Skip to main content
Cancer Immunology, Immunotherapy : CII logoLink to Cancer Immunology, Immunotherapy : CII
. 2025 Aug 23;74(9):290. doi: 10.1007/s00262-025-04144-7

The transcription factor FOXA1 upregulates PYCR1-mediated autophagy to suppress antitumor immunity in lung adenocarcinoma

Kui Liu 1, Xiaoyan Yang 1, Xuemei Tang 2, Bo Tang 1,
PMCID: PMC12374928  PMID: 40848149

Abstract

Background

Immunotherapy has emerged as an effective treatment for lung adenocarcinoma (LUAD) in recent years. However, the ability of cancer cells to suppress antitumor immune responses through multiple mechanisms has become one of the major challenges for therapy. PYCR1 can reinforce the proliferation of LUAD cells, but the function of PYCR1 in LUAD against the tumor immune response has not been fully elucidated.

Methods

The clinical significance of PYCR1 in LUAD and the relationship between PYCR1 expression and CD8+ T cell infiltration were examined by bioinformatics analysis. The expression of PYCR1 and CD8 in LUAD clinical samples was analyzed by immunohistochemistry. The expression of PYCR1 in the LUAD cell model was detected by qPCR. Flow cytometry, lactate dehydrogenase kit, Calcein-AM/PI staining, and Transwell were employed to analyze the effect of PYCR1 on CD8+ T cell function. Western blot and immunofluorescence were utilized to probe into the effect of PYCR1 on autophagy. The interaction between PYCR1 and FOXA1 was evaluated by dual-luciferase assay and ChIP assay. Finally, in vitro and in vivo rescue experiments were conducted to verify the role of the FOXA1/PSYR1 axis in the immune regulation of LUAD.

Results

PYCR1 was upregulated in LUAD and was linked with the dismal prognosis of patients. Knockdown of PYCR1 in LUAD remarkably enhanced the activity of peripheral CD8+ T cells and facilitated the death of LUAD cells. In addition, overexpression of PYCR1 activated autophagy in cancer cells and dampened the anti-tumor immune response of CD8+ T cells. FOXA1 was an upstream transcriptional activator of PYCR1. Knockdown of FOXA1 potentiated the killing ability of CD8+ T cells on LUAD cells by repressing autophagy, while overexpression of PYCR1 reversed the effect of FOXA1 knockdown, which was verified in mouse experiments.

Conclusion

FOXA1 upregulates PYCR1 expression, activates autophagy in LUAD cells, and dampens CD8+ T cell antitumor immune response. Targeting FOXA1/PYCR1 may be a potential approach to improve LUAD immunotherapy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00262-025-04144-7.

Keywords: FOXA1, PYCR1, Autophagy, Lung adenocarcinoma, CD8+ T cells

Introduction

Lung cancer (LC), the leading culprit of cancer-related deaths worldwide, claims the lives of approximately 1.8 million people annually [1]. Lung adenocarcinoma (LUAD) is the most prevalent histological subtype, accounting for 60% of LC cases [2]. Despite remarkable advances in therapeutic strategies targeting LUAD, the long-term survival of patients with LUAD remains a concern, with 5-year survival rates below 20% [3]. An increasing body of recent research has demonstrated that CD8+ T cell immune infiltration, owing to its role in boosting cancer cell death, has emerged as a favorable predictor of prognosis for a variety of malignancies, including LUAD [46]. However, the ability of tumor cells to escape the immune attack of CD8+ T cells through multiple mechanisms has somewhat limited their efficacy as prognostic markers [7]. Consequently, unraveling the mechanisms by which tumor cells suppress anti-tumor immunity is the key to elevating the cure rate for LUAD.

Autophagy is a lysosome-dependent catabolic process that encapsulates damaged organelles, protein aggregates, and excess cellular components within an autophagic lysosome, which then fuses with the lysosome, ultimately leading to their degradation to maintain protein and organelle integrity and balance cellular energy and nutritional demands [8, 9]. The repression of autophagy suppresses the expression of microtubule-associated protein 1 light chain 3B-II (LC3B-II), reduces the conversion rate of LC3B-I/II, and enhances the expression of nucleoporin 62 (P62), thereby impairing the migration and invasive capabilities of LUAD cells [10]. This suggests that autophagy plays a central part in the occurrence and progression of LUAD. Moreover, the function of autophagy in modulating the tumor microenvironment (TME) and immune response of tumor cells has garnered increasing attention in recent years. For example, Yamamoto et al. [11] have confirmed that in pancreatic cancer models, the repression of autophagy can dramatically reinforce the presentation of tumor antigens, thereby enhancing the anti-tumor effect of CD8+ T cells and repressing tumor growth and progression. Additionally, Wang et al. [12] have discovered via bioinformatics analysis that in LUAD, a high autophagy-related gene pair index (ATGPI) can display a great positive correlation with patients having shorter survival time. For patients with higher ATGPI, the level of CD4+ T cell infiltration in TME was dramatically reduced [12]. Therefore, a deep interpretation of the mechanism of autophagy in cancer development and antitumor immune response is crucial for the innovation of new LUAD therapeutic strategies.

