Abstract
Neuroinflammation, a significant contributor to secondary brain injury, plays a critical role in the pathological process and prognosis of intracerebral haemorrhage (ICH). Thus, developing interventions to mitigate secondary neuroimmune deterioration is of paramount importance. Currently, no effective immunomodulatory drugs are available for ICH. The cyclic GMP-AMP synthase (cGAS)−stimulator of interferon genes (STING) pathway is a recently identified innate immune-sensing pathway primarily expressed in microglia within the central nervous system (CNS) that has been implicated in the pathophysiology of various neurological diseases. In this study we investigated the role of cGAS-STING pathway in ICH. A collagenase model of ICH was established in mice. Brain tissues were collected on D1 or D3 post-ICH. We observed a significant increase in double-stranded (dsDNA) levels and activation of the cGAS-STING pathway in the perihaematomal region of ICH mice. Administration of a blood brain barrier-permeable STING antagonist H151 (10 mg/kg, i.p.) significantly decreased cell apoptosis, alleviated hematoma growth, and improved motor impairments in ICH mice, accompanied by inhibiting the STING pathway in microglia, reducing production/release of the cGAS-STING pathway downstream inflammatory factors, NLRP3 inflammasome activation and gasdermin D (GSDMD)-induced microglial pyroptosis. Microglial Sting conditional knockout significantly mitigated ICH-induced neuroinflammatory responses, pathological damage and motor dysfunction. These results suggest that the microglial STING pathway promotes brain pathological damage and behavioural defects in ICH mice by activating the NLRP3 inflammasome and microglial pyroptosis. The STING pathway may serve as a potential therapeutic target for ICH-induced secondary brain injury.

Keywords: intracerebral haemorrhage, neuroinflammation, STING, NLRP3, GSDMD, pyroptosis
Introduction
Spontaneous intracerebral haemorrhage (ICH) is a devastating event that occurs due to the rupture of a blood vessel and leads to the formation of a haematoma within the brain parenchyma [1]. Spontaneous ICH is characterized by high rates of mortality and disability. Estimates suggest that over 2 million individuals are affected annually, with a mortality rate of approximately 50% within the first month, and most survivors experience long-term disability [1–3]. Brain damage following ICH consists primarily of initial injury from haemorrhage and haematoma expansion, along with secondary injury driven by pathological responses to the haematoma, which exacerbates tissue damage. A critical component of secondary injury is neuroinflammation [4]. Therefore, developing interventions to mitigate secondary neuroimmune deterioration is of paramount importance. Although recent minimally invasive surgical techniques for haematoma evacuation have shown promise in reducing surgical morbidity [2, 5], progress in understanding and treating the subsequent inflammatory cascade after ICH has been limited.
Microglia, the resident macrophage population of the brain, play crucial roles in modulating neuroinflammation in the central nervous system (CNS). A growing body of evidence suggests that activated microglia are a primary source of immunomodulatory molecules contributing to secondary brain injury following ICH [6, 7]. The NOD-like receptor family pyrin domain-containing 3 (NLRP3) inflammasome is a key mediator of neuroinflammatory responses triggered by activated microglia [8]. The NLRP3 inflammasome consists of the sensor NLRP3, the adaptor ASC, and the effector pro-caspase-1 [9]. The activation of the NLRP3 inflammasome occurs in two distinct stages: priming and activation. Priming involves the activation of the nuclear factor NF-κB, which induces the production of pro-IL-1β and NLRP3. This activation is characterized by the generation of reactive oxygen species (ROS) and related molecules, such as thioredoxin-interacting protein (TXNIP) [10], resulting in the assembly of the NLRP3 inflammasome and the cleavage of caspase-1 [9]. The NLRP3 inflammasome has been shown to mediate pyroptosis in various diseases, including ICH [11–14]. Pyroptosis, a form of programmed cell death distinct from apoptosis and necrosis, is mediated by the gasdermin protein family and is characterized by a pore-forming N-terminal domain and an autoinhibitory C-terminal domain [15]. Recent research has revealed that gasdermin D (GSDMD) is one of the most critical members of this family. Activated caspase-1 cleaves GSDMD at the aspartic acid residue within the linker loop, generating an N-terminal fragment (GSDMD-N) that binds to the plasma membrane and forms pores that trigger pyroptosis and facilitate the release of inflammatory cytokines, such as IL-1β. This, in turn, enhances the recruitment of immune cells and exacerbates the inflammatory response [16, 17]. These studies suggest that regulating the NLRP3 inflammasome and the pyroptosis pathway may be potential strategies for treating secondary brain injury in ICH. However, the contributions of these pathways in microglia and their upstream regulatory mechanisms under the pathological conditions of ICH remain unclear.
The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway is an essential innate immune-sensing pathway that is expressed primarily in immune cells, including microglia [18, 19]. cGAS catalyses the conversion of cytosolic DNA, such as foreign double-stranded DNA (dsDNA) derived from pathogens and endogenous self-DNA released during cellular damage, into cyclic GMP-AMP (cGAMP) [18]. cGAMP serves as a second messenger that binds to and activates STING, thereby facilitating the translocation of STING from the endoplasmic reticulum (ER) to perinuclear microsomes via the Golgi apparatus. Upon activation, STING recruits and activates TANK-binding kinase 1 (TBK1), which phosphorylates and activates interferon regulatory factor 3 (IRF3). This cascade induces the expression of type I interferons (IFNs), IFN-stimulated genes (ISGs), and other inflammatory mediators [20]. Additionally, STING contributes to the production of proinflammatory factors, such as TNF-α and IL-6, by activating the transcription factor NF-κB [21], thereby amplifying the inflammatory response. Recent evidence suggests that the activation of the cGAS-STING pathway in response to cytosolic DNA stimulation is involved in the activation of the NLRP3 inflammasome and GSDMD-mediated pyroptosis in microglia [22, 23]. STING induces NLRP3 inflammasome activation either by activating NF-κB, which initiates potassium efflux upstream of NLRP3 [24], or through direct binding to NLRP3 [25]. The pathological activation of the cGAS-STING pathway, resulting from the abnormal accumulation of dsDNA in the cytoplasm, may be involved in the pathophysiology of various neurological diseases, such as hypoxia-ischaemia and subarachnoid haemorrhage [26, 27]. However, the specific role and underlying mechanisms of this pathway in ICH have not yet been investigated.
In this study, we observed elevated levels of dsDNA and activation of the cGAS‒STING pathway in a mouse model of ICH. Pharmacological interventions using the blood‒brain barrier-permeable STING antagonist H151, as well as microglial Sting conditional knockout, were found to inhibit STING pathway activation in microglia within the perihaematomal region of ICH mice. This inhibition led to a decrease in the production/release of downstream inflammatory factors, as well as a reduction in NLRP3 inflammasome activation and GSDMD-induced pyroptosis. Furthermore, these interventions resulted in decreased cell apoptosis and haematoma volume and alleviated the behavioural impairments associated with ICH. These findings suggest that the microglial STING pathway plays a critical role in neuroinflammation and the pathophysiological mechanisms underlying ICH, indicating that targeting this pathway may constitute a promising strategy for the treatment of ICH.
Materials and methods
Animals
C57BL/6J mice were obtained from Shanghai Slaccas Laboratory Animal Co., Ltd. (Shanghai, China). Microglial Sting conditional knockout mice (Stingfl/fl;Cx3cr1Cre) on a C57BL/6J background were kindly provided by Professor Liu-fu Deng from Shanghai Jiao Tong University, China. These mice were generated by crossing Stingfl/fl mice (strain no. T009704; GemPharmatech Co., Ltd., Nanjing, China) with Cx3cr1Cre mice (strain no. 021160; Jackson Laboratory, Bar Harbor, Maine). We backcrossed Stingfl/fl;Cx3cr1Cre mice with wild-type (WT) C57BL/6J mice to obtain littermate controls (Stingfl/fl mice) and experimental mice (Stingfl/fl;Cx3cr1Cre). The mice were genotyped via polymerase chain reaction (PCR). The primers used were as follows: Common forward primer: 5'-AAG ACT CAC GTG GAC CTG CT-3'; Mutant reverse primer: 5'-CGG TTA TTC AAC TTG CAC CA-3'; WT reverse primer: 5'-AGG ATG TTG ACT TCC GAG TTG-3'; Sting forward primer: 5'-CTT TTT CAT CTG CCT TCC AGG T-3'; Sting reverse primer: 5'-GAG GAG ACA AAG GCA AGC AC-3'. Male mice aged 8–10 weeks were used in this study. All the mice were housed in a specific pathogen-free environment under strictly controlled conditions, including temperature (22 ± 1 °C) and humidity (45%–55%). The mice were group-housed (4–5 mice/cage), maintained on a 12-h light/dark cycle, and provided ad libitum access to food and water. All housing, breeding, and experimental procedures were conducted in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University, in alignment with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Approval No. A2023116-008).
The collagenase model of intracerebral haemorrhage
The ICH mouse model was established on the basis of our previous study [28] with slight modifications. The mice were randomly divided into two groups: the sham-operated group and the ICH-operated group. Each mouse was anaesthetized via intraperitoneal injection of sodium pentobarbital (40 mg/kg), followed by restraint onto a stereotaxic apparatus. The burr hole location was selected at coordinates 0.2 mm anterior to the bregma, 2.2 mm lateral to the midline, and 3.5 mm ventral. Subsequently, 0.075 U of collagenase IV (Sigma‒Aldrich, St. Louis, MO, USA) dissolved in 0.4 μL of sterile PBS was injected over a period of 5 min via a microinfusion pump. To prevent reflux, the needle was withdrawn slowly over 2 min, and the burr hole was sealed with bone wax. In the sham-operated group, an equal volume of sterile PBS was injected. All the mice were kept on heating pads at 37 °C until they fully recovered from anaesthesia.
