Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Aug 25.
Published in final edited form as: J Neurophysiol. 2025 Jun 30;134(1):361–371. doi: 10.1152/jn.00216.2025

Experience-induced NPAS4 reduces dendritic inhibition from CCK+ inhibitory neurons and enhances plasticity

Daniel A Heinz 1, Wenhao Cui 2, Kimberly L Cooper 2, Brenda L Bloodgood 1
PMCID: PMC12372623  NIHMSID: NIHMS2094549  PMID: 40588373

Abstract

Flexibility of neurological systems stems from a host of biological responses to changing experience. When a mouse explores an enriched environment, neurons throughout the brain express the inducible transcription factor NPAS4. In CA1 of the hippocampus, pyramidal neurons that express NPAS4 receive more perisomatic inhibition from CCK+ inhibitory neurons, and less dendritic inhibition from a previously unidentified inhibitory neuron population. Here, we show that this reduction in dendritic inhibition is specific to synapses made by CCK+ inhibitory neurons, and that these NPAS4-dependent changes result in facilitation of theta-burst synaptic plasticity. Thus, NPAS4 expression reorganizes inhibition from a genetically defined population of inhibitory neurons, changing learning rules in response to an animal’s interactions with its environment.

Keywords: CCK inhibitory neuron, dendritic inhibition, enriched environment, NPAS4, plasticity

Graphical Abstract

graphic file with name nihms-2094549-f0001.jpg

NEW & NOTEWORTHY

How does an inducible transcription factor affect neuronal and circuit function? Here we show that housing mice in an enriched environment induces NPAS4 expression in CA1 pyramidal neurons, leading to a reduction in dendritic inhibition specifically from CCK+ inhibitory neurons. This facilitates excitatory synaptic plasticity, indicating a potential mechanistic link between environmental enrichment and enhanced cognitive flexibility.

INTRODUCTION

Novel experiences trigger a cascade of molecular events that modify neuronal connectivity and function (1–3). One key mechanism for changing neuronal function is the expression of activity-dependent transcription factors, such as NPAS4 (4–6). Stimuli that engage neurons in specific brain areas promote NPAS4 expression in those regions, where it orchestrates context-appropriate cellular and circuit changes. Loss of NPAS4 disrupts these processes, impairing the ability of affected neurons to mount proper physiological responses (7–15).

Exploration of an enriched environment (EE), characterized by novelty and enhanced complexity, is an ethological experience that in humans promotes cognitive health and ameliorates symptoms of many neurological disorders (16). In rodents, EE enhances cognition (17, 18) and leads to NPAS4 expression throughout the brain (7). In CA1 of the hippocampus, little NPAS4 is expressed when a mouse is in the standard environment (SE) of a lab cage. When a mouse is allowed to explore an EE, however, many CA1 pyramidal neurons express NPAS4 (7, 14, 15), which drives a reorganization of synaptic inhibition. This is characterized by an increase in perisomatic (in stratum pyramidale, SP), and a reduction in proximal apical dendritic (in stratum radiatum, SR) inhibition onto NPAS4-expressing cells (7, 14, 15).

These opposing changes cannot be seen merely as a counterbalancing mechanism; inhibition onto different cellular compartments comes from different populations of inhibitory neurons, and has distinct consequences. Somatic inhibition, provided by basket cells, gates the neuron’s action potential output and spike timing (19, 20), while dendritic inhibition influences temporal and spatial summation (21, 22), limits burst firing and dendritic calcium spikes (23–29), and gates NMDA receptor-mediated synaptic plasticity (29–33).

Even within a compartment, different populations of inhibitory neurons shape pyramidal neuron function in distinct ways. In the somatic domain, parvalbumin (PV+) and cholecystokinin (CCK+) basket cells represent a functional dichotomy. Reliable, temporally precise inhibition from PV+ basket cells tightly regulates the rhythm of CA1 during movement (34, 35), and slow, asynchronous inhibition from CCK+ basket cells (36, 37) provides a blanket of inhibition during rest (35, 38). Critically, CCK+ but not PV+ basket cells are subject to depolarization-induced suppression of inhibition (DSI) (39–41); DSI allows highly active pyramidal neurons to temporarily escape from inhibition via synthesis of endocannabinoids, which silence CCK+ synapses (42, 43). Previous work has shown that NPAS4 specifically increases perisomatic inhibition from CCK+ inhibitory neurons, resulting in enhanced sensitivity to DSI (15).

Many types of inhibitory neurons synapse onto the proximal apical dendrites of CA1 pyramidal neurons, characterized by anatomy, gene expression, and function (44, 45). This heterogeneity can be reduced to four distinct but overlapping populations, defined by expression of somatostatin (SST), PV, neuropeptide Y (NPY), and CCK (22, 46). The SST+ population is adept at vetoing pyramidal neuron bursts (25), and the NPY+ population at compartmentalizing distal and proximal excitatory inputs (22). The CCK+ population modulates pyramidal neuron receptivity to synaptic plasticity and is subject to DSI (39, 42, 47–49). The functional impact of PV+ dendrite targeting inhibitory neurons is less explored, but their bias towards primary branches may imply a role in dendritic compartmentalization (50). To predict the consequences of NPAS4 expression, therefore, it is necessary to determine which inhibitory synapse populations are affected.

We assessed the contribution of these inhibitory neuron populations to the NPAS4-dependent reduction in dendritic inhibition by combining Cas9-mediated disruption of the Npas4 gene with spatially restricted optogenetic stimulation of genetically defined inhibitory synapses. We found that only CCK+ dendritic inhibition was impacted by EE-induced NPAS4, leading us to hypothesize and demonstrate that NPAS4 facilitates at least one form of synaptic plasticity affected by dendritic inhibition, including theta-burst stimulus (TBS) plasticity.

MATERIALS AND METHODS

In Vitro Evaluation of Cas9 gRNA Editing Efficiency

Npas4 Translational Start Site (TSS) gRNA (GTCATGTACCACCGATCAA) was synthesized as complementary oligonucleotide pairs (Integrated DNA Technologies), annealed, and cloned into the BbsI-digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene, plasmid #48138). Plasmids were purified using a QIAGEN® Plasmid Midi Kit. NIH/3T3 mouse fibroblasts were transfected with the constructed plasmids using TransIT-X2 Dynamic Delivery System (Mirus Bio LLC) and cultured for 72 hours. GFP-positive cells were enriched through fluorescence-activated cell sorting (FACS), and genomic DNA was isolated using a PureLink® Genomic DNA Mini Kit (Thermo Fisher Scientific). CRISPR/Cas9 target sites were PCR-amplified from extracted genomic DNA using Q5® High-Fidelity 2X Master Mix (NEB). Specifically, the TSS target region was amplified using forward primer Npas4 TSS-F (GATGACGTCGGAAGTCTGGG) and reverse primer Npas4 TSS-R (GTCAGCTCTGGTCTCCGGTA), followed by Sanger sequencing using the Npas4 TSS-R primer. Genome editing efficiency (Indel %) was quantified by analyzing sequencing chromatograms with the Inference of CRISPR Edits (ICE) algorithm (v3; Synthego; https://ice.synthego.com) following the manufacturer’s recommended protocol.

Animals

Animals were handled according to protocols approved by the UC San Diego Institutional Animal Care and Use Committee, which are in accordance with federal guidelines. In all experiments, male and female C57BL/BJ mice heterozygous (+/−) for Cas9 (B6J.129(Cg)-Igs2tm1.1(CAG-cas9*)Mmw/J, JAX Strain # 028239) were used. For oStim experiments, mice were also heterozygous for Gad2-Cre (B6J.Cg-Gad2tm2(cre)Zjh/MwarJ, JAX Strain # 028867), SST-Cre (B6J.Cg-Ssttm2.1(cre)Zjh/MwarJ, JAX Stain # 028864), PV-Cre (B6.129P2-Pvalbtm1(cre)Arbr/J, JAX Strain # 017320) NPY-Cre (B6.Cg-Npytm1(cre)Zman/J, JAX Strain # 027851) or CCK-Cre (Ccktm1.1(cre)Zjh/J, JAX Strain # 012706). For a subset of CCK+ oStim experiments, mice were also heterozygous for DLX-Flp (Tg(mI56i-flpe)39Fsh/J, JAX Strain # 010815) back-crossed into the C57BL/BJ background.

