Biotechnological Elucidation of Xinyin Tablet’s Mechanism: SIRT1 Activation Attenuates Cardiac Fibrosis Via Suppressing Endothelial-to-Mesenchymal Transition

Abstract

Background:

Xinyin tablet (XYT), a traditional Chinese medicine consisting of Ginseng, Ophiopogon, Astragalus, Ilex pubescens, Motherwort, and other medicines, is clinically used to manage chronic heart failure (HF), yet its molecular mechanisms remain underexplored.

Objectives:

This study integrates biotechnological approaches to investigate how XYT mitigates cardiac fibrosis by targeting the SIRT1-mediated TGF-β/Smad signaling pathway.

Materials and Methods:

Transverse aortic constriction (TAC)-induced HF mice and TGF-β1-stimulated myocardial microvascular endothelial cells (MMECs) were employed. Echocardiography, histopathology, and molecular assays (qRT-PCR, Western blotting, siRNA transfection) were utilized to assess cardiac function, fibrosis, and signaling pathways.

Results:

XYT treatment significantly improved cardiac function (↑LVEF, LVFS; ↓LVIDs, LVIDd) and reduced collagen I/III deposition in TAC mice. Mechanistically, XYT upregulated SIRT1 expression while suppressing EndMT markers (↓α-SMA, ↑VE-cadherin) and TGF-β/Smad signaling (↓TGF-βR1, p-Smad2/3). Crucially, SIRT1 knockdown in MMECs abolished XYT’s inhibitory effects on EndMT and TGF-β/Smad activation, confirming SIRT1’s pivotal role.

Conclusions:

These findings highlight XYT’s biotechnological relevance by linking SIRT1 activation to EndMT inhibition, offering a novel therapeutic strategy for cardiac fibrosis. This study underscores the potential of integrating traditional medicine with molecular biotechnology to develop targeted therapies for cardiovascular diseases.

1. Background

Myocardial fibrosis (MF) is unavoidable in the end stage of many cardiovascular diseases, giving rise to severe cardiac dysfunction and even death ( 1 ). Management of MF is based on beta-blockers, diuretics, vasodilators, and angiotensin-converting enzyme inhibitors ( 2 ), which can improve clinical symptoms but are difficult to reverse the process of MF. Therefore, seeking effective drugs to inhibit or reverse MF is essential.

At the cellular level, MF manifests through trans-formation of quiescent cardiac fibroblasts (CFs) into extracellular matrix (ECM)-producing myo- fibroblasts and subsequent ECM over-deposition, ultimately driving structural remodeling of myocardial tissue ( 3 ). In fibrotic tissues, a significant proportion (27%–35%) of fibroblasts are derived from endothelial cells (ECs) via endothelial-to-mesenchymal transition (EndMT) ( 4 ), a dynamic process in which ECs lose their endothelial identity and adopt mesenchymal features, including altered morphology and pro-fibrotic functions. EndMT is pathologically hallmarked by the progressive loss of endothelial-specific markers (e.g., VE-calmodulin and vascular hemophilic factor) in endothelial cells, coupled with the acquisition of mesenchymal or myofibroblast phenotypes characterized by upregulated expression of type III collagen, type I collagen, and α-smooth muscle actin (α-SMA) ( 5 ). The hallmark of EndMT is the progressive loss of endothelial-specific markers in ECs such as VE-calmodulin and vascular hemophilic factor and the acquisition of mesenchymal or myofibroblast phenotypes such as collagen III, collagen I, vimentin, and α-smooth muscle actin (α-SMA) ( 5 ). Moreover, the loss of polarity and connectivity and the gaining of invasive and migratory abilities of ECs during EndMT increase the number of CFs, promote ECM deposition, and decrease ventricular compliance, resulting in MF ( 6 ). Available evidence demonstrated that suppression of EndMT can relieve MF obviously in heart failure (HF) models urged by transverse aortic constriction (TAC) ( 7 ). Thus, modulation of EndMT may be a promising strategy for MF treatment.