Drug administration
H151 (10 mg/kg, CAT#HY-112693, MedChemExpress, Monmouth Junction, NJ, USA), MCC950 (10 mg/kg, CAT#HY-12815, MedChemExpress), and disulfiram (DSF, 50 mg/kg, CAT#HY-B0240, MedChemExpress) were dissolved in sterile saline containing 5% DMSO (Sigma‒Aldrich), 5% PEG400 (CAT#A611781-0500, Sangon Biotech, Shanghai, China), and 5% Tween 80 (CAT#C13519235, Macklin Inc., Shanghai, China). H151, MCC950, or disulfiram was administered intraperitoneally at 2, 6, and 24 h after ICH, followed by once-daily dosing until day 7. The drug dosing method and dosage were chosen on the basis of previous reports [29–31].
Experimental design
To investigate the changes in the cGAS-STING pathway following ICH, the mice were randomly divided into three groups: the sham-operated group, the 1-day post-ICH operation group, and the 3-day post-ICH operation group (n = 6 per group). Brain tissues were collected for Western blotting (WB, n = 6), RT‒qPCR analysis (n = 6), and immunofluorescence (IF) staining (n = 3).
To evaluate the effects of pharmacological inhibition of the STING pathway on ICH-induced neuroinflammation, pathological damage, and motor function impairments, the mice were assigned to three groups: sham + vehicle, ICH + vehicle, and ICH + H151. Magnetic resonance imaging (MRI) was performed on day 3 post-ICH to evaluate haematoma volume (n = 4, 6, and 6, respectively). Brain tissues were collected on day 3 post-ICH for dihydroethidium (DHE) staining (n = 3), TUNEL staining (n = 3), Fluoro-Jade C (FJC) staining (n = 3), IF staining (n = 3), WB (n = 6), and RT‒qPCR analysis (n = 6). Behavioural tests were conducted 1-day presurgery and on days 1, 3, and 7 post-ICH, with n = 6, 8, and 10 mice in the sham + vehicle, ICH + vehicle, and ICH + H151 groups, respectively.
To elucidate the role of the microglial STING pathway in the pathological progression of ICH, the mice were randomly divided into four groups: the Stingfl/fl sham group, the Stingfl/fl ICH group, the Stingfl/fl;Cx3cr1Cre sham group, and the Stingfl/fl;Cx3cr1Cre ICH group. MRI was performed on day 3 post-ICH to assess haematoma volume (n = 3, 5, 3, and 5, respectively). Brain tissues were collected on day 3 post-ICH for DHE staining, TUNEL staining, FJC staining, IF staining, WB, and RT‒qPCR (n = 3). Behavioural tests were performed 1-day presurgery and on days 1 and 3 post-ICH, with n = 4, 6, 4, and 6 mice in the Stingfl/fl sham, Stingfl/fl ICH, Stingfl/fl;Cx3cr1Cre sham, and Stingfl/fl;Cx3cr1Cre ICH groups, respectively.
Western blot (WB) analysis
Following transcardial perfusion with precooled saline, mouse brain tissue from the perihaematomal region was homogenized in RIPA buffer (Beyotime Biotechnology, Nantong, Jiangsu, China) supplemented with protease and phosphatase inhibitors (Beyotime). Protein concentrations were determined with BCA kits (Beyotime) according to the manufacturer’s protocol. The homogenates were resolved by 6%‒12% SDS‒PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were blocked with protein-free rapid blocking buffer (CAT#PS108P, Epizyme, Inc., Cambridge, MA, USA) for 10 min at room temperature and then incubated overnight at 4 °C with primary antibodies. The primary antibodies, including anti-cGAS (1:1000, CAT#31659), STING (1:1000, CAT#13647), phospho-STING (1:1000, CAT#72971), TBK1 (CAT1:1000, #3504), phospho-TBK1 (1:1000, CAT#5483), IRF3 (1:1000, CAT#4302), phospho-IRF3 (1:1000, CAT#29047), NF-κB p65 (CAT#8242), NLRP3 (1:1000, CAT#15101), cleaved caspase-1 (1:1000, CAT#E2G2I), and β-actin (1:1000, CAT#3700) antibodies, were obtained from Cell Signaling Technology (CST, Danvers, MA, USA). The anti-phospho-NF-κB p65 antibody (1:1000, CAT#AP0214) was purchased from ABclonal (Woburn, MA, USA). Antibodies against GSDMD (1:1000, CAT#ab219800), IL-1β (1:1000, CAT#ab254360), and TXNIP (1:1000, CAT#ab188865) were obtained from Abcam (Cambridge, UK). After being washed with phosphate-buffered saline (PBS), the membranes were incubated with HRP-labelled goat anti-rabbit IgG (H + L) or HRP-labelled goat anti-mouse IgG (H + L) secondary antibodies for 1 h at room temperature. Detection was performed via Super ECL Plus (US Everbright® Inc., Silicon Valley, CA, USA) with an AMERSHAM ImageQuant 800 imager (Cytiva, Marlborough, MA, USA). The quantification of immunoreactive bands was performed via ImageJ/FIJI software (National Institutes of Health [NIH], Bethesda, MD, USA).
Quantitative real‐time polymerase chain reaction (qPCR) analysis
Total RNA was isolated from the perihaematomal region of the mouse brain with a Steady Pure quick RNA extraction kit (Accurate Biotechnology Co., Ltd., Changsha, Hunan, China) and quantified with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was conducted via the HiScript III RT SuperMix for the qPCR kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. Quantitative real-time PCR was performed with ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The PCR protocol included initial denaturation at 95 °C for 30 s, followed by 50 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 95 °C for 15 s, with a final extension at 60 °C for 60 s. Relative mRNA levels were determined via the 2exp(-∆∆Ct) method, with β-actin used as an endogenous control. The primer sequences were synthesized by Sangon Biotech (Shanghai, China) and are listed in Table 1.
Table 1.
Primers used in quantitative real-time PCR analysis
| Genes | Forward primer (5' to 3') | Reverse primer (5' to 3') |
|---|---|---|
| Cgas | CAGGAAGGAACCGGACAAGC | CCGACTCCCGTTTCTGCATT |
| Sting | TCGCACGAACTTGGACTACTG | CCAACTGAGGTATATGTCAGCAG |
| Cxcl10 | ATCATCCCTGCGAGCCTATCCT | GACCTTTTTTGGCTAAACGCTTTC |
| Ifnb | CAGCTCCAAGAAAGGACGAAC | GGCAGTGTAACTCTTCTGCAT |
| Tnfa | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| Il6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| Ccl2 | TTTTTGTCACCAAGCTCAAGAG | TTCTGATCTCATTTGGTTCCGA |
| Il1b | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Preparation of frozen sections
The mice were euthanized and perfused with prechilled saline. Brain tissues were excised, fixed in 4% paraformaldehyde (PFA) for 24 h, and cryoprotected in 15% and 30% sucrose in 0.1 M PBS for 48 h at 4 °C. The brains were subsequently embedded in optimal cutting temperature (O.C.T.) compound, rapidly frozen in liquid nitrogen, and stored at −80 °C. Consecutive 20-µm-thick coronal sections were obtained via a freezing microtome (CM1950, Leica Microsystems, Wetzlar, Germany) and then stored at −20 °C.
Immunofluorescence staining
The frozen brain sections were rinsed twice in PBS and then subjected to permeabilization and blocking in 0.3% Triton X-100 containing 5% goat or donkey serum for 1 h. The sections were then incubated overnight at 4 °C with primary antibodies, including anti-dsDNA (1:100, CAT#sc-58749, Santa Cruz Biotechnology, Santa Cruz, CA, USA), STING (1:3000, CAT#90947, CST), GSDMD (1:100, CAT#ab219800, Abcam), GSDMD-N (1:150, CAT#DF13758, Affinity Biosciences Ltd., Cincinnati, OH, USA), IBA-1 conjugated to Alexa Fluor 488 (1:100, CAT#2082, CST), NeuN (1:500, CAT#94403, CST), GFAP-Cy3™ (1:500, CAT#C9205, Sigma‒Aldrich), TNF-α (1:200, CAT#11948, CST), and IL-6 (1:200, CAT#12912, CST) antibodies. For immunofluorescent double staining, the sections were washed three times with PBS following primary antibody incubation and then incubated with secondary antibodies: goat anti-rabbit IgG H&L (Alexa Fluor 647, 1:400, CAT#ab196159, Abcam) or goat anti-mouse IgG H&L (Alexa Fluor 568, 1:400, CAT#1917938, Thermo Fisher Scientific) for 1 h at room temperature. After washing with PBS, the nuclei were counterstained with DAPI (Beyotime) for 10 min and then mounted on glass slides. Images were captured via confocal microscopy (TCS SP8, Leica Microsystems). The expression levels of dsDNA, STING, NLRP3, GSDMD, GSDMD-N, IBA-1, TNF-α, and IL-6 were quantified via analysis of the immunofluorescence intensity via ImageJ/FIJI software (NIH). The results are presented as the mean ± SEM of two individual fields in each region, with three mice per group. Quantitative analysis of the immunofluorescence intensity profiles for STING, GSDMD, and GSDMD-N colocalization with IBA-1, GFAP, or NeuN was performed via ImageJ/FIJI software (NIH). Microglial morphological alterations were assessed through quantitative morphometric analysis of IBA-1 immunostaining, including measurements of soma size, process length, and terminal branch points, conducted via ImageJ/FIJI software (NIH).