Pyrroline-5-carboxylate reductase 1 (PYCR1) is an essential enzyme for proline metabolism [13]. Its high expression plays a critical role in tumorigenesis and tumor progression, including breast cancer, hepatocellular carcinoma, and LC [1416]. Similarly, in LUAD, the upregulation of PYCR1 can also be observed. Downregulating PYCR1 can activate the JAK-STAT signaling pathway and curb the proliferation, migration, and invasion of LUAD cells [17], indicating the critical role of PYCR1 in the tumor biology of LUAD. Furthermore, Sun et al. [18] have revealed that CD8+ T cells as well as monocyte infiltration levels were remarkably reduced in the prostate cancer high-risk group with higher PYCR1, suggesting that PYCR1 expression may influence the TME. However, few studies have focused on the link between PYCR1 and suppression of antitumor immunity in LUAD, and the relation between PYCR1 and LUAD autophagy has not been mentioned. Consequently, this investigation focused on illuminating whether PYCR1 exerted influence on autophagy and CD8+ T anti-tumor immune response. The study holds great research value for refining the therapeutic strategies for LUAD.

In this work, through bioinformatic analysis, we discovered that the upregulation of PYCR1 in LUAD was positively linked with the adverse prognosis and inversely related to CD8+ T cell infiltration. We further detected via cellular experiments that knocking down PYCR1 activated the cytotoxicity of CD8+ T cells. Overexpression of PYCR1 mainly achieved its inhibitory effect on CD8+ T cell activity by inducing autophagy. The transcription factor (TF), FOXA1, positively regulated PYCR1 and activated autophagy to repress anti-tumor immunity in LUAD. This work revealed the potential function and immunological relevance of PYCR1 and laid the foundation for innovating LUAD therapeutic strategies targeting PYCR1.

Materials and methods

Bioinformatics analysis

Transcriptome data of normal paracancerous tissue (Normal: 59) and tumor tissue (Tumor: 539) of LUAD patients were downloaded from the official website of the Cancer Genome Atlas (TCGA) database. The edgeR package was utilized for data collation. The differentially expressed genes were obtained. The parameters were set as |logFC|> 1 and FDR < 0.05. The final target genes were determined according to the corresponding literature. The Kaplan–Meier (K–M) curve was plotted to evaluate the linkage between target genes and the prognosis of LUAD patients. The TIMER2.0 was employed to analyze the linkage between target genes and CD8+ T cell infiltration. Gene set enrichment analysis (GSEA) was undertaken to detect the signal pathway of target gene enrichment, to analyze the signal pathway through which target genes affected LUAD progression. The hTFtarget database was applied to predict the potential TFs in the upstream of the target gene. The JASPAR database was applied to obtain the target gene binding sites of the TFs, and then the TFs were determined. The expression of TFs in LUAD was detected by t-test. Finally, the correlation between the TFs and the target genes was analyzed by Pearson correlation analysis.

Cell cultivation

Human normal lung epithelial cells (BEAS-2B), LUAD cell lines (A549, Calu-3, and H1975), mouse LUAD LA795 cells, and human embryonic kidney cells (293 T) were all bought from Sunncell Biotechnology (China). Human CD8+ T cells were purchased from Milestone Biotechnologies (China). BEAS-2B, A549, and 293 T cells were kept in the DMEM medium (Gibco, USA). Calu-3 was cultivated in the MEM medium (Gibco, USA), LA795 and H1975 were in the RPMI-1640 medium (Gibco, USA). The above media all contained 1% penicillin–streptomycin (Gibco, USA) and 10% fetal bovine serum (Gibco, USA). CD8+ T cells were cultivated in AIM V medium (Gibco, USA) with 50 U/mL rIL-2 (MCE, China) and 5 ng/mL rIL-7 (MCE, USA). The incubator was set at 37 ℃ and 5% CO2.