Silent information regulator 1 (SIRT1), a member of the nicotinic adenine dinucleotide-dependent deacetylase family of sirtuins, is associated with the aging process, cancer, cardiovascular diseases, and neurodegenerative disorders ( 8 ). Existing evidence suggests that the activation of SIRT1 can dampen MF through the modulation of EndMT ( 9 , 10 ). Some scholars discovered that SIRT1 activation can undermine the transforming growth factor beta (TGF-β)/small mother against decapentaplegic (Smad) signaling, thereby mitigating MF and improving cardiac function ( 11 , 12 ). TGF-β, a key profibrotic mediator in fibrotic diseases, can carry out regula-tory signaling by influencing the phosphorylation of Smads ( 13 ). Attractively, EndMT is predominantly orchestrated by the TGF-β/Smad pathway ( 14 ). Therefore, therapeutic targeting of this axis via SIRT1 activation may effectively counteract MF by interrupting TGF-β/Smad- orchestrated endothelial phenotypic switching. Hence, augmentation of SIRT1 activity may be a novel therapeutic strategy to prevent or reverse MF.

Xinyin tablet (XYT) consists of Ginseng, Ophiopogon, Astragalus, Ilex pubescens, Motherwort, Schisandra chinensis, Semen lepidii, and other medicines ( 15 ). In traditional Chinese medicine (TCM) practice, XYT is routinely administered to treat chronic hypertension characterized by the triad of qi-yin deficiency, blood stasis, and fluid stagnation, owing to its integrated actions of qi supplementation, yin restoration, edema reduction, and blood stasis elimination ( 15 ). Although XYT is regularly used in managing HF, the mechanisms by which it works are not yet perfectly clarified.

2. Objectives

Therefore, the current research discussed the mechanism in which XYT alleviates MF by inhibiting EndMT and the TGF-β1/Smads pathway through activation of SIRT1, intending to provide new targets and strategies for the combination of MF in HF.

3. Materials and Methods

3.1. Experimental Animals

Wild-type C57Bl/6 mice (male, 22-25 g, 6–8 wk old; Animal Experiment Centre of Guangzhou University of Chinese Medicine, Guangzhou, China) were maintained at controlled temperature (20-26 °C) and humidity (40%−70%) under 12:12-h dark-light cycles in a specific pathogen free-grade facility with water and food ad libitum. Animal experiments were conducted with the approval of the Animal Ethics Committee of the First Affiliated Hospital of Guangzhou University of Chinese Medicine, and all animal operations adhered to the relevant regulations of the Animal Ethics Committee (No. 20240023). Animal studies were conducted under a protocol rigorously addressing: (i) ethical validation of animal use, (ii) welfare assurance, and (iii) implementation of the 3Rs principles (Replacement, Reduction, Refinement). Terminal euthanasia was performed by cervical dislocation at study endpoint.

3.2. Animal Models

TAC was undertaken in the light of a previous study ( 16 ). The combination of xylazine (6.2 mg.kg^-1) and ketamine (120 mg.kg^-1) was administered by intraperitoneal injection to anesthetize the mice. The anesthetized mice were attached to a small animal ventilator via laryngotracheal intubation after fixation in a supine position on a transparent plate. An incision was created at the second intercostal space at the edge of the left upper sternum in mice, followed by the insertion of a chest retractor to expose the aortic arch. The transverse aortic arch was tied with a 7-0 silk suture using a 27-gauge needle. Following needle withdrawal, both thoracic and cutaneous incisions were sutured with 4-0 silk sutures. The ventilator was then detached, and animals were maintained on heating pads until regaining consciousness. Sham-operated mice underwent identical procedures excluding aortic banding. After surgery, penicillin (1800 U/100 g) was administered intramuscularly for 3 days to prevent infection. Four weeks after surgery, ultrasonography of the heart was performed to assess the effectiveness of the modeling.

3.3. Drug Administration

C57Bl/6 mice were randomized subjected to different surgical operations: sham (n = 6) and TAC (n = 24). C57Bl/6 mice underwent TAC were randomized treated with distilled water, XYT-L, XYT-H, or perindopril, with 6 mice for each group. A suspension of XYT (approval number: Yueyao Z20071178) was prepared with distilled water. TAC-induced mice treated with low (L; 0.315 g.kg^-1) or high (H; 1.26 g.kg^-1) dose of XYT by intragastric gavage (i.g.) were assigned into the TAC+XYT-L (n = 6) and TAC+XYT-H (n = 6) groups, respectively (n = 6). The XYT dose for mouse oral gavage was calculated based on “human equivalent dose” conversion rules to mirror the human clinical daily dose ( 17 ). Both sham-operated controls (n = 6) and TAC model mice (n = 6) received an equivalent volume of distilled water following identical administration protocols. Mice in the TAC+perindopril group served as positive controls and were provided with 8 mg/kg of perindopril (approval number: Guoyao H20093504) in the same manner (n = 6). Mice were given a drug or vehicle once a day for 8 weeks. Following anesthesia with 3-5% isoflurane inhalation, all mice were humanely sacrificed by cervical dislocation as the terminal procedure. Left ventricular (LV) samples were collected for subsequent analysis.