Enzyme-linked immunosorbent assay (ELISA)
The concentrations of IL-1β, TNF-α, and IL-6 were measured via ELISA kits (CAT#432604, CAT#430904, and CAT#431304, respectively; Biolegend, San Diego, CA, USA) in accordance with the manufacturer’s protocol. Briefly, microplates were coated with capture solution and incubated overnight at 4 °C. After three washes with PBST (PBS containing 0.05% Tween-20), the plates were blocked with Assay Diluent A for 1 h at room temperature. The samples or standards were then added and incubated for 2 h. The detection antibody solution was applied, and the samples were incubated for 1 h at room temperature. Following four additional washes with PBST, avidin-HRP solution was added, and the mixture was incubated for 30 min. The substrate mixture was then added, and the mixture was incubated in the dark for 15 min. The reaction was terminated by adding stop solution, and the cytokine concentrations were determined by measuring the absorbance at 450 nm via a microplate reader.
Dihydroethidium (DHE) staining
DHE staining was employed to assess ROS levels in mouse brains following the methodologies described in previous studies [32]. Frozen brain sections (20 µm) were incubated with 3 μmol/L of the fluorescent dye dihydroethidium (CAT#D7008, Sigma‒Aldrich) at 37 °C for 30 min in a dark and humidified chamber. After incubation, the sections were counterstained with DAPI for 10 min. ROS levels were subsequently captured via a fluorescence microscope (TCS SP8, Leica Microsystems). For quantitative analysis, DHE-positive cells in two randomly selected regions were counted via ImageJ/FIJI software (NIH). The percentage of DHE-positive cells was calculated relative to the total number of cells counted.
TUNEL staining
Apoptosis was determined via a One Step TUNEL Apoptosis Assay Kit (C1090, Beyotime, China). The frozen sections were rinsed twice with PBS and subsequently incubated with 0.5% Triton X-100 in PBS at room temperature for 5 min. After being washed with PBS, the sections were incubated with the TUNEL reaction mixture for 60 min at 37 °C in the dark. Nuclei were counterstained with DAPI (Beyotime). Images were captured under a Leica fluorescence microscope (TCS SP8, Leica Microsystems), and TUNEL-positive cells are shown as a percentage of the total cell count.
Fluoro-Jade C (FJC) staining
To assess degenerating neurons, Fluoro-Jade C (FJC) staining was conducted with fluorescent Nissl counterstaining via the RTD™ Fluoro-Jade® C Staining Kit (TR-100-FJ, Biosensis, Thebarton, Australia). The data are presented as the average number of FJC-positive neurons per mm². The number of stained cells was determined via ImageJ/FIJI software (NIH).
Magnetic resonance imaging (MRI)
MRI was performed via a horizontal 11.7 T magnetic resonance scanner (Bruker Biospin, Germany), configured with a triple-axis gradient (maximum gradient strength of 74 Gauss/cm) and a volume excitation coil, in conjunction with a 4-channel phased array mouse head receive-only coil [33] Multislice T2-weighted (T2w) images were acquired via rapid acquisition with relaxation enhancement (RARE) pulse sequence with the following parameters: repetition time (TR)/echo time (TE) = 3800/60 ms, RARE factor = 8, number of signal averages = 4, field of view = 15 mm × 15 mm, 28 slices with 0.5 mm slice thickness, in-plane spatial resolution of 0.08 × 0.08 mm2, and a total scan duration of 12 min. Haematoma volume on day 3 post-ICH was quantified via 3D Slicer (NIH).
Behavioural tests
Modified neurological severity score (mNSS) assessment
To assess neurological impairment, the modified Neurological Severity Score (mNSS) was calculated as previously described [34]. The mNSS is an assessment tool designed to quantify neurological deficits on a scale ranging from 0 (normal) to 14 (maximum deficit). The mNSS includes tests for limb flexion during tail elevation (0–3 points), balance on a beam (0–6 points), walking posture (0–3 points), and pinna and corneal reflexes (0–2 points), with higher scores indicating more significant neurological damage.
Rotarod test
The rotarod test was conducted to assess motor coordination and balance in the mice. The mice were placed on a rotating drum, and the speed was gradually increased from 4 to 40 rpm over a 5-min period. The latency to fall from the rotating rod was recorded. Each mouse underwent three trials with a 5-min interval between trials. The data are presented as the means of three trials [35].
Elevated body swing test (EBST)
The EBST was utilized to evaluate asymmetric motor behaviour. The mice were suspended by their tails approximately 10 cm above the table, and deflections were recorded each time the mouse turned its head more than 10° from the vertical axis to either side. If no deflection occurred after 5 s of suspension, the tail was gently lifted to elicit rotational behaviour. Each mouse underwent 20 trials, with a minimum of 1-min intervals between trials. The number of deviations to the left was quantified.
Grip strength test
A grip strength meter (Bio-GS3, BioSeb, Vitrolles, France) was used to assess the forelimb and hindlimb grip strength of the mice. The mice were gently lifted by the tail to encourage them to grasp a rigid grid attached to a digital force gauge. The tail of each mouse was gradually pulled backwards until the mouse released its grip on the grid. Five consecutive tests were conducted on each mouse, and the mean maximum grip strength (in grams, g) was calculated.
Statistical analyses
All the data are presented as the means ± SEMs. Multiple comparisons were conducted via one-way ANOVA, followed by Tukey’s post hoc test. Comparisons between two groups were performed via two-tailed Student’s t tests. The results of the behavioural tests were analysed via two-way ANOVA. All the statistical analyses were carried out with GraphPad Prism 9 (San Diego, CA, USA), with a P value of less than 0.05 considered statistically significant. The investigators were blinded to group identities for the duration of the experiment.
Results
Intracerebral haemorrhage triggers an increase in dsDNA in the brain and activation of the cGAS‒STING pathway
We established a mouse model of ICH by administering a local injection of collagenase IV into the right striatum of the mouse brain (Fig. 1a). Given that dsDNA is the most potent damage-associated molecular pattern (DAMP) capable of activating the cGAS-STING pathway, we initially employed immunofluorescence staining to detect dsDNA levels following ICH. As illustrated in Fig. 1b and Supplementary Figure S1a, dsDNA expression in sham-operated mice was minimal and primarily presented as ring‐like nuclear contours around the injury site. On days 1 and 3 after ICH surgery, we observed a marked increase in dsDNA content, as well as its redistribution within the nucleus, with detectable dsDNA in the cytoplasm (Supplementary Fig. S1b). These findings suggest that dsDNA accumulation and leakage occurred in the injured areas after ICH.
Fig. 1. Accumulation of dsDNA and upregulation of the cGAS‒STING pathway in the perihaematomal region of ICH mice.
a Schematic representation of the ICH modelling process. b Representative images of dsDNA immunofluorescence staining of the perilesional region of sham-operated and 1- and 3-day post-ICH mice. The white arrows indicate dsDNA in the cytoplasm. Scale bar = 5 μm. c Western blot analysis demonstrating the expression levels of cGAS, STING, p-STING, TBK1, p-TBK1, IRF3, and p-IRF3 in the perilesional region of sham- and ICH-operated mice. d Quantitative analysis of the Western blot results (n = 6). e Measurement of the mRNA levels of Cgas, Sting, Cxcl10, and Ifnb in the perilesional region of sham- and ICH-operated mice by RT‒qPCR (n = 6). f Immunofluorescence double staining illustrates the localization of STING (green) in microglia (IBA-1, red) in the perilesional region of mice 3 days after ICH, with minimal expression in astrocytes (GFAP, red) and neurons (NeuN, red). The white arrows indicate the distribution of STING expression in relation to IBA-1, GFAP, and NeuN. Fluorescence curves revealing the distribution of STING were generated via the plot profile of ImageJ/FIJI. Scale bar = 100 μm. The data are shown as the means ± SEMs, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Next, we investigated the changes in the cGAS‒STING pathway in ICH mice. Western blot assays revealed that the protein levels of cGAS and STING increased in a time-dependent manner in the peripheral areas of haematoma samples collected from mice on days 1 and 3 after ICH (Fig. 1c, d). The upregulation of Cgas and Sting transcript levels was observed in the tissue surrounding the haematoma on day 3 after ICH (Fig. 1e). Additionally, the phosphorylation levels of STING, along with its downstream targets TBK1 and IRF3, were significantly elevated at 3 days post-ICH (Fig. 1c, d), and corresponding increases in the downstream factors Cxcl10 and Ifnb were also noted (Fig. 1e). These results indicate that the accumulation and leakage of dsDNA may activate the downstream cGAS‒STING pathway in the perihaematomal regions of the ICH brain.