Animals had access to food and water ad libitum and a 12-hour light/dark cycle. SE consisted of a mouse cage with bedding and nestlets. EE consisted of a rat cage with bedding, nestlets, running wheel, and novel objects that were changed every two days.

For seizures, mice were given an intraperitoneal (IP) injection of 12 mg/kg kainic acid and monitored. If no seizure was induced after 30 minutes, another dose was given every 15 minutes until seizures were observed. One hour after the last injection, mice were anesthetized, and brains were processed for immunohistochemistry.

Viruses

For in vivo Cas9-mediated disruption of the Npas4 gene, a virus with the TSS gRNA under the U6 promoter and mCherry under the hSyn promoter was used (AAV9-gRNA-mCherry, Vector Builder ID: VB190419–1109cra, Titer: 2.1×10^12 GC/mL, diluted to 12%). For opsin expression, Cre-dependent oChIEF under either the hSyn promoter (AAV2-hSyn-DIO-oChIEF, U Pen Vector Core, Titer: 8×10^12, diluted to 88%) or the hDlx promoter (AAV8-hDlx-DIO-oChIEF, Vector Builder ID: VB210330–1368hhk, Titer: 2.04×10^12, diluted to 88%). For CCK+ oStim experiments, either AAV8-hDlx-DIO-oChIEF in a CCK-Cre+/−;Cas9+/− mouse, or Cre-on/Flp-on ChR2 (AAV8-hSyn-DIO-fDIO-ChR2, Addgene ID: 55645, Titer: 2.1×10^13 GC/mL, diluted to 88%) with a CCK-Cre+/−;DLX-Flp+/−;Cas9+/− mouse was used; in either case, opsin expression is restricted to hDlx+ neurons.

For viral injections, a Hamilton syringe was used to deliver AAV with transcranial injection in P14 mice. Bilateral CA1 was targeted with three 150 nL injections at AP: −2.3 mm, ML: ±3.25 mm, DV: −3.6 mm, −2.5 mm, and −1.4 mm. Virus was injected at a rate of 100 nL per minute.

NPAS4 Immunohistochemistry

Ten to 16 days after unilateral injection of AAV9-gRNA-mCherry, seizures were induced. Brains were removed, blocked, drop-fixed in 4% PFA (2 hours), and dehydrated in 30% sucrose overnight. Tissue was flash-frozen in OCT, sectioned on a cryostat into 20 μm sections, stained with antibodies against NPAS4 (Rabbit anti NPAS4, Activity Signaling Cat# AS-AB18A-100) at 1:1000 dilution and NeuN (Guinea pig anti NeuN, Synaptic Systems Cat# 266 004) at 1:1000 dilution and fluorescent secondary antibodies (Jackson Immuno: 706-545-148, 711-605-152) at 1:500 dilution, and counterstained with DAPI (SouthernBiotech Cat# 0100-20) before imaging on a confocal microscope (UC San Diego Nikon Imaging Core, Model: Nikon AXR Laser Scanning Confocal, 20x objective, 0.75NA). Each section included both hemispheres, which were processed together. Images were acquired in a single session with identical parameters, and look-up tables were matched between hemispheres. NeuN+ and DAPI+ cells were manually counted in each hemisphere; only mCherry+ cells were counted in the injected hemisphere. Omero was used to prepare images for presentation.

Single Molecule Fluorescence In Situ Hybridization (smFish)

Ten to 16 days after viral injection (P14, AAV8-hDlx-DIO-oChIEF), brains were removed and flash frozen in OCT. Tissue was sectioned on a cryostat into 20um sections, and RNA Scope was performed using the ACD Bio RNAscope™ Multiplex Fluorescent Detection V2 kit (REF: 323110) using probes against mm-Gad2 (REF: 439371), oChIEF (REF: 1578591), mm-Sst (REF: 404631, mm-Pvalb (REF: 421931), mm-Npy (REF: 313321), and mm-Cck (REF: 402271), before imaging on a confocal microscope (UC San Diego Nikon Imaging Core, Model: Nikon AXR Laser Scanning Confocal, 20x objective, 0.75NA). Cells positive for oChief, inhibitory neuron subtype-specific genes, and Gad2 were counted manually and the percent coverage and specificity of expression were determined. Omero was used to prepare images for presentation.

Electrophysiology

Slices were prepared in either choline as described in (14, 15) or NMDG cutting solution as described in (51). For recordings, slices were perfused with 31° C oxygenated artificial cerebrospinal fluid (ACSF) (in mM: 127 NaCl, 25 NaHCO3, 1.25 Na2HPO4, 2.5 KCl, 2 CaCl2, 1 MgCl2, 25 glucose, saturated with 95% O2/5% CO2). Data were acquired using ScanImage software (52) and a Multiclamp 700B amplifier, sampled at 10 kHz and filtered at 6 kHz. Offline analysis was performed using NeuroMatic (53).

For eStim and oStim IPSC experiments, simultaneous whole-cell patch clamp recordings were acquired from neighboring mCherry+ and mCherry− pyramidal neurons in superficial CA1. Patch pipettes ( 2–4 MΩ) were filled with CsCl internal solution (in mM: 147 CsCl, 5 Na2-phosphocreatine, 10 HEPES, 2 MgATP, 0.3 Na2GTP, and 2 EGTA, pH=7.3, osmolarity=300 mOsm). When TTX was absent, CsCl internal was supplemented with QX-314 (5 mM).

For eStim, extracellular stimulation of axons within SP or SR was delivered via a theta glass electrode placed in the center of the relevant layer within 100–300 µm laterally of the patched pair’s dendrites. IPSCs were isolated with CPP (10 μM) and NBQX (10 µM).

For oStim, a 488nm LED was pulsed for 2 ms every 10 seconds through a pinhole and 100x objective to create a light spot approximately 40 μm in diameter centered on the somas of the patched pyramidal neurons, to record the SP oIPSC. The light spot was then moved to the midpoint of SR, and the pinhole was opened until an SP response returned, as identified by amplitude and kinetics. The pinhole was then closed until the SP response went away, and the remaining SR oIPSC was recorded. IPSCs were pharmacologically isolated with CPP (10 μM) and NBQX (10 µM), and, except where noted, propagation was restricted with TTX (2 μM) and 4-AP (10 μM).

IPSC experiments were discarded if the holding current was below −500 pA, the series resistance was greater than 25 MΩ, or the series resistance differed by more than 25% between the two cells. Individual traces were vetted for spontaneous events that obscured the evoked IPSC and, if warranted, removed. Individual sweeps were averaged into a single trace, which was treated as a biological replicate.

Theta-burst stimulation (TBS) consisted of a burst of five stimuli delivered at 100 Hz, with 10 bursts delivered at 10 Hz. A WT and gRNA pyramidal neuron were patched simultaneously. Patch pipettes (2–4 MΩ) were filled with K-gluconate internal solution (in mM: 130 Potassium Gluconate, 10 HEPES, 11.5 Na2 phosphocreatine, 0.2 EGTA, 3 Na2 ATP, 0.2 Na GTP, 3 MgCl2, pH=7.2, osmolarity=307 mOsm), and a theta-glass stimulating electrode was placed in SR ~100 μm from the patched neurons’ dendrites. The test stimulus was delivered to evoke an EPSP of ~10 mV in the WT pyramidal neuron. Recordings were switched into voltage clamp, and test stimuli were delivered every 10 seconds until a 3-minute stable baseline was acquired. Recordings were then switched into current clamp, and TBS was delivered. Recordings were then switched back into voltage clamp, and test stimuli were delivered every 10 seconds for the remainder of the experiment. TBS experiments were discarded if the holding current was below −100 pA or if the series resistance was not stable.

