final envelope acquisition. Poult Sci. 2020;99(12):6647–6652. doi: 10.1016/j.psj.2020.08.065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Ning Y, Huang Y, Wang M, et al. Evaluation of the safety and immunogenicity of duck-plague virus gE mutants. Front Immunol. 2022;13:882796. doi: 10.3389/fimmu.2022.882796 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].Cui Y, Chen S, Wang M, et al. Duck plague virus UL47 gene affects the release and cell-to-cell spread of the virus and its deletion strains can provide strong protection for ducks. Poult Sci. 2025;104(6):105092. doi: 10.1016/j.psj.2025.105092 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Luo N, Cheng A, Wang M, et al. Up-regulated Lnc BTU promotes the production of duck plague virus DNA polymerase and inhibits the activation of JAK-STAT pathway to facilitate duck plague virus replication. Poult Sci. 2024;103(12):104238. doi: 10.1016/j.psj.2024.104238 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Yang C, Zhang B, Li J, et al. Complete genomic sequence of a duck enteritis virus attenuated via serial passage in chick embryos. Arch Virol. 2017;162(11):3549–3550. doi: 10.1007/s00705-017-3491-1 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All datasets generated for this study are included in the article/Supplementary Material. Raw date and supplemental data for this article can be openly available in figshare (https://figshare.com) at https://doi.org/10.6084/m9.figshare.28777178.