We further explored the specific cell types in which the STING pathway is activated following ICH. Immunofluorescence staining revealed that on day 3 following ICH, STING expression was significantly increased in the cytoplasm of the cells surrounding the haematoma (Supplementary Fig. S2). Moreover, increased STING expression significantly colocalized with IBA-1 (a microglial marker) but did not colocalize with GFAP (an astrocyte marker) or NeuN (a neuronal marker) (Fig. 1f). These findings suggest that the cGAS‒STING pathway in microglia may play a role in the pathological progression of ICH.
Intracerebral haemorrhage leads to increased expression of NLRP3 and molecules associated with microglial pyroptosis
Studies have demonstrated that STING mediates the neuroinflammatory response through the activation of the NLRP3 inflammasome, which is also implicated in GSDMD-induced pyroptosis [11, 22, 36]. GSDMD and its N-terminal cleavage fragment, GSDMD-N, act as effectors and triggers pyroptosis. Therefore, we investigated the effects of ICH on the expression of NLRP3, GSDMD, and GSDMD-N. Western blot analysis revealed that, compared with that in the sham group, NLRP3 protein expression increased in a time-dependent manner on days 1 and 3 after ICH (Fig. 2a, b). Notably, the expression patterns of GSDMD and GSDMD-N were analogous to those of NLRP3 (Fig. 2a, b). Furthermore, immunofluorescence staining revealed that, on day 3 after ICH, GSDMD was predominantly localized in IBA-1-positive microglia surrounding the area of ICH injury, with minimal expression observed in astrocytes and neurons (Fig. 2c).
Fig. 2. Increased expression of NLRP3, GSDMD, and GSDMD-N and colocalization of GSDMD with microglia in the perihaematomal region following ICH.
a Western blot analysis showing the expression of NLRP3, GSDMD, and GSDMD-N in the perilesional region of sham-operated and 1- and 3-day post-ICH mice. b Quantitative analysis of the Western blot results (n = 6). c Immunofluorescence double staining illustrates the localization of GSDMD (green) in microglia (IBA-1, red, indicated by white arrows) in the perilesional region at 3 days post-ICH, with minimal expression in astrocytes (GFAP, red) and neurons (NeuN, red). Fluorescence curves revealing the distribution of GSDMD were generated via the plot profile of ImageJ/FIJI. Scale bar = 20 μm. The data are shown as the means ± SEMs, **P < 0.01, ***P < 0.001, ****P < 0.0001.
The STING antagonist H151 effectively inhibits the activation of the STING pathway and mitigates neuroinflammation in mice with ICH
On the basis of these findings, we hypothesized that the activation of the cGAS‒STING pathway induced by ICH may participate in the pathology of ICH by eliciting microglial inflammatory responses and pyroptosis. Therefore, ICH mice were administered the STING antagonist H151 to validate its ability to mitigate ICH. H151 is a small-molecule inhibitor that specifically targets the STING pathway by binding directly to STING, thereby disrupting its downstream signalling and regulating associated inflammatory responses [29, 37]. Given that H151 can permeate the blood‒brain barrier [19, 38, 39], it was administered at a dosage of 10 mg/kg via intraperitoneal injection at 2 h, 6 h, and 24 h after ICH modelling and then given once daily for three or seven consecutive days (Fig. 3a). Whole-brain or perilesional brain tissue samples were collected on day 3 after ICH for various biochemical analyses. Behavioural assessments were performed on days 1, 3, and 7 post-ICH to examine neurological functional impairments (Fig. 3a). Western blot analysis demonstrated that H151 treatment markedly suppressed the increase in STING expression and the phosphorylation of STING, TBK1, and IRF3 in the perihaematomal region of ICH mice (Fig. 3b, c). Immunofluorescence staining revealed that the increase in STING expression induced by ICH was predominantly in microglia, whereas H151 treatment significantly reversed the increase in both STING expression and the number of STING-positive microglia (Supplementary Fig. S3a, b). Furthermore, H151 reduced the expression of IBA-1 and the number of IBA-1-positive cells in ICH mice (Supplementary Fig. S3a, b). Morphological analysis of microglia revealed a significant increase in soma size and a reduction in branch length and endpoints in perilesional regions after ICH. H151 treatment partially reversed these morphological alterations (Supplementary Fig. S3c). These findings indicate that H151 attenuates microglial activation. Additionally, H151 treatment reduced the elevated transcription levels of Cxcl10 and Ifnb (Fig. 3d). We also assessed additional critical downstream transcription factors of STING, such as NF-κB, as well as inflammation-related factors, including TNF-α, IL-6, and CCL2. In the perihaematomal brain regions of the ICH mice, we observed increased expression and phosphorylation levels of NF-κB p65 (Fig. 3b, c), along with increased transcription and/or protein expression of TNF-α, IL-6, and Ccl2 (Fig. 3d–h, Supplementary Fig. S4). H151 treatment significantly reversed these changes induced by ICH (Fig. 3b–h, Supplementary Fig. S4). These findings suggest that treating ICH mice with the STING inhibitor H151 can suppress STING-mediated neuroinflammation in the brain.
Fig. 3. H151 administration inhibits STING pathway activation and inflammatory factor production following ICH.
a Schematic diagram depicting the experimental procedure for H151 administration in ICH model mice. b Western blot analysis of the expression of STING, p-STING, TBK1, p-TBK1, IRF3, p-IRF3, NF-κB p65, and p-NF-κB p65 in the perilesional region of sham + vehicle, ICH + vehicle, and ICH + H151 mice. The mice were evaluated on day 3 postoperation. c Quantitative analysis of the Western blot results (n = 6). d Measurement of the mRNA levels of Cxcl10, Ifnb, Tfna, Il6, and Ccl2 in the perilesional region across groups via RT‒qPCR (n = 6). e, g Representative images and quantitative analysis of TNF-α expression in the perilesional region for each group (n = 6). Scale bar = 50 μm. f, h Representative images and quantitative analysis of IL-6 expression in the perilesional region for each group (n = 6). Scale bar = 50 μm. The data are shown as the means ± SEMs, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
H151 treatment suppresses NLRP3 inflammasome activation and GSDMD-induced microglial pyroptosis in ICH mice
We initially verified the effects of H151 on the expression of NLRP3, GSDMD, and GSDMD-N in the brains of ICH mice. H151 treatment significantly attenuated the ICH-induced upregulation of NLRP3, GSDMD, and GSDMD-N expression in microglia within the perihaematomal region (Fig. 4a–f, Supplementary Fig. S5). Additionally, NLRP3 inflammasome activation triggers caspase-1 cleavage and the release of IL-1β [11, 40]. Caspase-1 can induce the cleavage of GSDMD to produce GSDMD-N, leading to pyroptosis [17]. Both caspase-1 and GSDMD play essential roles in the release of IL-1β [41]. In this study, Western blot analysis demonstrated significant upregulation of cleaved caspase-1, pro-IL-1β, and cleaved-IL-1β in the perihaematomal regions of ICH mice (Fig. 4a, b), with elevated IL-1β levels further confirmed by ELISA quantification (Supplementary Fig. S6a). H151 treatment reversed these changes and mitigated the increase in Il1b transcription among ICH mice (Fig. 4a, b; Supplementary Fig. S6a, b). Immunofluorescence staining revealed the expression of IL-1β in the brain parenchyma and in microglia surrounding the injury site following ICH (Supplementary Fig. S7). Furthermore, STING activation was found to induce ROS production [42] and trigger ROS/TXNIP-dependent NLRP3 activation in a mouse model of LPS-induced cardiac injury [43]. In the present study, antagonizing STING with H151 significantly suppressed the upregulation of ROS production, as indicated by DHE staining and TXNIP expression in the perihaematomal regions of mice induced by ICH (Fig. 5a–d). These findings suggest that antagonism of the STING signalling pathway mitigates NLRP3 inflammasome activation, GSDMD-induced microglial pyroptosis, and neuroinflammatory responses associated with ICH.
Fig. 4. Administration of H151 attenuates NLRP3 inflammasome activation and microglial pyroptosis following ICH.
a Western blot analysis showing the expression levels of NLRP3, cleaved caspase-1, GSDMD, GSDMD-N, pro-IL-1β, and cleaved-IL-1β in the perilesional region of sham + vehicle, ICH + vehicle, and ICH + H151 mice. The mice were evaluated on day 3 postoperation. b Quantitative analysis of the Western blot results (n = 6). c Immunofluorescence double-staining image of the colocalization of NLRP3 (green) and IBA-1 (red) in the perilesional region of mice from each group. Scale bar = 50 μm. d Quantitative analysis of NLRP3 expression and its colocalization with IBA-1 (n = 6). e Immunofluorescence double staining showing the expression of GSDMD-N (green) and IBA-1 (red), along with their colocalization in the perilesional region of the mice across the groups. Scale bar = 50 μm. f Quantitative analysis of GSDMD-N expression and its colocalization with IBA-1 (n = 6). The data are shown as the means ± SEMs, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Fig. 5. Administration of H151 reduces ROS levels and TXNIP expression in the perihaematomal region of ICH mice.
a Representative images of dihydroethidium (DHE) staining indicating ROS levels in the perilesional region of sham + vehicle, ICH + vehicle, and ICH + H151 mice. The mice were evaluated on day 3 postoperation. Scale bar = 50 μm. b Quantitative analysis of DHE staining results (n = 6). c Western blot analysis showing the expression of TXNIP in the perilesional region of the mice in each group. d Quantitative analysis of TXNIP expression (n = 6). The data are shown as the means ± SEMs; ****P < 0.0001.