Cell transfection

si-PYCR1#1: sense: (5′-UGAGAAGAAGCUGUCAGCGUU-3′), antisense: (5′-AACGCUGACAGCUUCUUCUCA-3′), si-PYCR1#2: sense: (5′-CCCUUCAUCCUGGAUGAAAUA-3′), (5′-UAUUUCAUCCAGGAUGAAGGG-3′), oe-PYCR1, si-FOXA1, sh-FOXA1, and their negative controls were synthesized by GenePharma (China). The autophagy inhibitor (3-MA) was acquired from MCE (USA). si-PYCR1#1, si-PYCR1#2, oe-PYCR1, si-FOXA1, sh-FOXA1, and their negative controls were transfected into LUAD cells using Lipofectamine 3000 reagent (Invitrogen, USA). In short, we diluted 100 pmol siRNA or plasmid with 2.5 μL Lipofectamine 3000 reagent in 250 μL serum-free MEM medium and incubated them at room temperature for 5 min. The diluted siRNA/plasmid was gently mixed with Lipofectamine 3000 mixture and incubated at room temperature for 15 min to form a transfection complex. 3-MA (2 mM) was added and cultured for 24 h.

Tissue samples of patients

Normal tissue (n = 10) and corresponding tumor tissue specimens (n = 10) from LUAD patients were collected from Zigong Fourth People’s Hospital with informed consent from October 2023 to October 2024. Specimens of these patients were formalin-fixed (Sangon, China) and paraffin-embedded. Tumor staging and pathological classification were determined according to the Eighth Edition of the Union for International Cancer Control (UICC) TNM Classification and the World Health Organization (WHO), with complete clinicopathological and follow-up data preserved. Approval for this research was granted by the Ethics Committee of Zigong Fourth People’s Hospital (No: 2024-028).

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total RNA was extracted from LUAD cells using TRIzol reagent (Invitrogen, USA). Subsequently, RNA was reverse transcribed to cDNA using Hifair ® II 1st Strand cDNA Synthesis Kit (YESEN, China), followed by the use of the uGreener Flex qPCR 2X × Mix (U & G BIO, China). qPCR was completed on an Applied Biosystems ™ 7500 real-time fluorescent quantitative PCR instrument (Thermo Fisher, USA). The reaction was conducted, with pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 10 s, and annealing/extension at 60 ℃ for 30 s, which continued for a total of 40 cycles. Finally, melting curves were analyzed to verify primer specificity. After the qPCR reaction, the results were analyzed using the 2−∆∆Ct method with GAPDH as an internal reference. Primer sequences are shown in Table 1.

Table 1.

Primer sequence

Gene Sequence
PYCR1 Forward 5′-TTGGCTGCCCACAAGATAA-3′
Reverse 5′-CAGGAAGAGCACATCACTGT-3′
FOXA1 Forward 5′-GCAATACTCGCCTTACGGCT-3′
Reverse 5′-TACACACCTTGGTAGTACGCC-3′
GAPDH Forward 5′-CGGGAAGCTTGTCATCAAT-3′
Reverse 5′-TCTCCATGGTGGTGAAGA-3′

Immunohistochemistry (IHC)

The patient’s tumor tissue sections were subjected to dewaxing. After dewaxing, EDTA antigen retrieval solution (Beyotime, P0085, China) was added and heated for antigen retrieval. The slices were immersed in a 3% hydrogen peroxide solution and incubated at room temperature for 10 min to block endogenous peroxidase activity. We washed the slices three times with PBS for 5 min each time. The primary antibodies PYCR1 (1:1000, Abcam, ab102601, UK) and CD8 (0.25 µg/ml, Abcam, ab237709, UK) were incubated overnight at 4 ℃. The next morning, the primary antibody was washed off. The sections were incubated for 30 min with the secondary antibody goat anti-rabbit IgG (H + L) (1:50, Beyotime, A0208, China) labeled with horseradish peroxidase (HRP), and then stained with hematoxylin (Beyotime, C0107, China). The pictures were taken with a microscope (Mshot, China).

Lactate dehydrogenase (LDH) cytotoxicity test

CD3/CD28/CD137 magnetic beads (Gibco, USA) were utilized to activate CD8+ T cells, and the activated CD8+ T cells were co-cultivated with LUAD cells at a ratio of 2:1. After 24 h of treatment, an LDH cytotoxicity test kit (YEASEN, 40209ES76, China) was applied. The absorbance was measured at 490 nm using a microplate reader (Thermo Fisher, USA). The release of LDH in LUAD cells was calculated according to the kit algorithm to assess T-cell toxicity.