Statistics

All statistics were performed and graphs were generated with either R Studio or Graphpad Prism. For pairwise IPSCs, ratio paired t-tests assessed whether gRNA/WT was different from 1.0. For between-pairs analyses, t-tests or ANOVAs with multiple comparisons were performed on the logs of the gRNA/WT ratios. Sample sizes were based on effect size and variance observed in previous descriptions of the NPAS4 phenotype. For TBS, average fold-change over 30 minutes was compared between gRNA and WT pyramidal neurons using a Kolmogorov–Smirnov test. For seizure NPAS4 analysis, paired t-test compared the proportion NPAS4+ cells between hemispheres. Summary statistics are included in Supplementary Table S1.

RESULTS

Methods to explore the EE-induced, NPAS4-dependent reduction in dendritic inhibition.

We sought to test the contribution of genetically defined inhibitory neuron subtypes to the NPAS4-dependent reduction in dendritic inhibition. To do this, we combined Cas9-dependent disruption of the Npas4 gene in CA1 pyramidal neurons with Cre-dependent excitatory opsin expression in genetically defined populations of inhibitory neurons. We generated a gRNA that targets Cas9 to the translational start site (TSS) of the Npas4 gene, as in (11), referred to as “gRNA”through this study. Cutting efficacy was determined by co-transfecting NIH/3T3 mouse fibroblasts with Cas9 and the gRNA followed by sequencing of the Npas4 locus. Expression of the gRNA leads to mutation of the Npas4 TSS (Supplemental Figure S1). We validated the efficacy of Npas4 disruption in vivo with unilateral stereotaxic injection of AAV encoding the gRNA and mCherry (AAV9-gRNA-mCherry) into CA1 of the hippocampus of Cas9+/− mice (postnatal day 14, P14). Ten to 16 days post-injection, mice were given seizures with kainic acid, and NPAS4 was visualized with immunohistochemistry. CA1 pyramidal neurons in the uninjected hemisphere showed robust NPAS4 expression, in sharp contrast to mCherry+ neurons, which did not express NPAS4 (Figure 1A and B), indicating effective Cas9-mediated disruption of the Npas4 gene and NPAS4 protein expression in vivo.

Figure 1: Cas9 Npas4 disruption 4 and spatially restricted optogenetic stimulation reveal the EE-dependent NPAS4 KO inhibitory phenotype.

Figure 1:

Open in a new tab

(A) Confocal images of CA1 from a Cas9+/− mouse after KA-induced seizure. Left (uninjected) and right (injected with AAV9-gRNA-mCherry) hemispheres are shown. NPAS4 (cyan), gRNA-mCherry (red). Scale bar: 10 μm. (B) Quantification of NPAS4 expression in CA1 of uninjected hemisphere (mCherry−) vs injected hemisphere (mCherry+) (paired t-test; n = 4 pairs of hemispheres). (C) Cartoon of experimental timeline. (D) Cartoon of optical stimulation of inhibitory terminals (left). Raw (right top) and peak-normalized (right bottom) oIPSCs in response to illumination of SR (grey) and SP (black) ±SEM. oIPSCs are spatially and pharmacologically isolated with TTX, 4-AP, CPP, and NBQX. Scale bars: 20 ms by 200 pA (raw) and 25% (normalized). (E) Quantification of amplitude, decay tau, and full width at half max (FWHM) from D (n = 16 neurons). (F) Cartoon of paired voltage-clamp recordings with electrical (left) or optical stimulus (right) of inhibitory terminals in SR or SP. (G) eIPSCs (left) and oIPSCs (right) recorded from pairs of WT and gRNA-expressing pyramidal neurons. Mice housed in EE: Individual data points (grey), geometric mean and SEM (filled circle). Mice housed in SE: Individual data points in Supplemental Figure 2, geometric mean and SEM (open circle). Inset: EE condition, IPSC traces recorded from WT (black) and gRNA (red) pyramidal neurons. Traces are shown as geometric mean ± SEM. Scale bars: 40 ms by 100% of WT. (ratio paired t-test; eStim - EE: n = 20 pairs, SE n = 13 pairs. oStim – EE: n = 11 pairs, SE: n = 13 pairs). (H) gRNA / WT IPSC geometric ratios ± SEM of data shown in G. (I) as in G, but IPSCs evoked in SP. Scale bars 40 ms by 50% of WT (ratio paired t-test; eStim - EE: n = 20 pairs, SE: n = 12 pairs. oStim – EE: n = 20 pairs, SE: n = 11 pairs). (J) gRNA / WT IPSC geometric ratios ± SEM of data shown in I. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001

We then assessed whether Cas9-mediated disruption of Npas4 prevents experience-dependent reorganization of inhibition, as observed with Cre-mediated knockout of Npas4 (14). Cas9+/− mice were injected with AAV9-gRNA-mCherry to disrupt Npas4 in a sparse population of CA1 pyramidal neurons. Four days after viral injection, mice were housed in either a standard or enriched environment (SE or EE, respectively) until acute brain slices were prepared (P24-P30). Simultaneous whole-cell voltage-clamp recordings were obtained from neighboring wild-type (WT) and gRNA-expressing CA1 pyramidal neurons. An extracellular stimulating electrode was placed in SP or SR and pharmacologically isolated, electrically-evoked inhibitory postsynaptic currents (eIPSC) were recorded as done previously (14, 15). In mice housed in EE, pairwise comparison showed significantly larger amplitude dendritic and smaller amplitude somatic eIPSCs in gRNA-expressing pyramidal neurons than in neighboring WT pyramidal neurons (Figure 1I and J). These differences were not present in mice housed in SE (Figure 1G, H, I, and J; Supplementary Figure S2A and C). Thus, Cas9-mediated disruption of the Npas4 gene recapitulates the inhibitory synapse phenotype observed with Cre-dependent knock out of Npas4 (14, 15).

Next, we optically evoked IPSCs (oIPSCs) in either the perisomatic region (SP) or proximal apical dendrites (SR) of pyramidal neurons to test the potential of optogenetic stimulation in exploring the NPAS4-dependent reorganization of inhibition. Using Gad2-Cre+/−;Cas9+/− mice, we co-injected AAV9-gRNA-mCherry and an AAV with Cre-dependent oChIEF (54) under either the hSyn or hDlx promoter (AAV2-hSyn-DIO-oChIEF or AAV8-hDlx-DIO-oChIEF) to drive opsin expression in transduced inhibitory neurons (55). As in (32), we specifically stimulated release from presynaptic terminals of soma or dendrite-targeting inhibitory neurons by delivering light through a pinhole (details in methods). TTX was included in the bath to prevent active propagation of action potentials that could trigger release outside of the illuminated region; 4-AP was included to prolong presynaptic depolarization and allow release even in the context of TTX (56) (Figure 1D). oIPSCs evoked by delivering light to SR had characteristically smaller amplitudes and slower kinetics than those evoked by illumination of SP, indicating successful spatial isolation of stimulation (Figure 1D and E) (19).

We then optically stimulated release from inhibitory presynaptic terminals in either the perisomatic region or the proximal apical dendrites while recording from neighboring WT and gRNA-expressing pyramidal neurons. In mice housed in EE, pairwise comparison showed significantly larger amplitude dendritic oIPSCs in gRNA-expressing than in neighboring WT pyramidal neurons (Figure 1G and H). These differences were not present in mice housed in SE (Figure 1G, H, I, and J; Supplemental Figure 2B and D). Thus, optogenetic stimulation of inhibitory inputs in SR combined with Cas9-mediated disruption of the Npas4 gene in pyramidal neurons is sufficient to reveal the EE-induced, NPAS4-dependent reduction in proximal apical dendritic inhibition.

