The Association of ITGBL1 and LPPR4/PRG1 Expression Profile in Patients with Prostate Cancer History

Abstract

Background:

Prostate cancer is ranked as the most widespread malignancy, among men with the second level of mortality in the United States after lung cancer. Despite the low frequency of prostate cancer incidence in Iran, it has been informed as the fourth most predominant cancer among men with 6% of all deaths from cancer. Recent studies suggest that several hot spot points are indirectly associated with the incidence of prostate neoplasm. Our study aimed to test whether two different ITGBL1 and LPPR4/PRG1 gene expression levels are linked with prostate cancer incidence.

Materials and Methods:

40 prostate tissue biopsies representing confirmed cancer and 41 normal tissues were selected. RNA extraction, cDNA synthesis, and TaqMan Real-time PCR were done according to the standard guidelines.

Results:

Among all 81 biopsy samples that were analyzed, expression levels of ITGBL1 have been significantly elevated in patients with prostate cancer. Also, the results of the present study showed that there was no significant correlation between LPPR4/PRG1 expression levels (2.79 ± 3.83) with prostate cancer incidence, while there has been no association between LPPR4/PRG1 expression levels (1.85 ± 1.55) in a patient with prostate cancer history out of control.

Conclusion:

According to the role of ITGBL1 in several tumor phenotypes, we cannot ignore the importance of ITGBL1 genes as one of the critical regulatory proteins in prostate cancer development or progression. Therefore, more studies are required to explore the associations of prostate cancer with these regulatory proteins in more Iranian populations.

INTRODUCTION

According to 2020 GLOBOCAN reports, prostate cancer is ranked as the most abandon n abandoned non-skin malignancy in men worldwide with a low incidence rate in the southeast despite the increasing trend of prostate incidence worldwide, the latest report showed that the incidence of prostate malignancy in the Iranian population is relatively low (Age-Standardized Incidence Rate (ASR) = 9.11/100,000), compared to Turkey as one of the Asian countries (40.6/100,000) and Lebanon (37.2/100,000).[1,2,3] Several factors like hereditary inflammation, age, lifestyle, testosterone levels and environmental factors, are well-known to be related to the prostate cancer susceptibility.[4,5] Prostate cancer progression and prognosis are weaker in developing countries since they lack access to screening techniques, which leads to late detection of prostate cancer to its late stages.[6,7] In developed countries, the decline in mortality rates is mainly due to the improvements in diagnostic methods, like Prostate Specific Antigen (PSA) level measurement, and better access to healthcare.[8] Consequently, it is vital to provide biomarkers that can be used to predict the prognosis of cancer.

As cell surface receptors, integrins mediate the adhesion between extracellular matrixes (ECMs) and cells to receive and conduct signal cascades, regulating proliferation, cell survival, movement, and other biological processes.[9] Numerous integrins are believed to be involved in tumor formation and progression. An EGF-like protein family member, Integrin beta-like protein 1 (ITGBL1) is normally expressed in 206 organs, with maximum expression level in gallbladder, breast, and placenta.[10] According to the latest studies, ITGBL1 role as an integrin ECM inhibitor, which is critical for not only cartilage formation but also, osteoarthritis progress.[11] In pathological conditions, ITGBL1 expression promoted Runx2-induced bone metastasis of breast neoplasm throughout TGF-β signaling pathway.[12] Also, it has been considered that ITGBL1 expression as a great biomarker is strongly associated with an epithelial-mesenchymal transition (EMT), invasiveness, and poor survival in several cancers.[13,14,15,16]

The lipid phosphate phosphatase-related proteins (LPPR) family members are a family of six transmembrane proteins that are mainly expressed in the central nervous system (CNS), particularly neurons.[17] In cancer cells, LPPs regulate signal transduction and breakdown of extracellular lysophosphatidate (LPA), sphingosine 1-phosphate (S1P), and other intracellular substrates that contribute in several processes like cell survival, inflammation, migration, and angiogenesis.[18] LPPR4 or plasticity-related gene-1 (PRG1) catalyzes the dephosphorylation of several lipid mediators that regulates a variety of cell functions that maintain synaptic homeostasis.[19] Up to now there has been a limited number of reports that represented the relation between LPPR family member genes and cancer including gliomas. For instance, deregulated LPPR3/PRG3 expression enhances proliferation, reduces apoptosis, and migration and subsequently raises the malignancy of glioma cancer cells.[20] In the case of prostate malignancy, there is only one report that showed the overexpression trend in patients with early and late stage of prostate cancer.[21]

In this propose, the expression levels of both ITGBL1 and LPPR4/PRG1 genes are investigated in patients with diagnosed prostate cancer with different stages to determine whether these genes can be used as prognostic factors of cancer stage detection.