H151 treatment reduces cell apoptosis, neuronal degeneration, and haematoma volume while alleviating motor deficits in ICH mice
Additionally, we evaluated the effects of H151 treatment on cell apoptosis, neuronal degeneration, and haematoma volume in the brains of mice with ICH. TUNEL staining and FJC staining revealed that, compared with those in the sham-operated group, there was a significant increase in the number of apoptotic cells and degenerated neurons in the perihaematomal area of the mouse brain on day 3 after ICH (Fig. 6a, b). H151 treatment notably alleviated these changes induced by ICH (Fig. 6a, b). Moreover, MRI experiments demonstrated that H151 administration significantly reduced the haematoma volume in the mouse brain on day 3 after ICH (Fig. 6c).
Fig. 6. Administration of H151 mitigated neuronal damage, intracerebral haemorrhage, and motor function deficits in ICH mice.
a Representative images of TUNEL staining and quantitative analyses revealing apoptotic cells in the perilesional region of sham + vehicle, ICH + vehicle, and ICH + H151 mice. The mice were evaluated on day 3 postoperation (n = 6). Scale bar = 50 μm. b Representative images of Fluoro-Jade C (FJC) staining and quantitative analyses demonstrating degenerating neurons in the perilesional region across various groups (n = 6). Scale bar = 50 μm. c Representative MR images and quantitative analyses of haemorrhage volume across groups, with red circles indicating areas of haemorrhage. The numbers of mice in the three groups were 4, 6, and 6, respectively. d Behavioural assessments, which included the modified neurological severity score (mNSS), rotarod test, elevated body swing test, and grip strength test, were conducted on the mice prior to the ICH procedure and on 1, 3, and 7 postoperation. The numbers of mice in the three groups were 6, 8, and 10, respectively. The data are shown as the means ± SEMs; *P < 0.05, **P< 0.01, ***P < 0.001, ****P < 0.0001 for the comparison of the ICH + H151 and ICH + vehicle groups.
To further investigate whether antagonizing STING can alleviate the behavioural impairments induced by ICH in mice, we conducted a series of assessments, including the modified neurological severity score (mNSS), rotarod test, elevated body swing test (EBST), and grip strength test. These tests were performed to evaluate the comprehensive motor and sensory functions, motor coordination and balance, lateralized motor behaviours, and muscle strength of the mice, respectively. The administration of H151 improved all the observed motor dysfunctions in the mice on day 3 after ICH, and these benefits persisted for at least 7 days (Fig. 6d). These findings indicate that antagonizing STING can protect against tissue damage and neuronal injury while promoting motor recovery following ICH.
We subsequently investigated which downstream effectors of STING contribute primarily to the neurological dysfunction associated with ICH. Given that NLRP3 serves as a key downstream effector of STING [24, 25] and that GSDMD-induced pyroptosis is primarily triggered by inflammasomes, particularly NLRP3 [44], we speculated that STING-induced activation of the NLRP3/GSDMD axis may play a pivotal role in the neurological dysfunction caused by ICH. Therefore, we employed MCC950, a selective NLRP3 inflammasome inhibitor that stabilizes NLRP3 in its inactive conformation [45, 46], and disulfiram, which inhibits GSDMD-N-mediated pore formation [47]. This pore formation is a critical step in pyroptosis and cytokine release [16, 17, 48–50]. These inhibitors were used to assess their efficacy in mitigating ICH-induced behavioural deficits in mice, with comparisons made with the STING inhibitor H151. Our results demonstrated that the administration of MCC950 significantly improved behavioural impairments in mice on days 3 and 7 post-ICH, as evaluated by the mNSS, with a slightly weaker effect than H151 (Supplementary Fig. S8a). Disulfiram also led to a moderate improvement in behavioural deficits, although its efficacy was inferior to that of both MCC950 and H151 (Supplementary Fig. S8a). In the EBST, both MCC950 and disulfiram significantly reduced motor asymmetry in mice on days 3 and 7 after ICH, with effects comparable to those of H151 (Supplementary Fig. S8b). These findings suggest that NLRP3 may be the primary downstream effector of STING in the pathology of ICH. While NLRP3 predominantly regulates GSDMD, it may also contribute to ICH through other pathways.
Microglial Sting deficiency inhibits the activation of the STING pathway and attenuates neuroinflammation in ICH mice
Since significant activation of the cGAS-STING pathway in microglia was observed in the perihaematomal area of ICH mice, we investigated whether this pathway in microglia is involved in the pathology of ICH. Microglial Sting conditional knockout mice (Stingfl/fl;Cx3cr1Cre mice) and their littermate control mice (Stingfl/fl) were used in this study (Fig. 7a). Whole-brain or perilesional brain tissue was harvested on day 3 after ICH for biochemical analyses, whereas behavioural tests were conducted on days 1 and 3 post-ICH to assess neurological function in mice (Fig. 7a). Compared with those in ICH-operated Stingfl/fl mice, the expression of STING and the phosphorylation levels of STING, TBK1, IRF3, and NF-κB p65 were significantly lower in the perihaematomal area of ICH-operated Stingfl/fl;Cx3cr1Cre mice (Fig. 7b, c). Similarly, the transcript levels of Cxcl10, Tnfa, and Ccl2, which are downstream molecules associated with this pathway, were notably decreased in these mice (Fig. 7d). Additionally, consistent with the results of the Western blot analysis, immunofluorescence staining revealed a significant reduction in the expression of STING and the number of STING-positive microglia in the ICH-operated Stingfl/fl;Cx3cr1Cre mice compared with the ICH-operated Stingfl/fl mice (Fig. 7e). Moreover, the deletion of microglial Sting partially reversed the increase in IBA-1 expression, the increase in IBA-1-positive cell counts, the enlargement of microglial cell bodies, and the reduction in branch length and endpoints observed on day 3 post-ICH (Fig. 7e, Supplementary Fig. S9). These findings demonstrate that microglial Sting deficiency partially mitigates ICH-induced microglial activation (Fig. 7e). These results indicate the critical role of microglial STING in regulating pathway activation and the expression of downstream inflammatory factors in ICH mice.
Fig. 7. Microglial Sting knockout inhibits STING pathway activation and inflammatory factor production following ICH.
a Schematic diagram outlining the ICH model in microglial Sting conditional knockout mice and the subsequent experimental procedures. b Western blot analysis demonstrating the expression levels of STING, p-STING, TBK1, p-TBK1, IRF3, p-IRF3, NF-κB p65, and p-NF-κB p65 in the perilesional region of sham- and ICH-operated Stingfl/fl and Stingfl/fl;Cx3cr1Cre mice. The mice were evaluated on day 3 postoperation. c Quantitative analysis of the Western blot results (n = 3). d Measurement of the mRNA levels of Cxcl10, Tnfa, and Ccl2 in the perilesional region across groups via RT‒qPCR (n = 3). e Representative images of immunofluorescence double staining and quantification of STING and IBA-1 expression, along with their colocalization in the perilesional region of each group (n = 6). Scale bar = 50 μm. The data are shown as the means ± SEMs, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Microglial Sting deficiency reduces NLRP3 inflammasome activation and GSDMD-induced microglial pyroptosis in ICH mice
We further explored the role of the microglial STING pathway in the activation of the NLRP3 inflammasome and GSDMD-induced pyroptosis induced by ICH. Compared with those in ICH-operated Stingfl/fl mice, the expression levels of NLRP3, cleaved caspase-1, GSDMD, GSDMD-N, pro-IL-1β, and cleaved-IL-1β were significantly lower in the perihaematomal region of ICH-operated Stingfl/fl;Cx3cr1Cre mice (Fig. 8a, b). This reduction in the IL-1β level was further confirmed via ELISA (Supplementary Fig. S10a). Moreover, the transcription level of Il1b was markedly reduced in these mice (Supplementary Fig. S10b). Immunofluorescence staining further revealed that the knockout of Sting in microglia led to a significant decrease in the expression of NLRP3, GSDMD, and GSDMD-N, as well as a reduction in the number of NLRP3-, GSDMD-, and GSDMD-N-positive microglia in ICH-operated Stingfl/fl;Cx3cr1Cre mice compared with ICH-operated Stingfl/fl mice (Fig. 8c–f, Supplementary Fig. S11). Additionally, DHE staining revealed a lower level of ROS in the ICH-operated Stingfl/fl;Cx3cr1Cre mice than in the ICH-operated Stingfl/fl mice (Supplementary Fig. S12). These findings indicate that microglial STING is involved in ICH-induced NLRP3 inflammasome activation and microglial pyroptosis.