In contrast, and surprisingly given the eStim results (Figure 1G and H), when perisomatic oIPSCs were recorded in the context of TTX and 4-AP, pairwise comparison revealed no difference in amplitude between WT and gRNA-expressing pyramidal neurons (Supplemental Figure 3). Notably, these oIPSCs were very large and broad (Figure 1D), potentially indicating that 4-AP leads to exaggerated presynaptic depolarization and neurotransmitter release from somatic inhibitory synapses, obscuring our ability to detect the phenotype. This is particularly likely as inhibitory synapses made by CCK basket cells have substantial asynchronous release that scales with calcium concentration and increases variability (36). Moreover, because somatic IPSCs are far larger than their dendritic counterparts, and because few axons of passage go through the somatic region, it is possible to record somatic IPSCs even without TTX and 4-AP. As such, we repeated the SP oSim experiment without TTX and 4-AP. In this context, gRNA-expressing pyramidal neurons produced significantly smaller amplitude oIPSCs than did their WT neighbors (Figure 1I and J and Supplemental Figure 2B), mirroring our results with electrical stimulation and consistent with previous reports (14, 15). Collectively, these results demonstrate that Cas9-mediated disruption of the Npas4 gene and spatially restricted optical stimulation of inhibitory terminals are sufficient to reveal the EE-induced, NPAS4-dependent reorganization of inhibition.

NPAS4 reduces inhibition from CCK+ inhibitory neurons onto proximal apical dendrites.

Next, we sought to determine if NPAS4 regulates dendritic inhibitory synapses made by a distinct population of inhibitory neurons. In CA1, nearly all dendrite-targeting inhibitory neurons express SST, PV, NPY, or CCK (44), allowing us to transduce each cell type with greater than 90% specificity (Figure 2A, C, E, and G) using the relevant Cre lines (55, 57). Since CCK is also expressed in many CA1 pyramidal neurons, we further restricted opsin expression to CCK+ inhibitory neurons through the use of a virus with a DLX promoter, or with an additional cross to DLX-Flp mice and injection of AAV encoding a Cre/Flp dependent opsin (55, 57). The different Cre lines were crossed with Cas9 mice, as described for Gad2-Cre above.

Figure 2: EE-induced, NPAS4-dependent reduction in dendritic inhibition from CCK+ inhibitory neurons.

Figure 2:

Open in a new tab

(A) Confocal image of smFISH in CA1 alveus and stratum oriens (SO) from an SST-Cre+/− mouse injected with AAV8-hDlx-DIO-oChIEF. DAPI (blue), SST mRNA (left brown), Gad2 mRNA (left, white), oChIEF mRNA (middle, yellow). White arrows indicate cells positive for both Gad2 and SST mRNA, red arrows indicate Gad2 only. Scale bar 10 μm. Quantification of specificity (spec.) of expression (percent of oChIEF positive cells that are also Gad2 and SST positive) and percent coverage (Cov.) (percent of Gad2 and SST positive cells that are also oChIEF positive) (B) Cartoon of optical stimulation of SST+ inhibitory terminals in SR with paired voltage clamp recordings from WT (black), and gRNA (red) CA1 pyramidal neurons. oIPSCs (right) recorded from pairs of WT and gRNA-expressing pyramidal neurons from mice housed in EE. Individual data points (grey), geometric mean and SEM (filled circle). Inset: oIPSC traces recorded from WT (black) and gRNA (red) pyramidal neurons. Traces are shown as geometric mean ± SEM. Scale bars: 20 ms by 100% of WT. (ratio paired t-test; n = 15 pairs). (C) As in A, but in CA1 SP and SO with PV-Cre+/− mouse, and PV mRNA (left, green). (D) As in B, but with stimulation of PV+ inhibitory terminals in SR. (n = 10 pairs). (E) As in A and C, but in CA1 SP and SR with NPY-Cre+/− mouse, and NPY mRNA (left, cyan). (F) As in B and D, but with NPY+ inhibitory terminals in SR. (ratio paired t-test; n = 13 pairs). (G) As in A, C, and D, but in CA1 SR with CCK-Cre+/− mouse, and CCK mRNA (left, magenta). (H) As in B, D, ‘n F, but with CCK+ inhibitory terminals in SR (ratio paired t-test; n = 14 pairs) and SE housed geometric mean and SEM (open circle) (ratio paired t-test; n = 15 pairs). (I) gRNA / WT IPSC geometric ratios ± SEM of data shown in B, D, F, and H, with shaded horizontal grey band showing EE-Gad-SR SEM (replotted from Figure 1H). (ratio paired t-test for within-pair comparisons; ANOVA with multiple comparisons for between-genotype comparisons; t-test for CCK+ EE-SE comparison) (J) As in B, D, F, and H, but with CCK+ inhibitory terminals in SP (ratio paired t-test; n =11 pairs). (K) gRNA / WT IPSC geometric ratios ± SEM of data shown in J, with a shaded horizontal grey band showing EE-Gad-SP SEM (replotted from Figure1J).

Optical stimulation of SST+, PV+, and NPY+ terminals in SR revealed no difference in oIPSC amplitude between WT and gRNA-expressing pyramidal neurons (Figure 2B, D, F, and I). In stark contrast, optical stimulation of CCK+ inhibitory presynaptic terminals produced significantly larger amplitude oIPSCs in gRNA-expressing pyramidal neurons than in the neighboring WT neuron, with gRNA oIPSCs approximately twice as large as WT (Figure 2H). This difference was not present in mice housed in SE (Figure 2H and I; Supplemental Figure S4). In addition to the gRNA vs WT pairwise difference, the average gRNA/WT oIPSC log ratio from CCK+ stimulation was significantly larger than that from SST+, PV+, and NPY+ stimulation (Figure 2I), indicating that the EE-induced, NPAS4-dependent reduction of proximal apical dendritic inhibition is specific to synapses made by CCK+ inhibitory neurons.

Finally, we confirmed that the EE-induced, NPAS4-dependent increase in perisomatic inhibition results from an increase in CCK+ inhibition, as has been shown previously (15, 58). In mice housed in an EE and without bath-applied TTX and 4-AP, optogenetic stimulation of CCK+ terminals in SP produced smaller oIPSCs in gRNA-expressing pyramidal neurons than in their WT neighbors (Figure 2J and K). Notably, CCK+ basket cells exclusively form synapses on the soma of pyramidal neurons, whereas dendrite-targeting CCK+ inhibitory neurons specifically synapse onto pyramidal neuron dendrites (59). This suggests that the distinct changes observed in the NPAS4 phenotype arise from the regulation of synapses from separate subpopulations of CCK+ inhibitory neurons.

NPAS4-dependent changes in CCK+ inhibition facilitate theta-burst synaptic plasticity.

How does NPAS4-dependent reorganization of CCK+ inhibition impact CA1 pyramidal neuron function? Excitatory synaptic plasticity at Schaffer collateral synapses is a core mechanism through which long-term explicit memories are formed, but many slice physiology paradigms for inducing plasticity require pharmacological blockade of synaptic inhibition. One exception is theta-burst stimulation (TBS) plasticity, wherein bursts of synaptic inputs from the Schaffer-collaterals, approximating the endogenous theta rhythm, produce pronounced excitatory potentiation even with inhibition intact (theta stimulation: 1 burst = 5 stimuli at 100 Hz; 10 bursts delivered with 100 ms inter-burst interval; Figure 3A) (60, 61). Dendritic inhibition gates excitatory synaptic plasticity generally (29–33), and dendrite targeting, CB1R-expressing, presumably CCK+ (39, 41, 42) inhibition suppresses TBS plasticity in particular (48). Given the dramatic NPAS4-dependent reduction in CCK+ dendritic inhibition, we hypothesized that NPAS4 facilitates TBS excitatory synaptic potentiation.

Figure 3: NPAS4-dependent changes in CB1R-sensitive inhibition facilitate TBS plasticity.

Figure 3:

Open in a new tab

(A) Example traces of the TBS protocol (left), and cartoon of experimental setup (right). Scale bar 20 ms by 150 pA. (B) (Left) time course of 1-minute binned average normalized EPSC measurements before (WT: grey, gRNA: pink) and after (WT: black, gRNA: red) TBS, with inset example traces (scale bar: 20 ms by 100% of pre). (Right) Cumulative distribution of average EPSC fold changes following TBS, shaded columns ± SEM around mean. (KS test; n = 15 WT, 13 gRNA). (C) As in B, but with 10 μM Gabazine (KS test; n = 8 WT, 9 gRNA). (D) As in B and C, but with 5 μM WIN 55,212–2 (KS test; n = 9 WT, 7 gRNA). * p < 0.05.