MATERIALS AND METHODS

Sample collection and RNA extraction

To examine the expression profile of both ITGBL1 and LPPR4/PRG1 genes, 40 prostates with a prostate cancer history and 41 healthy individuals without any malignant history or any confirmed urological disease, which were admitted to Shahid Akbar Abadi Hospital (Tehran, Iran) during February-December of 2018. The prostate patients and normal samples were chosen from 25 to 88 (48.70 ± 15.32) and 23 to 89 (53.63 ± 13.35) years old individuals. Informed consent was obtained from all patients. Several factors like Smoking habits and any familial prostate malignancy history of prostate neoplasm encounters were included and the cancer phase of each patient was measured using the following staging system: tumor, node, and metastasis (TNM) with no age-limiting considerations.

For RNA extraction, Prostate tissue biopsy samples were immediately kept in liquid nitrogen. Total RNA from each sample was extracted using a Super RNA Extraction Kit for Tissue and Culture Cells (Favorgen Biotech Corp, Taiwan) according to the constructer’s procedure. The RNA quality and concentration of all samples were determined via optical density (OD) ratio at 260 and 280 nm via Ultrospec 2100 (Biochrom, USA). The cDNA synthesis was done with GoScript^™ Reverse Transcriptase consistent with the constructer’s manual. In this propose, cDNA was synthesized in a final volume of 20 µl containing 4.75 µM random hexamers, 20 units of RNasin, 200 units of reverse transcriptase, 10 mM DTT, and 500 µM deoxynucleotides in 1X first strand buffer for 1 hours at 37°C. Then, the reverse transcriptase activity was stopped using thermal denaturation at 95°C for 5 min followed by storing at –20°C.

Primers and TaqMan quantitative real-time PCR

The expression levels of both ITGBL1 and LPPR4/PRG1 genes were evaluated using the Real-time TaqMan qPCR amplification technique via Rotor-Gene 6000 real-time PCR cycler apparatus (Qiagen Corbett, Hilden, Germany). TaqMan primers/probes for the desired genes were designed using the Primer Express software (PE Applied Biosystems, Foster City, CA). To diminish the contamination of DNA, a single intron was targeted for amplification. The 5ʹ tagged FAM fluorescence and 3ʹ tagged phosphorylated TAMRA quencher dye (518 and 582 nm emission wavelengths) were used for the TaqMan probes labeling, respectively. The final sequences were evaluated subsequently for their specificity, with the help of the Ribosomal Database Project software checker package and the BLAST database program. The specific primers of each genes were utilized with the following sequence information’s: (human ITGBL1, Forward primer: 5′- CCTGTGTGAGTGCCATGAGT -3′ and Reverse primer: 5′- ACCATCCCTGGTCACACTTG -3′; human LPPR4/PRG1, Forward primer: 5′- TAATGCTGGAGGCTGCAACT -3′ and Reverse primer: 5′-GCATACAAGCCCGAAACATACA-3′ and GAPDH, Forward primer: 5′- GGAGCGAGATCCCTCCAAAAT -3′ and Reverse primer: 5′- GGCTGTTGTCATACTTCTCATGG -3′) with the following profile: initial denaturation step at 95°C for 5 min, and 40 cycles at 95°C for 5 sec, annealing 60°C for 30 sec and extension for 30 sec at 72°C. The total volume of 20 µl of the reaction mixture was used comprising: 12 µl of Probe 2× Taq (Probe qPCR) Master Mix (Takara Bio, Shiga, Japan), 0.4 µl of any primers, 0.4 µl of TaqMan probe, 1 µl of each template cDNA, and finally 5.8 µl of ultra-pure water. The negative control tubes had no detected amplified DNA products due to the lack of template DNA. The measures expression data are the mean values of at least three independent repeats of Real-time PCR analysis.

Statistical analysis

Initially, data were collected from the patients and healthy individuals by questionnaires, and after evaluation of clinical information, data were added to SPSS-22 software (SPSS Inc., Chicago). Interpretation of the demographic data collected from all individuals was through frequency. Then, age groups of each patient and healthy samples were well-defined according to the observed quartiles in four different containing: 1) age ≤45, 2) 45 < age ≤54, 3) 54 < age ≤63, and 4) age >63. The normal distribution of data was assessed with the help of the Kolmogorov-Smirnov test. The effect of family history, smoking, and age on the risk of cancer was examined by Chi-squared (X²) test. The Mann-Whitney test was used for the assessment of differences between oncogenes in patients and healthy individuals. Moreover, the eta (η) correlation test was performed to evaluate the correlation between the oncogenes and the stage of prostate cancer. P ≤ 0.05 was considered the level of statistically significant.