Flow cytometry

After cell incubation, CD8+ T cells were collected, centrifuged, and washed once with phosphate-buffered saline (PBS). The centrifuged cell suspension was divided into two parts for the detection of the expression of TNF-α and IFN-γ, respectively. Cells were then incubated at 4 ℃ with antibody anti-TNF-α, PE (Invitrogen, 12-7321-82, USA) and anti-IFN-γ, FITC (Invitrogen, 11-7311-41, USA) for 15 min in the dark, followed by an analysis with the flow cytometer (Agilent, USA).

Transwell assay for T cell chemotaxis

The LUAD cells were counted after digestion with 0.25% trypsin (Solarbio, China) and resuspended in a serum-free medium. 600 μL of cell suspension was transferred to the lower chamber of a Transwell at a concentration of 2.5 × 105, while 200 μL of activated CD8+ T cell suspension was added to the upper chamber at a concentration of 5 × 105. The incubation lasted for 24 h. After that, the remaining CD8+ T cells in the upper chamber were counted under an optical microscope using a cell counting plate to detect chemotaxis.

Calcein-AM/PI staining

Cells in the co-culture system were cultured for 24 h, and the medium in the 24-well plate was discarded. The cells were rinsed once with PBS, and then digested with trypsin. The cell suspension was collected and centrifuged for 5 min, with the supernatant discarded. Cells were subjected to 2–3 full rinsings with 1 × Assay Buffer. The cell suspension was prepared with 1 × Assay Buffer. 100 µL of staining solution was introduced into 200 µL of cell suspension, followed by mixing and incubation at 37 ℃ for 15 min. Finally, observation and photography were completed by using a fluorescence microscope (KEYENCE, Japan).

Western blot (WB)

The extraction of total cellular protein was achieved by using Western & IP cell lysis buffer (Beyotime, P0013, China). Protein concentration determination was undertaken according to the instructions of the BCA protein concentration determination kit (Solarbio, PC0020, China). Proteins were then isolated by SDS-PAGE gel and transferred to a PVDF membrane (Millipore, USA). After 1 h of blocking with skim milk, the cells were incubated overnight at 4 ℃ with primary antibodies anti-LC3B (1: 1000, ABclonal, A19665, China), anti-p62 (1: 20,000, ABclonal, A19700, China), anti-PYCR1 (1: 1000, ABclonal, A6959, China) and anti-GAPDH (1: 50,000, HUABIO, ET1601-4, China). Then HRP-labeled goat anti-rabbit IgG (H + L) (1:1000, Beyotime, A0208, China) was incubated with cells for 1 h, followed by three times of TBST washing, which lasted for 5 min for each. Then, BeyoECL Plus chemiluminescence solution (Beyotime, P0018S, China) was applied to detect protein bands.

Immunofluorescence (IF)

LUAD cells were seeded onto 6-well plates with the cell slides at a density of 5 × 104 cells/well. After 24 h of incubation, the cell culture medium was discarded, and the cells were fixed with 75% ethanol for 30 min. Subsequently, the samples were rinsed three times with PBS, each time for five min, followed by permeabilization with 0.1% Triton X-100 (Sangon, China) for 10 min. Finally, the samples were blocked with 5% bovine serum albumin (Sangon, China) at room temperature for 1 h. After blocking, the primary antibody anti-LC3B (1: 200, ABclonal, China, A5618) was added to incubate overnight at 4 ℃, and then Alexa Fluor 555-labeled goat anti-rabbit IgG (Bioss, China, bs-0295G-AF555) was added to incubate for 1 h. Cells were stained with DAPI (Solarbio, C0065, China) and ultimately observed and photographed under a fluorescence microscope (KEYENCE, Japan).

Dual-luciferase reporter assay

PYCR1 promoter sequences containing PYCR1 wild-type (WT) and PYCR1 mutant (MUT) were cloned into the pGL-3 Basic firefly luciferase reporter vector (Promega, USA). pRL-TK plasmid was utilized as the Renilla luciferase reporter plasmid. The above plasmids were co-transfected with si-NC or si-FOXA1, respectively, into 293 T cells by Lipofectamine 3000 reagent. After 24 h, luciferase activity was measured using a luciferase detection kit (Promega, USA).

Chromatin immunoprecipitation (ChIP)

Cells (4 × 106) were fixed with 1% formaldehyde at room temperature for 10 min. After PBS rinsing, cells were lysed with the buffer from the Agarose ChIP Kit (Thermo Scientific, USA). The chromatin was then treated with micrococcal nuclease, and the protein-DNA complexes were incubated with ChIP-grade protein A/G agarose beads overnight at 4 ℃. Chromatin fragments were immunoprecipitated with anti-FOXA1 (Invitrogen, PA5-27,157, USA) antibody or anti-IgG. After de-cross-linking and elution, the enriched DNA sequences were detected using qPCR. ChIP-qPCR primer sequences were as follows: (5′–3′): Primer-F: GCGTTCTGGCTATCTGTCTAC; Primer-R: AGGTTTGAGCTGTCCATCTG.