To test this, we stimulated Schaffer collaterals with a TBS pattern while recording from WT and/or gRNA-expressing pyramidal neurons from EE-housed mice. Potentiation was observed in both WT and gRNA-expressing pyramidal neurons over a 30-minute period, but synapses on WT pyramidal neurons demonstrated nearly twice the potentiation as the gRNA-expressing neurons (Figure 3B). Next, to test the contribution of synaptic inhibition to this difference, we blocked GABA-A receptors with Gabazine (10 μM). Indeed, in this context, both WT and gRNA-expressing pyramidal neurons produced substantial potentiation and were not statistically different from each other (Figure 3C). Finally, we probed the specific role of CCK+ inhibition by pharmacologically preventing transmission from this inhibitory neuron population. Activation of cannabinoid receptors (CB1Rs), which are predominantly expressed at CCK+ presynaptic terminals, have been shown to suppress transmission from CCK+ but not other inhibitory neurons in CA1 (39, 41, 42). Thus, we repeated the TBS plasticity experiment in the presence of WIN 55,212–2 (5 μM), a potent and selective CB1R agonist which at 5uM can block transmission from dendrite targeting CCK+ inhibitory neurons (42). In this context, both WT and gRNA-expressing pyramidal neurons produced substantial and statistically comparable levels of synaptic potentiation, although the time course was notably different from the gabazine or no-drug conditions. (Figure 3D). Thus, NPAS4-induced changes in CCK+, presumably dendritic, inhibition underlie the NPAS4-dependent facilitation of TBS plasticity.

DISCUSSION

These and earlier (14, 15) experiments show that CA1 pyramidal neurons undergo an NPAS4-dependent reorganization of inhibition in response to environmental enrichment, with increased somatic and reduced dendritic inhibition both mediated by modification of synaptic input from anatomically distinct populations of CCK+ inhibitory neurons. This reorganization results in the facilitation of TBS synaptic potentiation, likely via the reduction in CCK+ dendritic inhibition, and renders pyramidal neurons more sensitive to DSI at somatic CCK+ synapses (15).

While these experiments provide new insight into NPAS4-regulated neurobiology, several questions remain. The optogenetic approach used here cannot distinguish whether the reduction in dendritic inhibition reflects a decrease in the number of CCK+ synapses, a weakening of their strength, or both. Prior work has shown that the NPAS4-dependent increase in somatic inhibition is driven by an increase in synapse number, suggesting the opposite may be true for dendritic inhibition; however, limitations in our approach preclude this assessment. Additionally, the time course of TBS-induced plasticity differs notably across pharmacological conditions, with antagonism of CB1Rs leading to a pronounced early enhancement of plasticity that declines over time. This suggests that WIN-sensitive inhibition may modulate the expression of TBS plasticity in a distinct manner compared to other sources of inhibition, although alternative explanations cannot be excluded.

Recent work provides insight into the role of CCK+ inhibitory neurons in the CA1 microcircuit. In sharp contrast to PV+ inhibitory neurons, CCKs are highly active during periods of inaction, when an animal stops running or sleeps (35, 38, 62). In addition, CCKs preferentially fire in the trough of theta, are highly active during ripples, gate burst-firing, and shape theta phase precession (38). These studies have not discriminated between soma and dendrite targeting CCKs, but the role of dendritic inhibition in gating burst firing, and of somatic inhibition in controlling action potential timing, is well established.

We speculate that in vivo, the role of NPAS4 in CA1 is to open a window of plasticity while tightening the specificity of firing. Less dendritic CCK+ inhibition would increase the frequency of bursts and associated dendritic calcium events, lower the threshold for synaptic plasticity, and potentially heighten learning. More perisomatic CCK+ inhibition would reduce out-of-field firing and tighten temporal entrainment of spikes to key oscillations in the local field potential, with enhanced DSI (15) allowing task-relevant neurons to more readily escape the inhibitory veto (43). This could be particularly important during sharp-wave ripples when CCK+ inhibitory neurons are highly active (38) and only recently active pyramidal neurons are allowed to fire action potentials (63), or in phase precession when the precise timing of firing encodes information about an animal’s path (64, 65).

That environmental enrichment enhances human neurological flexibility and dynamism is well established, in healthy and pathological contexts (16). Suitably enriched environments are critical for appropriate development (66–68) and the maintenance of cognitive function into old age (69). Environmental enrichment ameliorates symptoms of a variety of neurological disorders, including autism spectrum disorder (70), Alzheimer’s (71), schizophrenia (72, 73), intellectual disability (74), depression (75, 76), and stroke (77). NPAS4 is the most down-regulated gene in post-mortem brain tissue from patients with suicidal depression (78), and the capacity of the SSRI fluoxetine to re-open the critical period of plasticity in visual cortex in mice depends upon NPAS4 (10). Though NPAS4 is certainly not the sole mediator of EE enhancement of neural dynamism, these results suggest that future research should explore NPAS4’s role, and its therapeutic potential, in this process.

Supplementary Material

Supplementary Table S1 and Figures S1–S4: https://doi.org/10.17605/OSF.IO/6YX9J

ACKNOWLEDGMENTS

Special thanks to the UC San Diego Nikon Imaging Center.

GRANTS

The study was supported by F31MH124355 (DAH), R01NS111162 (BLB) and 5R01GM148640 (KLC).

Footnotes

DISCLOSURES

The authors declare no competing interests.

DATA AVAILABILITY

Source data for this study are openly available at https://doi.org/10.17605/OSF.IO/Q5XGK