RESULTS

In the present study, each patients harboring prostate malignancy were aligned in relative stages, and this is summarized in Table 1. According to the results, T2N1M0 stage is the prevalent form of malignancy in patients with the highest rate of smoking habit, and a family history. No significant relationship was noticed between the stage of PC and either smoking behaviors or family history.

Table 1.

The frequency of different TNM staging systems of prostate cancer and the corresponding relationship with family history and smoking

TNM staging system (n=40)	Frequency (%)	Smoking habit			Family history
		Yes (%)	No (%)	NA (%)	Yes (%)	No (%)	NA (%)
T1N0M0	1 (2.5)	1 (2.5)	-	-	-	1 (2.5)	-
T1N1M1	1 (2.5)	1 (2.5)	-	-	1 (2.5)	-	-
T2N1M0	19 (47.5)	11 (27.5)	7 (17.5)	1 (2.5)	3 (7.5)	15 (37.5)	1 (2.5)
T2N1M1	4 (10)	-	4 (10)	-	-	4 (10)	-
T2N2M1	7 (17.5)	4 (10)	3 (7.5)	-	2 (5)	4 (10)	1 (2.5)
T3N1M1	2 (5)	-	2 (5)	-	2 (5)	-	-
T4N1M1	1 (2.5)	1 (2.5)	-	-	-	1 (2.5)	-
NA	5 (12.5)	2 (5)	1 (2.5)	2 (5)	1 (2.5)	3 (7.5)	1 (2.5)

T0: In this case, there is no evidence of a tumor in the prostate tissue

Patients and healthy samples were chosen within the range of 25 to 88 (48.70 ± 15.32) and 23 to 89 (53.63 ± 13.35) years, respectively, and no significant differences were observed regarding age. Data analysis using X² test revealed a significant difference in the incidence of PC among age groups (X² = 9.30; P = 0.026). The maximum incidence of PC was observed among the patient with age ≤45 years and the lowermost was the group 54 < age ≤63 years [see Figure 1]. When a family history of PC data was analyzed, it was found that 22 (25.5%) patients were positive (see Figure 2). Also, 51 and 63% of healthy and patient subjects had smoking behaviors in their lifetime respectively (see Figure 3). As indicated by X² test, although, family history had a significant effect on PC prevalence (X² = 14.43; P = 0.001), smoking habits showed no significant effect (X² = 4.67; P = 0.097).

Figure 1.

The prevalence of PC and healthy individuals in four distinct age groups. The statistical analysis was performed using the Chi-squared (X²) test

Figure 2.

The rate of family history of PC in healthy and diagnosed prostate malignancy groups. The statistical analysis was performed using the Chi-squared (X²) test. NA: not applicable

Figure 3.

The rate of smoking habit in healthy and diagnosed prostate malignancy groups. The statistical analysis was performed using the Chi-squared (X²) test. NA: not applicable

ITGBL1 is highly expressed in prostate cancer tissues

Regarding the limited number of reports on expression levels of both ITGBL1 and LPPR4/PRG1 genes in malignancies, especially prostate cancer, the estimated expression levels in a subgroup of 40 matched pairs of malignant and 41 healthy tissues via qRT-PCR. As illustrated in Figure 4, ITGBL1 expression was more dominant in prostate cancerous tissues than in normal ones with up to 2.79 ± 3.83-fold elevation compared to the normal control (1.17 ± 0.84; pV = 0.015).

Figure 4.

Relative expression of ITGBL1 and LPPR4 genes in prostate tumor and non-cancerous biopsies

Finally, analysis of data by eta (η) discovered that the association of the stage of PC and the level of ITBGL1 and LPPR4 expression is weak and medium respectively [see Table 2].

Table 2.

Association of ITBGL1 and LPPR4 expression level with the stage of PC

Variable	Value	Interpretation
Stage Dependence	1.000	weak association between the variables
ITBGL1 Dependence	0.330
Stage Dependence	0.998	medium association between the variables
LPPR4 Dependence	0.437

Despite the expression levels of ITGBL1, in cancerous tissues, the expression pattern of LPPR4/PRG1 showed 1.85 ± 1.55 folds compared to the normal controls with 1.45 ± 1.24-fold of expression that was not statistically significant (pV = 0.221).