Allograft mouse model

A LUAD allograft mouse model was constructed using 15 5-week-old C57BL/6 male healthy mice (15–20 g) (Hangsi Bio., China). All animal experimental protocols were approved by the Laboratory Animal Welfare and Ethics Committee of Zigong Fourth People's Hospital (No. 2025-008). Specifically, mouse LUAD cells LA795 transfected with sh-NC/sh-FOXA1 or oe-NC/oe-PYCR1 were injected subcutaneously into the right axilla of mice (2 × 106 cells per mouse). The mice were grown in a sterile and comfortable environment, and the tumor volume was calculated every 5 days using a caliper. After the experiment, we euthanized the mice and dissected the tumors for subsequent detection. The volume formula is (length × width2)/2.

Enzyme-linked immunosorbent assay (ELISA)

We collected tumor tissues from each group of mice and cut and ground them into cell suspensions. The supernatant was collected after centrifugation. We used Mouse TNF-α ELISA Kit (Abcam, ab208348, UK) and Mouse IFN-γ ELISA Kit (Abcam, ab282874, UK) to detect the content of TNF-α and IFN-γ in the supernatant, respectively. The experimental process strictly follows the instructions of the kit, and a standard curve was drawn using the absorbance (OD) value at 450 nm.

Data analysis

Data were processed by utilizing GraphPad Prism 8.0 and were expressed as mean ± standard deviation (SD). Student’s t-test or one-way ANOVA was employed to assess disparities between two or more groups, respectively, with p < 0.05 indicating a significant difference. All experiments were repeated 3 times.

Results

PYCR1 is up-regulated in LUAD and is linked with the adverse prognosis

RNA sequencing data from the TCGA database were analyzed to reveal the PYCR1 mRNA level in LUAD. The mRNA expression of PYCR1 was considerably elevated in tumor tissues of LUAD patients compared to normal tissues (Fig. 1a). The relationship between PYCR1 expression and prognosis was then assessed by K–M curves based on the sample information from the TCGA database, which identified a positive trend between the upregulation of PYCR1 and poorer overall survival in LUAD patients (Fig. 1b). Moreover, PYCR1 expression in LUAD cell lines (A549, Calu-3, and H1975) and normal lung epithelial cell lines (BEAS-2B) was examined using qPCR, which demonstrated that PYCR1 was greatly up-regulated in LUAD cells compared with BEAS-2B cells (Fig. 1c), suggesting that PYCR1 may be a potential biomarker for LUAD. To further investigate the function of PYCR1 in LUAD, bioinformatics analysis was done to reveal the inverse linkage between PYCR1 and CD8+ T cell infiltration (Fig. 1d). Subsequently, the PYCR1 protein levels in normal tissue adjacent to primary LUAD samples were assessed through immunohistochemical staining. PYCR1 exhibited considerably higher levels in the tumor tissue than in the normal paracancerous tissue (Fig. 1e). The subsequent experiment further examined whether the expression of PYCR1 in LUAD tissues affected CD8+ T cell infiltration. CD8-positive expression was found to be declined in LUAD tissues with high PYCR1 expression (Fig. 1f). Taken together, the upregulation of PYCR1 is tightly linked with the dismal prognosis of LUAD patients. PYCR1 is greatly inversely associated with CD8+ T-cell infiltration.

Fig. 1.

Fig. 1

PYCR1 is up-regulated in LUAD and is linked with the adverse prognosis. a TCGA database was used to analyze the expression of PYCR1 in normal paracancerous tissues and tumor tissues of LUAD; b K–M curve was used to analyze the relationship between PYCR1 expression and prognosis; c qPCR detected the expression of PYCR1 in normal lung epithelial cell lines and LUAD cell lines; d TIMER 2. 0 was employed to analyze the correlation between PYCR1 and CD8+ T cell infiltration; e IHC detected the protein level of PYCR1 in normal paracancerous tissues and tumor tissues; f IHC assessed the number and correlation of CD8+ T cells in tumor tissues with high/low expression of PYCR1. *Represents P < 0.05