REFERENCES

  • 1.Magee JC, Grienberger C. Synaptic Plasticity Forms and Functions. Annu Rev Neurosci 43: 95–117, 2020. doi: 10.1146/annurev-neuro-090919-022842. [DOI] [PubMed] [Google Scholar]
  • 2.Holtmaat A, Svoboda K. Experience-dependent structural synaptic plasticity in the mammalian brain. Nat Rev Neurosci 10: 647–658, 2009. doi: 10.1038/nrn2699. [DOI] [PubMed] [Google Scholar]
  • 3.Bonfanti L, Charvet CJ. Brain Plasticity in Humans and Model Systems: Advances, Challenges, and Future Directions. Int J Mol Sci 22: 9358, 2021. doi: 10.3390/ijms22179358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Heinz DA, Bloodgood BL. Mechanisms that communicate features of neuronal activity to the genome. Curr Opin Neurobiol 63: 131–136, 2020. doi: 10.1016/j.conb.2020.03.002. [DOI] [PubMed] [Google Scholar]
  • 5.Tyssowski KM, DeStefino NR, Cho J-H, Dunn CJ, Poston RG, Carty CE, Jones RD, Chang SM, Romeo P, Wurzelmann MK, Ward JM, Andermann ML, Saha RN, Dudek SM, Gray JM. Different Neuronal Activity Patterns Induce Different Gene Expression Programs. Neuron 98: 530–546.e11, 2018. doi: 10.1016/j.neuron.2018.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yap E-L, Greenberg ME. Activity-regulated transcription: Bridging the gap between neural activity and behavior. Neuron 100: 330–348, 2018. doi: 10.1016/j.neuron.2018.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lin Y, Bloodgood BL, Hauser JL, Lapan AD, Koon AC, Kim T-K, Hu LS, Malik AN, Greenberg ME. Activity-dependent regulation of inhibitory synapse development by Npas4. Nature 455: 1198–1204, 2008. doi: 10.1038/nature07319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sun X, Lin Y. Npas4: Linking Neuronal Activity to Memory. Trends Neurosci 39: 264–275, 2016. doi: 10.1016/j.tins.2016.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Taniguchi M, Carreira MB, Cooper YA, Bobadilla A-C, Heinsbroek JA, Koike N, Larson EB, Balmuth EA, Hughes BW, Penrod RD, Kumar J, Smith LN, Guzman D, Takahashi JS, Kim T-K, Kalivas PW, Self DW, Lin Y, Cowan CW. HDAC5 and its target gene, NPAS4, function in the nucleus accumbens to regulate cocaine conditioned behaviors. Neuron 96: 130–144.e6, 2017. doi: 10.1016/j.neuron.2017.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Maya-Vetencourt JF, Tiraboschi E, Greco D, Restani L, Cerri C, Auvinen P, Maffei L, Castrén E. Experience-dependent expression of NPAS4 regulates plasticity in adult visual cortex. J Physiol 590: 4777–4787, 2012. doi: 10.1113/jphysiol.2012.234237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yang J, Serrano P, Yin X, Sun X, Lin Y, Chen SX. Functionally distinct NPAS4-expressing somatostatin interneuron ensembles critical for motor skill learning. Neuron 110: 3339–3355.e8, 2022. doi: 10.1016/j.neuron.2022.08.018. [DOI] [PubMed] [Google Scholar]
  • 12.Weng F-J, Garcia RI, Lutzu S, Alviña K, Zhang Y, Dushko M, Ku T, Zemoura K, Rich D, Garcia-Dominguez D, Hung M, Yelhekar TD, Sørensen AT, Xu W, Chung K, Castillo PE, Lin Y. Npas4 Is a Critical Regulator of Learning-induced Plasticity at Mossy Fiber-CA3 Synapses During Contextual Memory Formation. Neuron 97: 1137–1152.e5, 2018. doi: 10.1016/j.neuron.2018.01.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hughes BW, Siemsen BM, Tsvetkov E, Berto S, Kumar J, Cornbrooks RG, Akiki RM, Cho JY, Carter JS, Snyder KK, Assali A, Scofield MD, Cowan CW, Taniguchi M. NPAS4 in the medial prefrontal cortex mediates chronic social defeat stress-induced anhedonia-like behavior and reductions in excitatory synapses. eLife 12: e75631, 2023. doi: 10.7554/eLife.75631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bloodgood BL, Sharma N, Browne HA, Trepman AZ, Greenberg ME. The activity-dependent transcription factor NPAS4 regulates domain-specific inhibition. Nature 503: 121–125, 2013. doi: 10.1038/nature12743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hartzell AL, Martyniuk KM, Brigidi GS, Heinz DA, Djaja NA, Payne A, Bloodgood BL. NPAS4 recruits CCK basket cell synapses and enhances cannabinoid-sensitive inhibition in the mouse hippocampus. eLife 7: e35927, 2018. doi: 10.7554/eLife.35927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sale A, Berardi N, Maffei L. Environment and Brain Plasticity: Towards an Endogenous Pharmacotherapy. Physiol Rev 94: 189–234, 2014. doi: 10.1152/physrev.00036.2012. [DOI] [PubMed] [Google Scholar]
  • 17.Ishiwari K, King CP, Martin CD, Tripi JA, George AM, Lamparelli AC, Chitre AS, Polesskaya O, Richards JB, Solberg Woods LC, Gancarz AM, Palmer AA, Dietz DM, Mitchell SH, Meyer PJ. Environmental enrichment promotes adaptive responding during tests of behavioral regulation in male heterogeneous stock rats. Sci Rep 14: 4182, 2024. doi: 10.1038/s41598-024-53943-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Simpson J, Kelly JP. The impact of environmental enrichment in laboratory rats—Behavioural and neurochemical aspects. Behav Brain Res 222: 246–264, 2011. doi: 10.1016/j.bbr.2011.04.002. [DOI] [PubMed] [Google Scholar]
  • 19.Miles R, Tóth K, Gulyás AI, Hájos N, Freund TF. Differences between Somatic and Dendritic Inhibition in the Hippocampus. Neuron 16: 815–823, 1996. doi: 10.1016/S0896-6273(00)80101-4. [DOI] [PubMed] [Google Scholar]
  • 20.Freund TF, Katona I. Perisomatic Inhibition. Neuron 56: 33–42, 2007. doi: 10.1016/j.neuron.2007.09.012. [DOI] [PubMed] [Google Scholar]
  • 21.Hao J, Wang X, Dan Y, Poo M, Zhang X. An arithmetic rule for spatial summation of excitatory and inhibitory inputs in pyramidal neurons. Proc Natl Acad Sci 106: 21906–21911, 2009. doi: 10.1073/pnas.0912022106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Milstein AD, Bloss EB, Apostolides PF, Vaidya SP, Dilly GA, Zemelman BV, Magee JC. Inhibitory Gating of Input Comparison in the CA1 Microcircuit. Neuron 87: 1274–1289, 2015. doi: 10.1016/j.neuron.2015.08.025. [DOI] [PubMed] [Google Scholar]
  • 23.Grienberger C, Chen X, Konnerth A. NMDA Receptor-Dependent Multidendrite Ca2+ Spikes Required for Hippocampal Burst Firing In Vivo. Neuron 81: 1274–1281, 2014. doi: 10.1016/j.neuron.2014.01.014. [DOI] [PubMed] [Google Scholar]
  • 24.Jadi M, Polsky A, Schiller J, Mel BW. Location-Dependent Effects of Inhibition on Local Spiking in Pyramidal Neuron Dendrites. PLOS Comput Biol 8: e1002550, 2012. doi: 10.1371/journal.pcbi.1002550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lovett-Barron M, Turi GF, Kaifosh P, Lee PH, Bolze F, Sun X-H, Nicoud J-F, Zemelman BV, Sternson SM, Losonczy A. Regulation of neuronal input transformations by tunable dendritic inhibition. Nat Neurosci 15: 423–430, S1–3, 2012. doi: 10.1038/nn.3024. [DOI] [PubMed] [Google Scholar]
  • 26.Müllner FE, Wierenga CJ, Bonhoeffer T. Precision of Inhibition: Dendritic Inhibition by Individual GABAergic Synapses on Hippocampal Pyramidal Cells Is Confined in Space and Time. Neuron 87: 576–589, 2015. doi: 10.1016/j.neuron.2015.07.003. [DOI] [PubMed] [Google Scholar]
  • 27.Rhodes P The Properties and Implications of NMDA Spikes in Neocortical Pyramidal Cells. J Neurosci 26: 6704–6715, 2006. doi: 10.1523/JNEUROSCI.3791-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tsubokawa H, Ross WN. IPSPs modulate spike backpropagation and associated [Ca2+]i changes in the dendrites of hippocampal CA1 pyramidal neurons. J Neurophysiol 76: 2896–2906, 1996. doi: 10.1152/jn.1996.76.5.2896. [DOI] [PubMed] [Google Scholar]