3.4. Echocardiography

Transthoracic echocardiographic imaging was achieved via the Vevo 2100 system (VisualSonics, Toronto, Canada) by an investigator who was blinded to animal grouping, with a high-frequency (30 MHz) MS-400 transducer. We anesthetized mice using inhaled isoflurane (3% induction, 1.5% maintenance) before cardiac functional analysis. M-mode imaging under two-dimensional guidance was performed in the long-axis plane at the left ventricular papillary muscle level. Functional parameters were systematically measured to assess cardiac performance, including LV internal dimension in systole (LVIDs), LV internal dimension in diastole (LVIDd), LV ejection fraction (LVEF), and LV short-axis fraction (LVFS).

3.5. Histological Analysis

Fresh cardiac tissues underwent 24-hour fixation with 4% PFA (Sangon, Shanghai, China), followed by embedding in paraffin and cutting into a cross-section (5 μm). Pathological changes were assessed by standard hematoxylin and eosin (HE) staining using the H&E staining kit (MeilunBio, Dalian, China) following the directions provided by the manufacturer. Fibrotic lesions were appraised by Masson’s staining in line with the experimental instructions attached to Masson’s trichrome stain kit (Solarbio, Beijing, China) in the light of the instructions set out by the manufacturer. A bright-field microscope (IX83, Olympus, Japan) was used to capture the stained sections. Morphometric analysis was performed by an investigator who was blinded to randomization in selected fields per section.

3.6. Cell Culture

We cultured mouse myocardial microvascular endothelial cells (MMECs) (catalog number: MIC-iCell-c018; iCell, Shanghai, China) in Dulbecco’s Modified Eagle’s Medium (Thermo, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo) and endothelial cell growth supplement (15 mg. L^-1, ScienCell, Carlsbad, CA, USA). Cells were maintained under standard culture conditions (37 °C, 5% CO2).

3.7. Transfection of Oligonucleotides

Three small interfering RNAs (siRNAs) specific to SIRT1 (si-SIRT1#1: 5’-GCACAGATCCTCGAA CAA-3’; si-SIRT1#2: 5’-GCTGATGAACCGCT TGCTA-3’; and si-SIRT1#3: 5’-CCATGGCGCT GAGGTATAT-3’) and negative control (si-NC: 5’-CCACGCGGAGTATGGTTAT-3’) were synthes-ized by RiboBio (Guangzhou, China). Prior to transfection, MMECs were inoculated at a density of 30% and incubated for 24 hours. Transfection of MMECs with 30 nM oligonucleotides was done with Lipofectamine 2000 (Thermo) following the operating guidelines provided by the manufacturer. After 24 hours of transfection, 10 ng. mL^-1 of TGF-β1 (MCE, Monmouth Junction, NJ, USA) was added to incubate for 24 hours in the absence or presence of XYT (30 μg. mL^-1).

3.8. Western Blotting

Cardiac samples or MMECs were homogenized in RIPA buffer (Sangon), centrifuged at 12,000 rpm (4 °C, 10 min), and the resulting supernatant (total protein lysate) was subjected to BCA-based quantification (MeilunBio). We separated equal protein amounts using 10%-12% SDS-PAGE and transferred them onto polyvinylidene difluoride membranes (pore size: 0.45 μm; Millipore, Bedford, MA, USA). Membranes were blocked in 5% skim milk for 1 hour prior to overnight incubation with primary antibodies at 4 °C. We probed membranes with secondary antibodies for 1 hour, detected signals using ECL substrate (Millipore), and analyzed band intensities with ImageJ (NIH, Bethesda, MD, USA). The loading control is vital to the successful and correct interpretation of Western blot analysis. In our study, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels were unchanged in the ischemic mouse heart tissue compared with sham control, and hence it was used as a loading control. Antibody speci-fications are summarized in Table 1.

Table 1.

Antibodies utilized in Western blotting.