The impact of PYCR1 on CD8+ T cell anti-tumor immune response

To elucidate the effect of PYCR1 on CD8+ T cell anti-tumor immune response in LUAD, Calu-3 cells were transfected with si-NC and si-PYCR1, respectively. Compared to the si-NC group, the expression of PYCR1 mRNA and protein was significantly decreased in the si-PYCR1 group (Fig. 2a) (Supplementary Fig. 1A). The treated Calu-3 cells were co-cultured with activated CD8+ T cells. The function of CD8+ T cells was evaluated. Both cytokines TNF-α and IFN-γ in the co-culture system were considerably upregulated after the knockdown of PYCR1 (Fig. 2b–c) (Supplementary Fig. 1B-C). Subsequently, the cytotoxicity of CD8+ T cells against LUAD cells was assessed, revealing that knocking down PYCR1 facilitated LDH release and enhanced the cell toxicity of CD8+ T cells toward LUAD cells (Fig. 2d) (Supplementary Fig. 1D). Transwell results manifested that the knockdown of PYCR1 potentiated the chemotactic ability of CD8+ T cells compared to the control group (Fig. 2e) (Supplementary Fig. 1E). Additionally, Calcein-am/PI staining was applied to detect the death of Calu-3 cells. A large number of PI-positive cells were found in the co-culture system after PYCR1 knockdown, indicating that PYCR1 knockdown boosted the activity of CD8+ T cells and remarkably induced the death of LUAD cells (Fig. 2f) (Supplementary Fig. 1F). Taken together, the knockdown of PYCR1 can activate CD8+ T cells, thereby enhancing the anti-tumor immune response.

Fig. 2.

Fig. 2

The impact of PYCR1 on CD8+ T cell anti-tumor immune response. a qPCR and WB assessed PYCR1 expression in Calu-3 cells; b, c Flow cytometry detected TNF-α and IFN-γ levels in the co-culture system; d LDH activity assay kit was used to detect CD8+ T cell toxicity in the co-culture system; e Transwell assay assessed the chemotactic potential of CD8+ T cells in the co-culture system; F: Calcein-AM/PI staining and statistical analysis of PI positivity rate in Calu-3 cells. *Represents P < 0.05

PYCR1-mediated autophagy represses antitumor immunity in LUAD

A recent study has revealed that activating autophagy can suppress antitumor immunity of CD8+ T cells [19], but the relevant specific role and mechanism in LUAD remains largely unclear. In this work, PYCR1 was enriched in the autophagy pathway, as evidenced by bioinformatics analysis (P = 0.004032258, NES = 1.8399049) (Fig. 3a). To probe into whether PYCR1 modulated autophagy to affect CD8+ T cell antitumor immunity, we produced an overexpression model of PYCR1 in H1975 cells. The qPCR results showed that PYCR1 expression was dramatically up-regulated in the oe-PYCR1 group (Fig. 3b). The detection of autophagy-related protein levels manifested that the overexpression of PYCR1 greatly elevated LC3-II levels and suppressed p62 levels compared to controls (Fig. 3c). The IF detection of LC3 expression revealed that in LUAD cells treated with oe-PYCR1, the fluorescent signal of LC3 was enhanced. This suggested that the overexpression of PYCR1 effectively activated autophagy (Fig. 3d–e). Then, H1975 cells were treated with autophagy inhibitor 3-MA and co-cultured with activated CD8+ T cells to evaluate the effect of PYCR1-mediated autophagy on CD8+ T cell function. Compared to the control group, in co-culture systems where PYCR1 expression was overexpressed, TNF-α and IFN-γ levels, as well as the cytotoxicity of CD8+ T cells, were significantly reduced. This trend was partially reversed upon the addition of 3-MA (Fig. 3f–j). Additionally, Transwell results demonstrated that the overexpression of PYCR1 considerably dampened the chemotaxis of CD8+ T cells, while the addition of 3-MA effectively enhanced their chemotaxis (Fig. 3k). The effect of 3-MA on the survival of H1975 cells was then further assessed. The overexpression of PYCR1 down-regulated the proportion of LUAD dead cells in the co-culture system, but this effect was reversed by 3-MA (Fig. 3l). Given all findings, PYCR1 activates autophagy to suppress the antitumor immune response of CD8+ T cells.

Fig. 3.