Fig. 8. Microglial Sting knockout reduces NLRP3 inflammasome activation and microglial pyroptosis following ICH.
a Western blot analysis demonstrating the expression levels of NLRP3, cleaved caspase-1, GSDMD, GSDMD-N, pro-IL-1β, and cleaved-IL-1β in the perilesional region of sham- and ICH-operated Stingfl/fl and Stingfl/fl;Cx3cr1Cre mice. The mice were evaluated on day 3 postoperation. b Quantitative analysis of the Western blot results (n = 3). c Immunofluorescence double staining showing the colocalization of NLRP3 (green) and IBA-1 (red) in the perilesional region of each group. Scale bar = 50 μm. d Quantitative analysis of NLRP3 expression and its colocalization with IBA-1 (n = 6). e Immunofluorescence double staining for GSDMD-N (green) and IBA-1 (red), along with their colocalization in the perilesional region of all groups. Scale bar = 50 μm. f Quantitative analysis of GSDMD-N expression and its colocalization with IBA-1 (n = 6). The data are shown as the means ± SEMs, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Microglial Sting deficiency reduces cell apoptosis, neuronal degeneration, and haemorrhage volume and mitigates motor deficits following ICH
Finally, we investigated the effects of Sting deletion in microglia on apoptosis, neuronal degeneration, haematoma at the injury site, and behavioural impairments resulting from ICH. As expected, TUNEL and FJC assays demonstrated significant attenuation of cell apoptosis and neuronal degeneration in the ICH-operated Stingfl/fl;Cx3cr1Cre mice compared with the Stingfl/fl mice with ICH (Fig. 9a–d). Additionally, the knockout of Sting in microglia significantly mitigated ICH-induced haematoma, as revealed by MR images (Fig. 9e, f). Furthermore, compared with Stingfl/fl mice, ICH-operated Stingfl/fl;Cx3cr1Cre mice exhibited improvements in various behaviours, including motor and sensory functions, coordination and balance, and lateralized motor behaviours, on day 3 post-ICH (Fig. 9g). These results suggest that microglial STING plays a key role in tissue and neuronal injury and contributes to motor dysfunction following ICH.
Fig. 9. Microglial Sting deletion mitigates neuronal damage, intracerebral haemorrhage, and motor function impairments following ICH.
a Representative images of TUNEL staining showing apoptotic cells in the perilesional region of sham- and ICH-operated Stingfl/fl and Stingfl/fl;Cx3cr1Cre mice. The mice were evaluated on day 3 postoperation. Scale bar = 50 μm. b Quantitative analysis of the TUNEL staining results (n = 6). c Representative images of FJC staining demonstrating degenerating neurons in the perilesional region across groups. Scale bar = 50 μm. d Quantitative analysis of the FJC staining results (n = 6). e Representative MR images illustrating haemorrhage volume across groups, with red circles indicating areas of haemorrhage. f Quantitative analysis of the MRI results. The numbers of mice in the four groups were 3, 5, 3, and 5, respectively. g Behavioural assessments, including the mNSS, rotarod test, and elevated body swing test, were performed on the mice prior to the ICH procedure and on days 1 and 3 postoperation. The numbers of mice in the four groups were 4, 6, 4, and 6, respectively. The data are shown as the means ± SEMs, *P < 0.05, **P < 0.01, ***P< 0.001, ****P < 0.0001 for Stingfl/fl;Cx3cr1Cre ICH vs. Stingfl/fl ICH.
Discussion
The cGAS-STING pathway is not only the primary innate immune pathway for sensing and defending against DNA viruses but also the detection of host cytoplasmic DNA, leading to abnormal activation associated with various neuroinflammatory and autoimmune diseases [51–56]. Several studies have indicated that activation of the cGAS-STING pathway is crucial to the pathophysiology of ischaemic stroke, and evidence from experimental animal models has demonstrated that blocking this pathway significantly alleviates the associated pathology [11, 57, 58]. However, the role and underlying mechanisms of this pathway in ICH have yet to be fully elucidated. In the present study, we utilized a well-established mouse model of spontaneous haemorrhagic stroke and identified significant activation of the cGAS-STING pathway in microglia induced following ICH. Both pharmacological inhibition and microglial genetic knockout of Sting result in a substantial reduction in STING pathway activation and the production/release of downstream inflammatory factors in the perihaematomal region of ICH model mice. Furthermore, these interventions lower the expression of NLRP3 and the proteins related to GSDMD-induced pyroptosis, improve cell apoptosis, reduce haematoma volume, and facilitate the recovery of impaired neurological motor functions. These findings suggest that the cGAS‒STING pathway is a critical therapeutic target for haemorrhagic stroke.
An increasing number of studies have demonstrated that inflammatory responses, particularly neuroinflammation, play a significant role in the pathological process and prognosis of ICH [59–61]. However, there are currently no clinically effective immunomodulatory drugs available for ICH. Our data indicate that in a mouse model of ICH, H151 markedly reduces ICH-induced neuroinflammation by inhibiting the activation of the microglial STING pathway and alleviating various motor dysfunctions associated with ICH. Notably, the therapeutic effects of H151 on motor function recovery in ICH mice persisted for at least seven days post-ICH. H151 is a highly specific antagonist of STING that is capable of inhibiting STING signalling pathway activation and downstream type I IFN production, as well as NF-κB-related gene expression [37, 62]. It has been widely used in studies investigating various STING pathway-related mechanisms [63, 64]. Studies have demonstrated that H151 is capable of penetrating the blood‒brain barrier and has promising therapeutic potential for a variety of neurological diseases [39, 65, 66], including experimental ischaemic stroke [38]. Our findings highlight its substantial potential in mitigating neuroinflammation and facilitating recovery following ICH.
Another important finding of this study is that the use of microglial Sting knockout mice confirmed the involvement of the microglial STING pathway in ICH-induced neuroinflammation, brain pathology, and motor dysfunction. Notably, the deletion of microglial Sting alleviated ICH pathology to a degree similar to that observed with intraperitoneal H151 administration. However, the inhibitory effects of H151 on haematoma volume and microglial activation were less pronounced than those of H151, suggesting that H151 may have additional effects on other STING+ immune cell populations. Previous studies have indicated that peripheral immune cells can infiltrate the region surrounding the haematoma through a compromised blood‒brain barrier following ICH [4]. Therefore, our findings suggest that while microglial STING-mediated neuroinflammation significantly contributes to ICH pathophysiology, other STING+ immune cells, such as infiltrating macrophages of myeloid origin, may also play a role in ICH pathology.
In this study, we demonstrated that pharmacological intervention or microglial Sting knockout effectively suppressed the activation of the STING/TBK1/IRF3 and NF-κB signalling pathways, along with the expression of downstream genes. Furthermore, microglial Sting knockout significantly reduced the expression of NLRP3 and GSDMD-mediated pyroptosis-related proteins, including cleaved caspase-1, GSDMD, GSDMD-N, pro-IL-1β, and cleaved-IL-1β. Proinflammatory cytokines, including IL-1β, are significantly elevated in the brains of ICH patients [67]. Since NLRP3 acts as a critical downstream effector of STING [24, 25] and GSDMD-induced pyroptosis is predominantly initiated by inflammasomes, particularly NLRP3 [44], we investigated whether STING-induced activation of the NLRP3/GSDMD axis plays a pivotal role in the neurological dysfunction associated with ICH. Our findings revealed that the NLRP3 inhibitor MCC950 alleviated ICH-induced behavioural deficits to a slightly lesser extent than H151 did, whereas MCC950 exhibited marginally superior efficacy in mitigating ICH compared with the GSDMD inhibitor disulfiram. These results suggest that NLRP3 may serve as the primary downstream effector of STING in ICH pathology. Although NLRP3 primarily regulates GSDMD, it may also contribute to ICH through alternative pathways. Furthermore, although H151 demonstrated slightly greater efficacy than MCC950 in alleviating ICH-induced behavioural deficits, it remains the most effective therapeutic intervention and holds significant promise for clinical application in mitigating secondary damage mediated by inflammatory responses following ICH.
Furthermore, we observed a significant increase in dsDNA in both the nucleus and cytoplasm of cells within the perihaematomal region of ICH mice. As one of the most potent damage-associated molecular patterns (DAMPs), dsDNA can be recognized by cGAS [18, 68]. Consequently, we further revealed significant activation of the cGAS‒STING pathway in microglia surrounding the haematoma. The presence of broken dsDNA was observed in the brains of ICH patients [69]. Additionally, Gu et al. reported an increase in cytosolic mitochondrial DNA (mtDNA) in microglia around the haematoma in a mouse model of ICH induced by unilateral infusion of autologous whole blood [70]. The cGAS-STING pathway has also been reported to detect mtDNA in the cytoplasm [71]. These findings suggest that dsDNA or mtDNA released from damaged neurons and activated microglia following ICH may play a role in the activation of the cGAS‒STING pathway.
Notably, our study has several limitations. First, while we focused on the role of microglial STING, the STING pathway in other cell types, such as peripherally infiltrating macrophages, may also contribute to ICH pathology, a possibility that warrants further investigation. Second, although we confirmed the critical involvement of the NLRP3/GSDMD axis in STING-mediated ICH pathogenesis, the roles of other STING-regulated pathways, including TBK1/IRF3, NF-κB, and oxidative stress, have yet to be fully elucidated. Additionally, the processes of damage and repair following ICH are prolonged and dynamic. While our findings demonstrate that inhibiting microglial STING activation attenuates pathological damage during the early phase of ICH, its effects on brain tissue repair during the intermediate and late stages, particularly in terms of modulating anti-inflammatory factors and resolving inflammation, require further exploration.
In conclusion, this study demonstrated that the cGAS‒STING pathway is significantly activated in the perihaematomal region of an experimental mouse model of ICH. Pharmacological intervention with the selective STING antagonist H151 or microglial Sting knockout effectively inhibits the activation of STING signalling and reduces NLRP3 inflammasome activation and GSDMD-induced pyroptosis, thus alleviating motor dysfunction in ICH mice. Therefore, the cGAS-STING pathway represents a potential therapeutic target for ICH, and precise regulation of this pathway in microglia may provide novel strategies for the treatment of haemorrhagic stroke.