Antibody	Manufacturer	Cat.no	Dilution
Collagen I	Thermo	PA5-95137	0.5 µg/ml
Collagen III	Mybiosource, San Diego, CA, USA	MBS9700404	1:1000
VE-cadherin	MyBioSource	MBS9436055	1:1000
α-SMA	United States Biological	220701	1:1000
SIRT1	GeneTex, Irvine, CA, USA	GTX134606	1:1000
TGFβR1	Biorbyt, Cambridge, UK	orb32997	1:1000
p-Smad2	Bioss, Beijing, China	bs-20341R	1/300
p-Smad3	GeneTex	GTX129841	1:1000
GAPDH	Fine Biotech, Wuhan, China	FNab03342	1:2000

3.9. Reverse Transcriptase-Quantitative Polymerase Chain Reaction (Qrt-PCR)

Primers targeting VE-cadherin, α-SMA, TGF-βR1, Smad2, Smad3, SIRT1, and GAPDH were designed based on sequences reported in the NCBI database and synthesized by RiboBio. Total RNA was extracted from cardiac samples or MMECs using TRIzol reagent (Solarbio). Reverse transcription was implemented using the PrimeScript RT reagent kit (TakaRa, Dalian, China). Gene-specific amplification was quantified via SYBR Premix Ex Taq Kit (Takara). Relative mRNA levels were determined using the delta-delta Ct method, normalizing Ct to GAPDH expression ( 18 ). Primer sequences for qPCR are provided in Table 2.

Table 2.

Primer sequences used for qRT-PCR

Genes	Sequences
VE-cadherin	Forward	AGGCTAGACCGGGAGAAAGT
	Reverse	GTGCGAAAACACAGGCCAAT
α-SMA	Forward	CGTCCCAGACATCAGGGAGTA
	Reverse	ATAGCCACATACATGGCGGG
TGF-βR1	Forward	AGCTGCGCTTGCAGAGATTA
	Reverse	AGCCCTGTATTCCGTCTCCT
Smad2	Forward	CTCGGCACACGGAGATTCTA
	Reverse	TAGGAGACAGTTCAGCCGGA
Smad3	Forward	TGCAGCCGTGGAACTTACAA
	Reverse	GACCTCCCCTCCGATGTAGT
SIRT1	Forward	GCACATGCCAGAGTCCAAGT
	Reverse	CATTCGGGCCTCTCCGTATC
GAPDH	Forward	GGCAAATTCAACGGCACAGT
	Reverse	GGCCTCACCCCATTTGATGT

3.10. Immunofluorescence Staining

For the collected MMECs, fixation was done with 4% paraformaldehyde, followed by a 20-minute incubation with 0.1% Triton X-100/PBS (Sangon). Following a 1-hour incubation with 5% goat serum (Solarbio), the sections were incubated with a primary against α-SMA (catalog number: MA1-06110; Thermo, 1:100) at 4 °C overnight. After washing, the sections were subjected to a 45-minute incubation with Alexa Fluor 488 conjugate (catalog number: A28175; Thermo, 1:2000) (1:300 dilution). Cell nuclei were counterstained with 4’-6-Diamidino-2-phenylindole (Solarbio). Fluorescent images were obtained using a Zeiss fluorescence microscope (LSM 710, Carl Zeiss, Germany).

3.11. Statistical Analysis

We presented quantitative data as mean ± standard error of the mean (SEM) and performed statistical analyses via one-way analysis of variance (ANOVA) with Tukey’s test using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA), with a predetermined significance level (p < 0.05). Effect sizes were reported as eta-squared (η²) for ANOVA.

4. Results

4.1. XYT Mitigated TAC-Induced Cardiac Dysfunction

To study the efficacy of XYT in pressure overload-induced cardiac dysfunction, TAC mouse models were established and subjected to XYT treatment by intragastric, with perindopril as a positive control (Fig. 1A). In comparison with the sham-operated group, mice in the TAC group suffered from a significant decrease in LVEF and LVFS as well as an evident increase in LVIDs and LVIDd (Fig. 1B-1F). However, reduced LVEF and LVFS as well as elevated LVIDs and LVIDd in TAC-induced mice were ameliorated following XYT treatment, and greater efficacy was seen with the higher dose of XYT than with the lower dose (Fig. 1B-1F). The mean ± SEM and effect sizes are given in Table 3. These data suggested that XYT lightened cardiac dysfunction in mice with TAC.

Figure 1.