Fig. 3

PYCR1-mediated autophagy represses antitumor immunity in LUAD. a GSEA analysis of PYCR1 enrichment signaling pathway; b qPCR detected PYCR1 expression in H1975 cells; c WB analyzed autophagy-related protein levels in H1975 cells; d, e IF assessed LC3 levels in H1975 cells; fi Flow cytometry examined TNF-α and IFN-γ levels in co-culture systems; j LDH activity assay kit was used to detect CD8+ T cell toxicity in the co-culture system; k Transwell assay examined chemotaxis of CD8+ T cells in the co-culture system; l Calcein-AM/PI staining and statistical analysis of PI positivity rate in H1975 cells. *Represents P < 0.05

FOXA1 elevates the PYCR1 expression level

To unravel the potential mechanisms underlying abnormal PYCR1 expression, hTFtarget was employed for predicting potential TFs that modulate PYCR1. The intersection between potential TFs and differentially expressed mRNAs (DEmRNAs) was taken to obtain a total of 13 potential TFs (Fig. 4a). Furthermore, via analysis with the JASPAR database, it was determined that FOXA1 had motif binding sites within the promoter region (Fig. 4b). FOXA1 was then subjected to a t-test, which revealed its upregulation in LUAD tissues (Fig. 4c). Additionally, qPCR analysis manifested significantly upregulated FOXA1 in all three LUAD cell lines (Fig. 4d). Through correlation analysis, FOXA1 exhibited a positive relation with PYCR1 (Fig. 4e), suggesting that FOXA1 had the potential to modulate PYCR1 expression. A luciferase reporter gene assay was undertaken to investigate the interplay between FOXA1 and PYCR1, demonstrating that downregulating FOXA1 considerably reduced luciferase activity driven by the PYCR1-WT sequence (Fig. 4f). Moreover, ChIP further implicated that FOXA1 could bind to the promoter region of PYCR1 (Fig. 4g). Knocking down FOXA1 inhibited protein expression of PYCR1 in cells (Fig. 4h). Evidently, FOXA1 is a TF for PYCR1 and can bind to the PYCR1 promoter sequence.

Fig. 4.

Fig. 4

FOXA1 elevates the PYCR1 expression level. a hTFtarget database was used to predict the upstream TF of PYCR1; b JASPAR database was utilized to determine the binding sites; c The t-test analysis of the expression of FOXA1 in LUAD tissues; d qPCR detected the expression of FOXA1 in normal lung epithelial cell lines and LUAD cell lines; e Pearson analysis assessed the correlation between FOXA1 and PYCR1 cell infiltration; f Luciferase reporter assay detected the interaction between FOXA1 and PYCR1; g ChIP verified the interaction between FOXA1 and PYCR1; h WB analyzed protein levels in cells. *Represents P < 0.05

FOXA1 upregulates PYCR1-mediated autophagy to suppress antitumor immunity in LUAD

To figure out whether FOXA1 affected the PYCR1 suppression of LUAD cell anti-tumor immunity, we created Calu-3 cells with lowly-expressed FOXA1 and overexpressed PYCR1. qPCR was used to detect transfection efficiency. Compared with the control group, PYCR1 expression was significantly downregulated in the si-FOXA1 group, indicating that FOXA1 deficiency has an impact on intracellular gene expression, and PYCR1 is one of the affected genes. Meanwhile, the addition of oe-PYCR1 upregulated the expression of PYCR1 (Fig. 5a), indicating that the oe-PYCR1 vector effectively introduced the PYCR1 gene into cells and increased its expression. Therefore, these results indicated that the si-FOXA1 and oe-PYCR1 models were successfully constructed. Next, autophagy-related protein levels were examined. FOXA1 knockdown hindered LC3-II levels and elevated p62 protein levels, but this effect was attenuated by PYCR1 overexpression (Fig. 5b). Similarly, IF results manifested that FOXA1 knockdown suppressed the fluorescence signal of LC3, whereas overexpression of PYCR1 returned it to control levels (Fig. 5c, d). Calu-3 cells were co-cultured with activated CD8+ T cells to examine the effect of the FOXA1/PYCR1 axis on CD8+ T cell function. Downregulation of FOXA1 greatly boosted TNF-α and IFN-γ levels in co-culture systems and enhanced the cytotoxicity and chemotactic potential of CD8+ T cells. Overexpression of PYCR1 reversed the promoting effect of FOXA1 knockdown on the functional activity of CD8+ T cells (Fig. 5e–h). Furthermore, through Calcein-AM/PI live/dead staining, the proportion of LUAD death cells in the co-culture system dramatically elevated after FOXA1 knockdown in comparison with the control group. The death cell ratio considerably decreased in the co-culture system with PYCR1 overexpressed (Fig. 5i). Taken together, FOXA1 can positively modulate PYCR1 expression and dampen the antitumor immunity of CD8+ T cells in LUAD by activating autophagy.

Fig. 5.