DISCUSSION

Prostate cancer is one of the most prevalent cancers with great morbidity and mortality worldwide. While developed countries have a high rate of prostate malignancy incidence compared to Asian populations, the incidence has risen within the recent decade.[2,22,23] Several Prostate cancer risk factors like family history, age, and environmental contacts,[23] and more importantly genetic as well as epigenetic alterations are believed to be the cancer progression promoters.[24,25] Also, black ethnicity, elevated hormone levels, low sexual relationships, eliminated coffee consumption, and high alcohol consumption are believed to be other risk factors for prostate cancer incidence.[26,27,28,29] Integrin-β-like or ITGBL1 contributes to several physiological processes like promoting chondrogenesis,[11] it could act as a progressive factor in several diseases like cardiovascular, Hepatitis B, and several types of cancer. Also, the FAK/SRC, Wnt/PCP, and TGF-β signaling pathways show a critical role in the cardiac remodeling processes.[30] Likewise, ITGBL1 is believed to be a key controller in hepatitis B virus-related liver fibrosis patients.[31,32] Several reports have been conducted on the role of ITGBL1 protein in cancer. ITGBL1 promotes FAK/SRC and Wnt/PCP signaling pathway-mediated ovarian cancer migration, cell EMT, and adhesion.[32,15] Also, ITGBL1 stimulates migration, invasion, and even poor prognostic phenotype of colorectal and gastric cancer.[14,33,34] The ITGBL1 protein also triggers metastasis to bone in breast tumors via TGF-β mediated pathway.[12] In contrast, ITGBL1 overexpression inhibits the invasion and migration abilities of non-small cell lung cancer (NSCLC), suggesting that ITGBL1 acts as a tumor suppressor protein in NSCLC.[35] Therefore, the biological role of the ITGBL1 gene in cancers is still unclear. Like the previous report, the present study provides experimental evidence for the role of ITGBL1 in the capability of prostate cancer development. In this propose, we found that the ITGBL1 mRNA expression levels were significantly elevated in prostate cancer tissues compared to normal control. A similar report suggested the key role of ITGBL1 in prostate invasion, EMT, and lymph node metastasis by triggering the NF-κB signaling pathway.[36]

LPPR/PRG are 5 six transmembrane family proteins (LPPR1–LPPR5) that are largely enriched in the central nervous system.[37,38] The LPPR4/PRG1 protein, normally, plays a vital role in regulating excitatory neurotransmission, and brain development in response to hippocampal lesions, and also inhibiting LPA-induced vascular smooth muscle cell migration and proliferation.[18,39,40] There has been a limited number of reports that conducted LPPR4/PRG1 with diseases like cancer. For instance, A503D mutations of LPP4/PRG1 are correlated with the progression of metastatic Triple Negative Breast neoplastic patients with TP53 mutation.[41] Gleason Score (GS) based gene expression of prostate cancer showed that patients with GS ≤6 and GS 8-10 (malignant stage of tumors) typically elevated levels of LPP4/PRG1 gene expression with 3.66 and 4.93 fold, respectively.[20] In contrast with this report, our results showed no significant increasing trend in patients with prostate malignancy compared to normal healthy tissues. To determine the origin of this contrast, the number of samples, age, and stage of the disease must be considered.

Moreover, our findings suggest that the prevalence of prostate malignancy is elevated in young individuals, and the family history rather than smoking hubbies in Iranian males resulted in malignant levels of prostate cancer. Previous research suggests that smoking does not significantly increase the overall risk of prostate cancer, especially in low-grade cases. However, it may be linked to more aggressive forms of the disease, especially in patients with family history and obesity.[42,43]

CONCLUSION

In the present study, our results discovered that ITGBL1 expression levels were elevated in prostate cancer tissues, which was positively associated with progression and metastasis in prostate cancer patients. In contrast, LPPR4/PRG1 presented no spiritually expressional changes compared to control healthy tissues. Although more research should be done to investigate the cancer biomarkers in the Iranian population, these findings should be mentioned in future prevention sexual health policies of the country. In an overall point of view, current studies surrounding this controversy on introducing a novel marker for the determination of prostate cancer for suitable therapeutic propose.

Author contributions

BR: Design of the work. MM, MT, FR, and FM: Acquisition, analysis, and interpretation of data for the work. AN, NN: Drafting the work. EN, ZJ and BR: Final approval of the version to be published.

Ethics approval and consent to participate

Informed consent was obtained from all patients, and the study was approved by the ethical committee of Shahid Akbar Abadi Hospital Research Ethics Committee.

Availability of data and materials

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Competing interests

All authors declare no conflict of interest.

Funding Statement

There was no funding. The study was self-funded.