XYT softened cardiac dysfunction in TAC-induced mouse models. A) Schematic of experimental design. Wild-type C57Bl/6 mice were subjected to sham or TAC and then treated with XYT-L, XYT-H, or perindopril. B) Representative echocardiographic images (M-mode) of mouse hearts from the sham-operated, TAC, and TAC+XYT-L, TAC+XYT-H, or TAC+perindopril groups at 8 weeks. C-F) The echocardiographic parameters LVEF, LVFS, LVIDd and LVIDs respectively were calculated (n = 6). All quantitative data are reported as means ± SEM. ^***p < 0.001 vs. Sham and ^###p < 0.001 vs. TAC; one-way ANOVA with Tukey multiple comparisons test.

Table 3.

Effect of XYT on TAC-induced MF mice

Group	Sham	TAC	TAC+XYT-L	TAC+XYT-H	TAC+perindopril	P-value	Effect size
LVEF (%)	75.94±2.145	33.57±2.515	48.06±1.824	54.30±2.208	63.45±2.896	<0.0001	0.98
LVFS (%)	44.22±2.294	15.82±1.435	23.50±1.293	27.12±1.548	32.57±2.456	<0.0001	0.97
LVIDd (%)	3.315±0.3609	4.105±0.1041	3.200±0.08944	2.977±0.2619	2.612±0.1987	<0.0001	0.85
LVIDs (%)	2.127±0.09352	3.478±0.09326	2.467±0.2083	2.163±0.1275	1.713±0.2378	<0.0001	0.94
Collagen I/GAPDH	1.000±0.07613	2.763±0.3916	2.083±0.1346	1.374±0.008753	1.859±0.05848	<0.0001	0.94
Collagen III/GAPDH	1.000±0.07590	3.339±0.4703	2.554±0.1218	2.056±0.09112	2.439±0.05964	<0.0001	0.95
VE-cadherin mRNA	1.001±0.06098	0.2200±0.02210	0.3447±0.03563	0.5240±0.07989	0.7766±0.1031	<0.0001	0.96
α-SMA mRNA	1.024±0.2852	8.006±1.073	4.652±0.6829	3.685±0.2320	3.346±0.3348	<0.0001	0.95
SIRT1 mRNA	1.014±0.2101	0.4000±0.03846	0.3964±0.06294	1.276±0.2957	1.023±0.1408	0.0003	0.86
TGF-βR1 mRNA	1.021±0.2535	9.353±1.005	7.024±0.5337	2.702±0.1180	4.183±1.474	<0.0001	0.95
Smad2 mRNA	1.026±0.2926	2.368±0.2119	1.513±0.07233	1.055±0.1792	0.8898±0.1190	<0.0001	0.92
Smad3 mRNA	1.018±0.2296	6.881±0.8290	3.044±0.06259	1.870±0.4512	2.328±0.3714	<0.0001	0.97
VE-cadherin/GAPDH	1.000±0.07055	0.1337±0.002586	0.2984±0.01232	0.7737±0.03959	0.6829±0.08565	<0.0001	0.98
α-SMA/GAPDH	1.000±0.05764	4.030±0.04206	3.375±0.1409	2.668±0.2163	2.433±0.1451	<0.0001	0.99
SIRT1/GAPDH	1.000±0.07383	0.3202±0.05709	0.5933±0.02596	1.208±0.03271	0.8672±0.09366	<0.0001	0.97
TGF-βR1/GAPDH	1.000±0.04175	3.119±0.07058	2.575±0.03337	1.541±0.07010	1.557±0.04952	<0.0001	1.00
p-Smad2/GAPDH	1.000±0.09206	7.037±0.2628	2.633±0.1941	1.730±0.2954	1.689±0.2640	<0.0001	0.99
p-Smad3/GAPDH	1.000±0.09332	3.126±0.2303	2.320±0.08775	2.122±0.1752	1.860±0.1518	<0.0001	0.97