  • 29.Wilmes KA, Sprekeler H, Schreiber S. Inhibition as a Binary Switch for Excitatory Plasticity in Pyramidal Neurons. PLOS Comput Biol 12: e1004768, 2016. doi: 10.1371/journal.pcbi.1004768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bar-Ilan L, Gidon A, Segev I. The role of dendritic inhibition in shaping the plasticity of excitatory synapses. Front Neural Circuits 6: 118, 2013. doi: 10.3389/fncir.2012.00118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Douglas RM, Goddard GV, Riives M. Inhibitory modulation of long-term potentiation: Evidence for a postsynaptic locus of control. Brain Res 240: 259–272, 1982. doi: 10.1016/0006-8993(82)90221-9. [DOI] [PubMed] [Google Scholar]
  • 32.Schulz JM, Knoflach F, Hernandez M-C, Bischofberger J. Dendrite-targeting interneurons control synaptic NMDA-receptor activation via nonlinear α5-GABAA receptors. Nat Commun 9: 3576, 2018. doi: 10.1038/s41467-018-06004-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Steele PM, Mauk MD. Inhibitory control of LTP and LTD: stability of synapse strength. J Neurophysiol 81: 1559–1566, 1999. doi: 10.1152/jn.1999.81.4.1559. [DOI] [PubMed] [Google Scholar]
  • 34.Pouille F, Scanziani M. Enforcement of Temporal Fidelity in Pyramidal Cells by Somatic Feed-Forward Inhibition. Science 293: 1159–1163, 2001. doi: 10.1126/science.1060342. [DOI] [PubMed] [Google Scholar]
  • 35.Dudok B, Klein PM, Hwaun E, Lee BR, Yao Z, Fong O, Bowler JC, Terada S, Sparks FT, Szabo GG, Farrell JS, Berg J, Daigle TL, Tasic B, Dimidschstein J, Fishell G, Losonczy A, Zeng H, Soltesz I. Alternating sources of perisomatic inhibition during behavior. Neuron 109: 997–1012.e9, 2021. doi: 10.1016/j.neuron.2021.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Daw MI, Tricoire L, Erdelyi F, Szabo G, McBain CJ. Asynchronous Transmitter Release from Cholecystokinin-Containing Inhibitory Interneurons Is Widespread and Target-Cell Independent. J Neurosci 29: 11112–11122, 2009. doi: 10.1523/JNEUROSCI.5760-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hefft S, Jonas P. Asynchronous GABA release generates long-lasting inhibition at a hippocampal interneuron–principal neuron synapse. Nat Neurosci 8: 1319–1328, 2005. doi: 10.1038/nn1542. [DOI] [PubMed] [Google Scholar]
  • 38.Guerrero DKR, Balueva K, Barayeu U, Baracskay P, Gridchyn I, Nardin M, Roth CN, Wulff P, Csicsvari J. Hippocampal cholecystokinin-expressing interneurons regulate temporal coding and contextual learning. Neuron 112: 2045–2061.e10, 2024. doi: 10.1016/j.neuron.2024.03.019. [DOI] [PubMed] [Google Scholar]
  • 39.Katona I, Sperlágh B, Sík A, Käfalvi A, Vizi ES, Mackie K, Freund TF. Presynaptically Located CB1 Cannabinoid Receptors Regulate GABA Release from Axon Terminals of Specific Hippocampal Interneurons. J Neurosci 19: 4544–4558, 1999. doi: 10.1523/JNEUROSCI.19-11-04544.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Glickfeld LL, Scanziani M. Distinct timing in the activity of cannabinoid-sensitive and cannabinoid-insensitive basket cells. Nat Neurosci 9: 807–815, 2006. doi: 10.1038/nn1688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wilson RI, Nicoll RA. Endogenous cannabinoids mediate retrograde signalling at hippocampal synapses. Nature 410: 588–592, 2001. doi: 10.1038/35069076. [DOI] [PubMed] [Google Scholar]
  • 42.Lee S-H, Földy C, Soltesz I. Distinct Endocannabinoid Control of GABA Release at Perisomatic and Dendritic Synapses in the Hippocampus. J Neurosci 30: 7993–8000, 2010. doi: 10.1523/JNEUROSCI.6238-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dudok B, Fan LZ, Farrell JS, Malhotra S, Homidan J, Kim DK, Wenardy C, Ramakrishnan C, Li Y, Deisseroth K, Soltesz I. Retrograde endocannabinoid signaling at inhibitory synapses in vivo. Science 383: 967–970, 2024. doi: 10.1126/science.adk3863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Harris KD, Hochgerner H, Skene NG, Magno L, Katona L, Gonzales CB, Somogyi P, Kessaris N, Linnarsson S, Hjerling-Leffler J. Classes and continua of hippocampal CA1 inhibitory neurons revealed by single-cell transcriptomics. PLOS Biol 16: e2006387, 2018. doi: 10.1371/journal.pbio.2006387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pelkey KA, Chittajallu R, Craig MT, Tricoire L, Wester JC, McBain CJ. Hippocampal GABAergic Inhibitory Interneurons. Physiol Rev 97: 1619–1747, 2017. doi: 10.1152/physrev.00007.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Somogyi P, Katona L, Klausberger T, Lasztóczi B, Viney TJ. Temporal redistribution of inhibition over neuronal subcellular domains underlies state-dependent rhythmic change of excitability in the hippocampus. Philos Trans R Soc B Biol Sci 369: 20120518, 2014. doi: 10.1098/rstb.2012.0518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Basu J, Zaremba JD, Cheung SK, Hitti FL, Zemelman BV, Losonczy A, Siegelbaum SA. Gating of hippocampal activity, plasticity, and memory by entorhinal cortex long-range inhibition. Science 351: aaa5694, 2016. doi: 10.1126/science.aaa5694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chevaleyre V, Castillo PE. Endocannabinoid-Mediated Metaplasticity in the Hippocampus. Neuron 43: 871–881, 2004. doi: 10.1016/j.neuron.2004.08.036. [DOI] [PubMed] [Google Scholar]
  • 49.Chevaleyre V, Castillo PE. Heterosynaptic LTD of Hippocampal GABAergic Synapses: A Novel Role of Endocannabinoids in Regulating Excitability. Neuron 38: 461–472, 2003. doi: 10.1016/S0896-6273(03)00235-6. [DOI] [PubMed] [Google Scholar]
  • 50.Bloss EB, Cembrowski MS, Karsh B, Colonell J, Fetter RD, Spruston N. Structured Dendritic Inhibition Supports Branch-Selective Integration in CA1 Pyramidal Cells. Neuron 89: 1016–1030, 2016. doi: 10.1016/j.neuron.2016.01.029. [DOI] [PubMed] [Google Scholar]
  • 51.Ting JT, Lee BR, Chong P, Soler-Llavina G, Cobbs C, Koch C, Zeng H, Lein E. Preparation of Acute Brain Slices Using an Optimized N-Methyl-D-glucamine Protective Recovery Method. J Vis Exp JoVE : 53825, 2018. doi: 10.3791/53825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Pologruto TA, Sabatini BL, Svoboda K. ScanImage: Flexible software for operating laser scanning microscopes. Biomed Eng OnLine 2: 13, 2003. doi: 10.1186/1475-925X-2-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rothman JS, Silver RA. NeuroMatic: An Integrated Open-Source Software Toolkit for Acquisition, Analysis and Simulation of Electrophysiological Data. Front Neuroinformatics 12: 14, 2018. doi: 10.3389/fninf.2018.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Lin JY, Lin MZ, Steinbach P, Tsien RY. Characterization of engineered channelrhodopsin variants with improved properties and kinetics. Biophys J 96: 1803–1814, 2009. doi: 10.1016/j.bpj.2008.11.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Dimidschstein J, Chen Q, Tremblay R, Rogers S, Saldi G, Guo L, Xu C, Liu R, Lu C, Chu J, Avery M, Rashid S, Baek M, Jacob A, Smith G, Wilson D, Kosche G, Kruglikov I, Rusielewicz T, Kotak V, Mowery T, Anderson S, Callaway E, Dasen J, Fitzpatrick D, Fossati V, Long M, Noggle S, Reynolds J, Sanes D, Rudy B, Feng G, Fishell G. A viral strategy for targeting and manipulating interneurons across vertebrate species. Nat Neurosci 19: 1743–1749, 2016. doi: 10.1038/nn.4430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Petreanu L, Mao T, Sternson S, Svoboda K. The subcellular organization of neocortical excitatory connections. Nature 457: 1142–1145, 2009. doi: 10.1038/nature07709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Taniguchi H, He M, Wu P, Kim S, Paik R, Sugino K, Kvitsani D, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB, Huang ZJ. A Resource of Cre Driver Lines for Genetic Targeting of GABAergic Neurons in Cerebral Cortex. Neuron 71: 995–1013, 2011. doi: 10.1016/j.neuron.2011.