Supplementary information
Acknowledgements
This study was funded by the National Key R&D Program of China (2022YFF1203005), the China National Science and Technology Innovation 2030 (2021ZD0204004), the National Natural Science Foundation of China (grant number 22177068, 22494694, 82171292), and the Natural Science Foundation of Shanghai (Grant 24ZR1491100, 22ZR1434700).
Author contributions
YXX, YJC, MZQ, and FFS performed the experiments. YXX processed and analysed the data. YXX, YY, and CYD wrote the manuscript. YHS, AZ, LGB, YTL, and YY provided the critical reagents and participated in the discussions. CYD, YY, and AZ conceived and designed the study. All the authors have read and approved the final manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Liu-guan Bian, Email: blg11118@rjh.com.cn.
Ao Zhang, Email: ao6919zhang@sjtu.edu.cn.
Yang Yu, Email: yuyang2011@sjtu.edu.cn.
Chun-yong Ding, Email: chunding@sjtu.edu.cn.
Supplementary information
The online version contains supplementary material available at 10.1038/s41401-025-01540-8.
References
- 1.Xi G, Keep RF, Hoff JT. Mechanisms of brain injury after intracerebral haemorrhage. Lancet Neurol. 2006;5:53–63. [DOI] [PubMed] [Google Scholar]
- 2.Broderick JP, Grotta JC, Naidech AM, Steiner T, Sprigg N, Toyoda K, et al. The story of intracerebral hemorrhage: from recalcitrant to treatable disease. Stroke. 2021;52:1905–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cordonnier C, Demchuk A, Ziai W, Anderson CS. Intracerebral haemorrhage: current approaches to acute management. Lancet. 2018;392:1257–68. [DOI] [PubMed] [Google Scholar]
- 4.Tschoe C, Bushnell CD, Duncan PW, Alexander-Miller MA, Wolfe SQ. Neuroinflammation after intracerebral hemorrhage and potential therapeutic targets. J Stroke. 2020;22:29–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Magid-Bernstein J, Girard R, Polster S, Srinath A, Romanos S, Awad IA, et al. Cerebral hemorrhage: pathophysiology, treatment, and future directions. Circ Res. 2022;130:1204–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lan X, Han X, Li Q, Yang QW, Wang J. Modulators of microglial activation and polarization after intracerebral haemorrhage. Nat Rev Neurol. 2017;13:420–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shao A, Zhu Z, Li L, Zhang S, Zhang J. Emerging therapeutic targets associated with the immune system in patients with intracerebral haemorrhage (ICH): from mechanisms to translation. EBioMedicine. 2019;45:615–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Heneka MT, McManus RM, Latz E. Inflammasome signalling in brain function and neurodegenerative disease. Nat Rev Neurosci. 2018;19:610–21. [DOI] [PubMed] [Google Scholar]
- 9.Swanson KV, Deng M, Ting JP. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 2019;19:477–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chen D, Dixon BJ, Doycheva DM, Li B, Zhang Y, Hu Q, et al. IRE1alpha inhibition decreased TXNIP/NLRP3 inflammasome activation through miR-17-5p after neonatal hypoxic-ischemic brain injury in rats. J Neuroinflamm. 2018;15:32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Li W, Shen N, Kong L, Huang H, Wang X, Zhang Y, et al. STING mediates microglial pyroptosis via interaction with NLRP3 in cerebral ischaemic stroke. Stroke Vasc Neurol. 2024;9:153–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lei P, Li Z, Hua Q, Song P, Gao L, Zhou L, et al. Ursolic acid alleviates neuroinflammation after intracerebral hemorrhage by mediating microglial pyroptosis via the NF-kappaB/NLRP3/GSDMD pathway. Int J Mol Sci. 2023;24:14771. [DOI] [PMC free article] [PubMed]
- 13.Toldo S, Abbate A. The role of the NLRP3 inflammasome and pyroptosis in cardiovascular diseases. Nat Rev Cardiol. 2024;21:219–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Guo S, Wang R, Hu J, Sun L, Zhao X, Zhao Y, et al. Photobiomodulation promotes hippocampal CA1 NSC differentiation toward neurons and facilitates cognitive function recovery involving NLRP3 inflammasome mitigation following global cerebral ischemia. Front Cell Neurosci. 2021;15:731855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Yu P, Zhang X, Liu N, Tang L, Peng C, Chen X. Pyroptosis: mechanisms and diseases. Signal Transduct Target Ther. 2021;6:128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wei C, Jiang W, Wang R, Zhong H, He H, Gao X, et al. Brain endothelial GSDMD activation mediates inflammatory BBB breakdown. Nature. 2024;629:893–900. [DOI] [PubMed] [Google Scholar]
- 17.Liu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, et al. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016;535:153–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wu J, Sun L, Chen X, Du F, Shi H, Chen C, et al. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science. 2013;339:826–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gulen MF, Samson N, Keller A, Schwabenland M, Liu C, Gluck S, et al. cGAS-STING drives ageing-related inflammation and neurodegeneration. Nature. 2023;620:374–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhang X, Bai XC, Chen ZJ. Structures and mechanisms in the cGAS-STING innate immunity pathway. Immunity. 2020;53:43–53. [DOI] [PubMed] [Google Scholar]
- 21.Balka KR, Louis C, Saunders TL, Smith AM, Calleja DJ, D’Silva DB, et al. TBK1 and IKKepsilon act redundantly to mediate STING-Induced NF-kappaB responses in myeloid cells. Cell Rep. 2020;31:107492. [DOI] [PubMed] [Google Scholar]
- 22.Ding R, Li H, Liu Y, Ou W, Zhang X, Chai H, et al. Activating cGAS-STING axis contributes to neuroinflammation in CVST mouse model and induces inflammasome activation and microglia pyroptosis. J Neuroinflamm. 2022;19:137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li Y, Li J, Yu Q, Ji L, Peng B. METTL14 regulates microglia/macrophage polarization and NLRP3 inflammasome activation after ischemic stroke by the KAT3B-STING axis. Neurobiol Dis. 2023;185:106253. [DOI] [PubMed] [Google Scholar]
- 24.Gaidt MM, Ebert TS, Chauhan D, Ramshorn K, Pinci F, Zuber S, et al. The DNA inflammasome in human myeloid cells is initiated by a STING-cell death program upstream of NLRP3. Cell. 2017;171:1110–24.e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang W, Hu D, Wu C, Feng Y, Li A, Liu W, et al. STING promotes NLRP3 localization in ER and facilitates NLRP3 deubiquitination to activate the inflammasome upon HSV-1 infection. PLoS Pathog. 2020;16:e1008335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gamdzyk M, Doycheva DM, Araujo C, Ocak U, Luo Y, Tang J, et al. cGAS/STING pathway activation contributes to delayed neurodegeneration in neonatal hypoxia-ischemia rat model: possible involvement of LINE-1. Mol Neurobiol. 2020;57:2600–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shao J, Meng Y, Yuan K, Wu Q, Zhu S, Li Y, et al. RU.521 mitigates subarachnoid hemorrhage-induced brain injury via regulating microglial polarization and neuroinflammation mediated by the cGAS/STING/NF-kappaB pathway. Cell Commun Signal. 2023;21:264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Xu C, Pan Y, Zhang H, Sun Y, Cao Y, Qi P, et al. Platelet-membrane-coated polydopamine nanoparticles for neuroprotection by reducing oxidative stress and repairing damaged vessels in intracerebral hemorrhage. Adv Health Mater. 2023;12:e2300797. [DOI] [PubMed] [Google Scholar]
- 29.Kobritz M, Borjas T, Patel V, Coppa G, Aziz M, Wang P. H151, a small molecule inhibitor of sting as a novel therapeutic in intestinal ischemia-reperfusion injury. Shock. 2022;58:241–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Xu C, Jiang F, Mao Y, Wei W, Song J, Jia F, et al. Disulfiram attenuates cell and tissue damage and blood‒brain barrier dysfunction after intracranial haemorrhage by inhibiting the classical pyroptosis pathway. Sci Rep. 2024;14:21860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ren H, Kong Y, Liu Z, Zang D, Yang X, Wood K, et al. Selective NLRP3 (pyrin domain-containing protein 3) inflammasome inhibitor reduces brain injury after intracerebral hemorrhage. Stroke. 2018;49:184–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Fan H, Ding R, Liu W, Zhang X, Li R, Wei B, et al. Heat shock protein 22 modulates NRF1/TFAM-dependent mitochondrial biogenesis and DRP1-sparked mitochondrial apoptosis through AMPK-PGC1alpha signaling pathway to alleviate the early brain injury of subarachnoid hemorrhage in rats. Redox Biol. 2021;40:101856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yang J, Li Q, Wang Z, Qi C, Han X, Lan X, et al. Multimodality MRI assessment of grey and white matter injury and blood-brain barrier disruption after intracerebral haemorrhage in mice. Sci Rep. 2017;7:40358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Liu Y, Cui F, Xu A, Wang B, Ma Y, Zhang Q, et al. Interaction between the PERK/ATF4 branch of the endoplasmic reticulum stress and mitochondrial one-carbon metabolism regulates neuronal survival after intracerebral hemorrhage. Int J Biol Sci. 2024;20:4277–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Xu J, Chen Z, Yu F, Liu H, Ma C, Xie D, et al. IL-4/STAT6 signaling facilitates innate hematoma resolution and neurological recovery after hemorrhagic stroke in mice. Proc Natl Acad Sci USA. 2020;117:32679–90. [DOI] [PMC free article] [PubMed]