4.2. XYT Mitigated MF in TAC Mice

Next, we performed histological analysis on the acquired mouse hearts. HE staining showed that mice in the sham group possessed mild degenerative changes in cardiomyocytes and tight and well-arranged myofibrillar filaments, whereas those in the TAC group demonstrated disorganization of myocardial fibers and enlargement of interstitial space of cardiomyocytes, with cell necrosis and massive infiltration of inflammatory cells. The above-mentioned pathological changes in TAC-induced mice were alleviated upon XYT-L, XYT-H, or perindopril treatment, and the effectiveness of XYT-H was better than that of XYT-L (Fig. 2A). Masson’s staining showed a small number of collagen fibers distributed uniformly around blood vessels in the myocardial tissues of mice from the sham group, whereas substantial numbers of collagen fibers appeared in TAC-induced mice, with a heterogeneous morphology and non-uniform distribution. Also, treatment with XYT-L, XYT-H, or perindopril significantly lessened MF and reduced collagen fiber deposition in TAC mice (Fig. 2B). Further validation of the effect of XYT on MF was performed by detecting the protein levels of collagen I and collagen III. Western blot in-dicated that collagen I and collagen III protein levels were increased overtly in mouse hearts after TAC induction, whereas treatment with XYT-L, XYT-H, or perindopril impaired collagen I and collagen III protein levels in TAC-induced mouse-derived heart samples (Fig. 2C). The mean ± SEM and effect sizes are given in Table 3. All data manifested that XYT lessened MF in TAC-induced mice.

Figure 2.

XYT eased TAC-induced MF in mouse models. A) Typical H&E staining of hearts from mice. B) Representative images of Masson’s staining to assess the extent of cardiac fibrosis in mice. C) Western blotting detection of collagen I and collagen III protein levels in the heart samples (n = 3). All quantitative data are reported as means ± SEM. ^**p < 0.01 vs. Sham and ^#p < 0.05, ^##p < 0.01 vs. TAC; one-way ANOVA with Tukey multiple comparisons test.

4.3. XYT Suppressed Cardiac Endmt and Activated SIRT1in TAC-Induced Mice

As EndMT takes part in the pathological process of fibrosis in many organs including the heart, we further explored the effect of XYT on EndMT-associated markers. The outcomes exhibited that VE-Cadherin (an endothelial cell-specific marker) mRNA levels were reduced and α-SMA (a mesenchymal cell-specific marker) mRNA levels were increased in TAC-induced mouse heart samples (Fig. 3A and 3B). In contrast to sham-operated mouse-derived heart samples, SIRT1 mRNA levels were lowly expressed while TGF-βR1, Smad2, and Smad3 mRNA levels were highly expressed in TAC-induced mouse-derived heart samples. However, these abnormal alterations induced by TAC were rescued after XYT or perindopril treatment (Fig. 3C-3F). As expected, the downregulated VE-Cadherin and SIRT1 protein levels and the raised α-SMA, TGF-βR1, p-Smad2, and p-Smad3 protein levels in TAC-induced mouse hearts were eroded following the administration of XYT or perindopril (Fig. 3G). Additionally, the usage of XYT-H had a better effect on the regulation of the above indexes than XYT-L. The mean ± SEM and effect sizes are given in Table 3. Collectively, these data suggested that XYT might inhibit TAC-induced EndMT in mouse hearts by modulating SIRT1-mediated the TGF-β/Smad pathway.

Figure 3.

XYT repressed EndMT and activated SIRT1 in TAC-induced mouse hearts. A-F) Detection of VE-Cadherin, α-SMA, SIRT1, TGF-βR1, Smad2, and Smad3 mRNA levels in TAC-induced mouse-derived heart samples was done by qRT-PCR (n = 6). G) Analysis of VE-Cadherin, α-SMA, SIRT1, TGF-βR1, p-Smad2, and p-Smad3 protein levels in heart samples was conducted by Western blotting (n = 3). All quantitative data are reported as means ± SEM. ^**p < 0.01, ^***p < 0.001 vs. Sham and ^#p < 0.05, ^##p < 0.01, ^###p < 0.001 vs. TAC; one-way ANOVA with Tukey multiple comparisons test.