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Brito DVC, Kupke J, Sokolov R, Cambridge S, Both M, Bengtson CP, Rozov A, Oliveira AMM. Biphasic Npas4 expression promotes inhibitory plasticity and suppression of fear memory consolidation in mice. Mol Psychiatry 29: 1929–1940, 2024. doi: 10.1038/s41380-024-02454-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Cope DW, Maccaferri G, Márton LF, Roberts JDB, Cobden PM, Somogyi P. Cholecystokinin-immunopositive basket and Schaffer collateral-associated interneurones target different domains of pyramidal cells in the CA1 area of the rat hippocampus. Neuroscience 109: 63–80, 2002. doi: 10.1016/S0306-4522(01)00440-7. [DOI] [PubMed] [Google Scholar]
  • 60.Larson J, Munkácsy E. Theta-Burst LTP. Brain Res 1621: 38–50, 2015. doi: 10.1016/j.brainres.2014.10.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Larson J, Wong D, Lynch G. Patterned stimulation at the theta frequency is optimal for the induction of hippocampal long-term potentiation. Brain Res 368: 347–350, 1986. doi: 10.1016/0006-8993(86)90579-2. [DOI] [PubMed] [Google Scholar]
  • 62.Geiller T, Vancura B, Terada S, Troullinou E, Chavlis S, Tsagkatakis G, Tsakalides P, Ócsai K, Poirazi P, Rózsa BJ, Losonczy A. Large-Scale 3D Two-Photon Imaging of Molecularly Identified CA1 Interneuron Dynamics in Behaving Mice. Neuron 108: 968–983.e9, 2020. doi: 10.1016/j.neuron.2020.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Nádasdy Z, Hirase H, Czurkó A, Csicsvari J, Buzsáki G. Replay and Time Compression of Recurring Spike Sequences in the Hippocampus. J Neurosci 19: 9497–9507, 1999. doi: 10.1523/JNEUROSCI.19-21-09497.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Dragoi G, Buzsáki G. Temporal encoding of place sequences by hippocampal cell assemblies. Neuron 50: 145–157, 2006. doi: 10.1016/j.neuron.2006.02.023. [DOI] [PubMed] [Google Scholar]
  • 65.O’Keefe J, Recce ML. Phase relationship between hippocampal place units and the EEG theta rhythm. Hippocampus 3: 317–330, 1993. doi: 10.1002/hipo.450030307. [DOI] [PubMed] [Google Scholar]
  • 66.Christensen DL, Schieve LA, Devine O, Drews-Botsch C. Socioeconomic status, child enrichment factors, and cognitive performance among preschool-age children: Results from the Follow-Up of Growth and Development Experiences study. Res Dev Disabil 35: 1789–1801, 2014. doi: 10.1016/j.ridd.2014.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Han Y, Yuan M, Guo Y-S, Shen X-Y, Gao Z-K, Bi X. The role of enriched environment in neural development and repair. Front Cell Neurosci 16, 2022. doi: 10.3389/fncel.2022.890666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Tooley UA, Bassett DS, Mackey AP. Environmental influences on the pace of brain development. Nat Rev Neurosci 22: 372–384, 2021. doi: 10.1038/s41583-021-00457-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Cintoli S, Radicchi C, Noale M, Maggi S, Meucci G, Tognoni G, Bonuccelli U, Sale A, Berardi N, Maffei L, Maffei L, Picano E, Andreassi MG, Angelucci A, Baldacci F, Baroncelli L, Begenisic T, Bellinvia PF, Berardi N, Biagi L, Bonaccorsi J, Bonanni E, Bonuccelli U, Borghini A, Braschi C, Broccardi M, Bruno RM, Caleo M, Carlesi C, Carnicelli L, Cartoni G, Cecchetti L, Cenni MC, Ceravolo R, Chico L, Cintoli S, Cioni G, Coscia M, Costa M, D’Angelo G, D’Ascanio P, De Nes M, Del Turco S, Di Coscio E, Di Galante M, di Lascio N, Faita F, Falorni I, Faraguna U, Fenu A, Fortunato L, Franco R, Gargani L, Gargiulo R, Ghiadoni L, Giorgi FS, Iannarella R, Iofrida C, Kusmic C, Limongi F, Maestri M, Maffei M, Maggi S, Mainardi M, Mammana L, Marabotti A, Mariotti V, Melissari E, Mercuri A, Micera S, Molinaro S, Narducci R, Navarra T, Noale M, Pagni C, Palumbo S, Pasquariello R, Pellegrini S, Pietrini P, Pizzorusso T, Poli A, Pratali L, Retico A, Ricciardi E, Rota G, Sale A, Sbrana S, Scabia G, Scali M, Scelfo D, Sicari R, Siciliano G, Stea F, Taddei S, Tognoni G, Tonacci A, Tosetti M, Turchi S, Volpi L, Train the Brain Consortium. Effects of combined training on neuropsychiatric symptoms and quality of life in patients with cognitive decline. Aging Clin Exp Res 33: 1249–1257, 2021. doi: 10.1007/s40520-019-01280-w. [DOI] [PubMed] [Google Scholar]
  • 70.Woo CC, Donnelly JH, Steinberg-Epstein R, Leon M. Environmental Enrichment as a Therapy for Autism: A Clinical Trial Replication and Extension. Behav Neurosci 129: 412–422, 2015. doi: 10.1037/bne0000068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Chen X, Hu J, Sun A. The Beneficial Effect of Enriched Environment on Pathogenesis of Alzheimer’s Disease. Yangtze Med 2: 225–243, 2018. doi: 10.4236/ym.2018.24025. [DOI] [Google Scholar]
  • 72.Arraes GC, Barreto FS, Vasconcelos GS, Lima CN de C, da Silva FER, Ribeiro WLC, de Sousa FCF, Furtado CLM, Macêdo DS. Long-term Environmental Enrichment Normalizes Schizophrenia-like Abnormalities and Promotes Hippocampal Slc6a4 Promoter Demethylation in Mice Submitted to a Two-hit Model. Neuroscience 551: 205–216, 2024. doi: 10.1016/j.neuroscience.2024.05.023. [DOI] [PubMed] [Google Scholar]
  • 73.Raine A, Mellingen K, Liu J, Venables P, Mednick SA. Effects of Environmental Enrichment at Ages 3–5 Years on Schizotypal Personality and Antisocial Behavior at Ages 17 and 23 Years. Am J Psychiatry 160: 1627–1635, 2003. doi: 10.1176/appi.ajp.160.9.1627. [DOI] [PubMed] [Google Scholar]
  • 74.Villouta-Gutiérrez O, Pérez-Villalobos C, Rojas-Ponce R, Sáez-Delgado F. Environmental enrichment and intellectual disability: Systematic review of neurocognitive effects in children and adolescents. Rev Mex Neurocienc 23, 2022. doi: 10.24875/RMN.21000012. [DOI] [Google Scholar]
  • 75.Flores-Ramos M, Yoldi-Negrete M, Guiza-Zayas R, Ramírez-Rodríguez G-B, Montes-Castrejón A, Fresán A. An Indicator of environmental enrichment to measure physical, social and cognitive activities in human daily life. BMC Psychiatry 22: 295, 2022. doi: 10.1186/s12888-022-03952-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Zhang Y-M, Wei R-M, Li X-Y, Feng Y-Z, Zhang K-X, Ge Y-J, Kong X-Y, Liu X-C, Chen G-H. Long-term environmental enrichment overcomes depression, learning, and memory impairment in elderly CD-1 mice with maternal sleep deprivation exposure. Front Aging Neurosci 15: 1177250, 2023. doi: 10.3389/fnagi.2023.1177250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Neves LT, Paz LV, Wieck A, Mestriner RG, de Miranda Monteiro VAC, Xavier LL. Environmental Enrichment in Stroke Research: an Update. Transl Stroke Res 15: 339–351, 2024. doi: 10.1007/s12975-023-01132-w. [DOI] [PubMed] [Google Scholar]
  • 78.Selçuk B, Aksu T, Dereli O, Adebali O. Downregulated NPAS4 in multiple brain regions is associated with major depressive disorder. Sci Rep 13: 21596, 2023. doi: 10.1038/s41598-023-48646-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Source data for this study are openly available at https://doi.org/10.17605/OSF.IO/Q5XGK

RESOURCES