- 36.Xiao Y, Zhao C, Tai Y, Li B, Lan T, Lai E, et al. STING mediates hepatocyte pyroptosis in liver fibrosis by epigenetically activating the NLRP3 inflammasome. Redox Biol. 2023;62:102691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Haag SM, Gulen MF, Reymond L, Gibelin A, Abrami L, Decout A, et al. Targeting STING with covalent small-molecule inhibitors. Nature. 2018;559:269–73. [DOI] [PubMed] [Google Scholar]
- 38.Wu C, Zhang S, Sun H, Li A, Hou F, Qi L, et al. STING inhibition suppresses microglia-mediated synapses engulfment and alleviates motor functional deficits after stroke. J Neuroinflamm. 2024;21:86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Xie X, Ma G, Li X, Zhao J, Zhao Z, Zeng J. Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5xFAD mice. Nat Aging. 2023;3:202–12. [DOI] [PubMed] [Google Scholar]
- 40.Li Y, Liu C, Wang G, Wang H, Liu X, Huang C, et al. HDAC3 inhibitor (BRD3308) modulates microglial pyroptosis and neuroinflammation through PPARgamma/NLRP3/GSDMD to improve neurological function after intraventricular hemorrhage in mice. Neuropharmacology. 2023;237:109633. [DOI] [PubMed] [Google Scholar]
- 41.Karmakar M, Minns M, Greenberg EN, Diaz-Aponte J, Pestonjamasp K, Johnson JL, et al. N-GSDMD trafficking to neutrophil organelles facilitates IL-1beta release independently of plasma membrane pores and pyroptosis. Nat Commun. 2020;11:2212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hayman TJ, Baro M, MacNeil T, Phoomak C, Aung TN, Cui W, et al. STING enhances cell death through regulation of reactive oxygen species and DNA damage. Nat Commun. 2021;12:2327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Li N, Zhou H, Wu H, Wu Q, Duan M, Deng W, et al. STING-IRF3 contributes to lipopolysaccharide-induced cardiac dysfunction, inflammation, apoptosis and pyroptosis by activating NLRP3. Redox Biol. 2019;24:101215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wang C, Yang T, Xiao J, Xu C, Alippe Y, Sun K, et al. NLRP3 inflammasome activation triggers gasdermin D-independent inflammation. Sci Immunol. 2021;6:eabj3859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Coll RC, Robertson AA, Chae JJ, Higgins SC, Munoz-Planillo R, Inserra MC, et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med. 2015;21:248–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Tapia-Abellan A, Angosto-Bazarra D, Martinez-Banaclocha H, de Torre-Minguela C, Ceron-Carrasco JP, Perez-Sanchez H, et al. MCC950 closes the active conformation of NLRP3 to an inactive state. Nat Chem Biol. 2019;15:560–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Hu JJ, Liu X, Xia S, Zhang Z, Zhang Y, Zhao J, et al. FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formation. Nat Immunol. 2020;21:736–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Aglietti RA, Estevez A, Gupta A, Ramirez MG, Liu PS, Kayagaki N, et al. GsdmD p30 elicited by caspase-11 during pyroptosis forms pores in membranes. Proc Natl Acad Sci USA. 2016;113:7858–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Ding J, Wang K, Liu W, She Y, Sun Q, Shi J, et al. Pore-forming activity and structural autoinhibition of the gasdermin family. Nature. 2016;535:111–6. [DOI] [PubMed] [Google Scholar]
- 50.Devant P, Kagan JC. Molecular mechanisms of gasdermin D pore-forming activity. Nat Immunol. 2023;24:1064–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Zhao Q, Wei Y, Pandol SJ, Li L, Habtezion A. STING signaling promotes inflammation in experimental acute pancreatitis. Gastroenterology. 2018;154:1822–35 e2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Abdullah A, Zhang M, Frugier T, Bedoui S, Taylor JM, Crack PJ. STING-mediated type-I interferons contribute to the neuroinflammatory process and detrimental effects following traumatic brain injury. J Neuroinflamm. 2018;15:323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Woo MS, Mayer C, Binkle-Ladisch L, Sonner JK, Rosenkranz SC, Shaposhnykov A, et al. STING orchestrates the neuronal inflammatory stress response in multiple sclerosis. Cell. 2024;187:4043–60.e30. [DOI] [PubMed] [Google Scholar]
- 54.Hou Y, Wei Y, Lautrup S, Yang B, Wang Y, Cordonnier S, et al. NAD+ supplementation reduces neuroinflammation and cell senescence in a transgenic mouse model of Alzheimer’s disease via cGAS-STING. Proc Natl Acad Sci USA. 2021;118:e2011226118. [DOI] [PMC free article] [PubMed]
- 55.Hinkle JT, Patel J, Panicker N, Karuppagounder SS, Biswas D, Belingon B, et al. STING mediates neurodegeneration and neuroinflammation in nigrostriatal alpha-synucleinopathy. Proc Natl Acad Sci USA. 2022;119:e2118819119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Zhou X, Wang J, Yu L, Qiao G, Qin D, Yuen-Kwan Law B, et al. Mitophagy and cGAS-STING crosstalk in neuroinflammation. Acta Pharm Sin B. 2024;14:3327–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Maimaiti M, Li C, Cheng M, Zhong Z, Hu J, Yang L, et al. Blocking cGAS-STING pathway promotes post-stroke functional recovery in an extended treatment window via facilitating remyelination. Med. 2024;5:622–44.e8. [DOI] [PubMed] [Google Scholar]
- 58.Li Q, Cao Y, Dang C, Han B, Han R, Ma H, et al. Inhibition of double-strand DNA-sensing cGAS ameliorates brain injury after ischemic stroke. EMBO Mol Med. 2020;12:e11002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Bader ER, Pana TA, Barlas RS, Metcalf AK, Potter JF, Myint PK. Elevated inflammatory biomarkers and poor outcomes in intracerebral hemorrhage. J Neurol. 2022;269:6330–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Gu T, Pan J, Chen L, Li K, Wang L, Zou Z, et al. Association of inflammatory cytokines expression in cerebrospinal fluid with the severity and prognosis of spontaneous intracerebral hemorrhage. BMC Neurol. 2024;24:7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Xue M, Yong VW. Neuroinflammation in intracerebral haemorrhage: immunotherapies with potential for translation. Lancet Neurol. 2020;19:1023–32. [DOI] [PubMed] [Google Scholar]
- 62.Pan Y, You Y, Sun L, Sui Q, Liu L, Yuan H, et al. The STING antagonist H-151 ameliorates psoriasis via suppression of STING/NF-kappaB-mediated inflammation. Br J Pharmacol. 2021;178:4907–22. [DOI] [PubMed] [Google Scholar]
- 63.Wu B, Xu MM, Fan C, Feng CL, Lu QK, Lu HM, et al. STING inhibitor ameliorates LPS-induced ALI by preventing vascular endothelial cells-mediated immune cells chemotaxis and adhesion. Acta Pharmacol Sin. 2022;43:2055–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Hu Z, Zhang F, Brenner M, Jacob A, Wang P. The protective effect of H151, a novel STING inhibitor, in renal ischemia-reperfusion-induced acute kidney injury. Am J Physiol Ren Physiol. 2023;324:F558–F67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Qiao H, Chiu Y, Liang X, Xia S, Ayrapetyan M, Liu S, et al. Microglia innate immune response contributes to the antiviral defense and blood-CSF barrier function in human choroid plexus organoids during HSV-1 infection. J Med Virol. 2023;95:e28472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zamiri K, Kesari S, Paul K, Hwang SH, Hammock B, Kaczor-Urbanowicz KE, et al. Therapy of autoimmune inflammation in sporadic amyotrophic lateral sclerosis: dimethyl fumarate and H-151 downregulate inflammatory cytokines in the cGAS-STING pathway. FASEB J. 2023;37:e23068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Ohashi SN, DeLong JH, Kozberg MG, Mazur-Hart DJ, van Veluw SJ, Alkayed NJ, et al. Role of inflammatory processes in hemorrhagic stroke. Stroke. 2023;54:605–19. [DOI] [PubMed] [Google Scholar]
- 68.Sun L, Wu J, Du F, Chen X, Chen ZJ. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 2013;339:786–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Loan JJ, Kirby C, Emelianova K, Dando OR, Poon MT, Pimenova L, et al. Secondary injury and inflammation after intracerebral haemorrhage: a systematic review and meta-analysis of molecular markers in patient brain tissue. J Neurol Neurosurg Psychiatry. 2022;93:126–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Gu F, Wang Z, Ding H, Tao X, Zhang J, Dai K, et al. Microglial mitochondrial DNA release contributes to neuroinflammation after intracerebral hemorrhage through activating AIM2 inflammasome. Exp Neurol. 2024;382:114950. [DOI] [PubMed] [Google Scholar]
- 71.Yu CH, Davidson S, Harapas CR, Hilton JB, Mlodzianoski MJ, Laohamonthonkul P, et al. TDP-43 triggers mitochondrial DNA release via mPTP to activate cGAS/STING in ALS. Cell. 2020;183:636–49.e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.