4.4. SIRT1 Silencing Cut Down XYT-Mediated Suppressive Effects on Endmt In TGF-Β1-Exposed Mmecs

Given the above outcomes, we further validated that XYT may inhibit TAC-induced EndMT in MMECs by the regulation of SIRT1 using cell models in vitro. To verify the function of SIRT1, three siRNAs were transfected into MMECs to interfere with SIRT1. As displayed in Figures 4A and 4B, SIRT1 mRNA and protein levels were prominently repressed in si-SIRT1-transfected MMECs, among which si-SIRT1#3 had the strongest interfering effect on SIRT1. Subsequently, TGF-β1-pre-incubated MMECs with or without SIRT1 knockdown were exposed to XYT. IF staining indicated that XYT treatment eased TGF-β1-induced upregulation of α-SMA in MMECs, yet XYT treatment did not affect α-SMA expression in SIRT1-knockdown MMECs stimulated by TGF-β1, manifesting that XYT may mediate the process of EndMT via SIRT1 in TGF-β1-exposed MMECs (Fig. 4C and 4D). Consistently, the decreased mRNA levels of VE-cadherin and the elevated mRNA levels of α-SMA, TGF-βR1, Smad2, and Smad3 in TGF-β1-challenged MMECs were cut down after XYT treatment. However, under XYT treatment, these indicators did not show significant differential changes in SIRT1-knockdown MMECs in response to TGF-β1 stimulation (Fig. 4E-4I). Similar results were observed for protein levels of VE-cadherin, α-SMA, TGF-βR1, p-Smad2, and p-Smad3 (Fig. 4J). Together, these findings suggested that XYT repressed the process of EndMT via SIRT1 in TGF-β1-exposed MMECs.

Figure 4.

XYT-mediated inhibitory effects on EndMT of TGF-β1-exposed MMECs were lessened after SIRT1 silencing. A and B) QRT-PCR and Western blot analysis of SIRT1 mRNA and protein in MMECs transfected with si-SIRT1#1, si-SIRT1#2, or si-SIRT1#3. ^nsp >0.05 vs. Control and ^#p < 0.05, ^##p < 0.01, ^###p < 0.001 vs. si-NC; one-way ANOVA with Tukey multiple comparisons test (n = 3). C and D) Representative images of IF staining for α-SMA expression in MMECs with indicated treatments and a histogram for quantitative analysis of the results. E-I) Relative mRNA levels of VE-Cadherin, α-SMA, TGF-βR1, Smad2, and Smad3 in MMECs with indicated treatments were detected by qRT-PCR (n = 3). J) Relative protein levels of VE-Cadherin, α-SMA, TGF-βR1, p-Smad2, and p-Smad3 in MMECs were measured by Western blotting (n = 3). All quantitative data are reported as means ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, and nsp >0.05; one-way ANOVA with Tukey multiple comparisons test.

5. Discussion

Ventricular remodeling due to MF has a profound impact on chronic HF, and targeting key pathogenic mechanisms of MF takes on great significance in delaying ventricular remodeling ( 19 ). In the current research, we demonstrated that XYT emasculated MF via repression of EndMT via activating SIRT1 and subsequently repressing the TGF-β/Smad signaling, providing new evidence for the application of XYT in the treatment of cardiac fibrosis.

Different from the Western medicine treatment which favors a single chemical component corresponding to a single target, the TCM treatment focuses on holistic thinking and macro-control, with the obvious advantage of multi-components and multi-targets. TCM believed that chronic HF patients have insufficient yin and yang in the heart of blood gas, with stagnation of phlegm and blood stasis in the body, so chronic HF should be treated with the method of benefiting qi and nourishing yin, promoting blood circulation, and inducing diuresis ( 20 ). XYT is a representative TCM for preventing and treating chronic HF, with this as the baseline ( 15 ). Clinical studies suggested that XYT can improve clinical parameters and cardiac function in HF patients with deficiency of qi and yin, blood stasis, and water stagnation. In animal experiments, XYT can enhance cardiac function as well as ameliorate cardiac hypertrophy and MF in mouse models. In agreement with previous studies, our results also confirmed that XYT ameliorated pathological changes, cardiac fibrosis, and improved cardiac function in TAC-induced mice. XYT contains Ginseng, Ophiopogon, Astragalus, Ilex pubescens, Motherwort, Schisandra chinensis, Semen lepidii, and other ingredients. Ginseng contained in XYT has been published to improve cardiac function and fibrosis via fortifying the PPARα/δ signaling or repressing the ERK1/2 signaling. Ophiopogon, another component of XYT, exerts an antagonistic effect on adriamycin-induced cardiotoxicity by inhibiting myocardial inflammation and fibrosis ( 21 ). Also, Ilex pubescens is effective against blood stasis ( 22 ) and alleviates myocardial infarction by inhibiting the ROS/NLRP3 pathway. Furthermore, stachydrine, an extract of Motherwort, alleviates HF by inhibiting MF ( 23 ). Schisandra chinensis can prevent cardiac hypertrophy by inhibiting oxidative stress ( 24 ). Conclusively, the therapeutic efficacy of XYT in CHF is a result of the synergistic action of multiple components, targets, and pathways.

The present study demonstrated that XYT ameliorated cardiac fibrosis in a TAC-induced heart failure model, providing a potential therapeutic strategy for this condition. Specifically, our findings suggested that XYT’s cardioprotective effects were mediated through the activation of SIRT1, leading to the inhibition of EndMT and the suppression of the TGF-β/Smad signaling pathway. These results align with previous research highlighting the protective role of SIRT1 in cardiovascular diseases, including its ability to attenuate myocardial fibrosis and improve cardiac function ( 25 - 27 ).

Our data indicated that XYT treatment upregulated SIRT1 expression while simultaneously suppressing EndMT markers and TGF-β/Smad signaling both in vivo and animal models. This is particularly noteworthy, as EndMT has been identified as a critical process contributing to cardiac fibrosis, with a significant proportion of cardiac fibroblasts originating from endothelial cells via EndMT ( 28 ). By inhibiting EndMT through SIRT1 activation, XYT may effectively reduce the number of fibroblasts contributing to ECM deposition and myocardial stiffening. The TGF-β/Smad signaling pathway, a key regulator of EndMT, is also suppressed by XYT, further supporting its potential as a therapeutic agent for cardiac fibrosis ( 29 ).

The importance of SIRT1 in this context was underscored by the finding that SIRT1 knockdown in MMECs abolished XYT’s inhibitory effects on EndMT and TGF-β/Smad activation. This confirmed the pivotal role of SIRT1 in mediating the therapeutic effects of XYT. Moreover, the observed improvements in cardiac function, as evidenced by increased LVEF and LVFS and decreased LVIDs and LVIDd, suggesting that XYT can effectively attenuate cardiac dysfunction associated with fibrosis ( 30 ). The protective effect of SIRT1 found in the other papers also supports the finding that it can have positive impact on the disease.

While our study provides valuable insights into the mechanisms of XYT’s cardioprotective effects, several limitations should be acknowledged. First, the study was conducted in a relatively small sample size (n = 6 per group), which may limit the generalizability of the findings. Future studies with larger sample sizes are needed to confirm these results. Second, our study focused primarily on the role of SIRT1 in EndMT and the TGF-β/Smad pathway. Although this is an important aspect of XYT’s mechanism of action, it is possible that other pathways may also be involved ( 31 ). For example, Chen et al. found that propofol regulates HIF-1α expression via the SIRT1 signaling pathway in kidney renal clear cell carcinoma, suggesting a potential role for SIRT1 in cancer as well ( 32 ). Furthermore, identifying the specific components within XYT responsible for SIRT1 activation would be a crucial step toward developing targeted therapies for cardiac fibrosis. In conclusion, our findings support the notion that XYT is a promising therapeutic agent for cardiac fibrosis, acting through the SIRT1/TGF-β/Smad/EndMT axis.

Perindopril, a drug used to treat high blood pressure and heart failure, was used as a positive control in this study. Although high-dose XYT was slightly less effective than perindopril in improving cardiac histopathological changes and function, it is established that XYT is effective in improving TAC-induced cardiac fibrosis and dysfunction. The role of XYT in improving cardiac fibrosis and function may provide a new therapeutic option for the clinical treatment of cardiac fibrosis. Combination therapy effects of XYT with available drugs (like perindopril and pirfenidone) on cardiac fibrosis and function need to be explored in the future using animal models. Furthermore, the specific component of XYT that led to the observed effect and its impact on other cell types involved in cardiac fibrosis (like immune cells and pericytes) need to be explored in the future. In addition, translational human clinical trials of XYT for the treatment of cardiac fibrosis face significant challenges, such as administration dose, safety for long-term administration, and bioavailability. The above challenges need to be explored in the future through pharmacokinetic and pharmacodynamic studies, regular monitoring of liver enzymes, renal and cardiac function, as well as simulation of intestinal absorption with Caco-2 cell models and assessment of metabolic pathways and half-life by liver microsomes or hepatocytes.

6. Conclusion

These findings demonstrated that XYT can impair cardiac fibrosis by inhibiting EndMT through activation of SIRT1. Compared to single-target inhibitors, XYT may form a multi-dimensional anti-fibrotic network by the synergistic action of multiple components that modulate SIRT1 and its downstream pathways simultaneously. The research provides a novel mechanism for XYT, suggesting that XYT may provide additional benefits in treating cardiac fibrosis when it is used alone or in combination with existing therapies.