Fig. 5

FOXA1 upregulates PYCR1-mediated autophagy to suppress antitumor immunity in LUAD. a qPCR analyzed the expression of PYCR1 in Calu-3 cells; b WB examined the level of autophagy-related proteins in Calu-3 cells; c, d IF detected the level of LC3 in Calu-3 cells; e, f Flow cytometry assessed the levels of TNF-α and IFN-γ in the co-culture system; g LDH activity detection kit was utilized to detect the cytotoxicity of CD8+ T in the co-culture system; h Transwell detect the chemotaxis of CD8+ T in the co-culture system; i Calcein-am/PI staining and statistical analysis of PI-positive rate of Calu-3 cells. *Represents P < 0.05

FOXA1 upregulates PYCR1-mediated autophagy to inhibit anti-tumor immunity in LUAD mice

To investigate whether FOXA1 affects anti-tumor immunity in mice through mediating PYCR1, we supplemented the following experimental groups based on C57BL/6 mice: sh-NC + oe NC, sh-FOXA1 + oe NC, sh-FOXA1 + oe PYCR1. The experimental results showed that knocking down FOXA1 significantly inhibited the volume and mass of tumors, while this inhibitory effect was weakened by overexpression of PYCR1 (Fig. 6a–c). According to the detection of autophagy-related protein levels, knocking down FOXA1 inhibited LC3-II levels and increased p62 protein levels, while overexpression of PYCR1 weakened this trend (Fig. 6d). Tumor tissues were collected for ELISA detection, which revealed that knocking down FOXA1 expression promoted the secretion of TNF-α and IFN-γ, while overexpression of PYCR1 reversed this promoting effect (Fig. 6e). Immunohistochemical analysis of tumor tissues revealed that CD8-positive expression increased in tissues with FOXA1 knockdown, while CD8-positive expression was reversed after PYCR1 overexpression (Fig. 6f). The above results indicated that FOXA1 can positively regulate PYCR1 expression and inhibit the anti-tumor immunity of CD8+ T cells in LUAD by activating autophagy levels.

Fig. 6.

Fig. 6

FOXA1 upregulates PYCR1-mediated autophagy to inhibit anti-tumor immunity in LUAD mice. a Images of mouse tumors; b Line graph of changes in mouse volume size; c Comparison of tumor mass in mice; d WB detected the levels of autophagy-related proteins in Calu-3 cells; e ELISA detected the levels of TNF-α and IFN-γ in tumor tissues; f Immunohistochemical detection of protein levels in tumor tissues; *Represents P < 0.05

Discussion

The recent T-cell-centered immunotherapy has exhibited great potential in the treatment of LUAD [20]. Even in the early stages of LUAD, the repression of T-cell immune function can satisfy its quest for survival and growth, suggesting that cancer may have already begun to evade immune surveillance at an early stage [7]. Therefore, an in-depth exploration of the mechanisms of T-cell dysfunction in LUAD is essential for the development of effective immunotherapeutic strategies. This study revealed a novel mechanism by which FOXA1 and its target gene PYCR1 activated autophagy to suppress CD8+ T cell anti-tumor immunity in LUAD, providing potential targets for immunotherapy of LUAD.

PYCR1, the most abundant subtype of the PYCR family, catalyzes the synthesis of proline from pyrroline-5-carboxylate (P5C) [21]. PYCR1 mutations in humans are frequently linked with cellular oxidative stress and mitochondrial dysfunction [22, 23]. Overexpression of PYCR1 has a bearing on multiple cancer types [15], including LUAD [24]. Similarly, in this investigation, PYCR1 expression was upregulated in LUAD tissues and cells. The upregulation of PYCR1 was preliminarily verified to be linked with the dismal prognosis of LUAD patients. Xu et al. [25] have resorted to bioinformatics analysis to reveal that CD8+ T cells in the PYCR1 high expression group have a depleted phenotype and decreased cytokine (Granzyme B) in renal cell carcinoma patients, suggesting that PYCR1 has the effect of suppressing the body’s immune response. Our study also showed the same trend of results. In vitro experiments showed that knocking down PYCR1 significantly enhanced the activity of CD8+ T cells and promoted LUAD cell death, while overexpression of PYCR1 inhibited CD8+ T cell function by activating autophagy. These results indicated that PYCR1 plays an important role in LUAD immune escape.

In this work, PYCR1 was enriched in the autophagy pathway as revealed by GSEA analysis, suggesting that PYCR1 may play a part in modulating autophagy. Autophagy is a critical biological process within cells that involves the degradation of damaged organelles and proteins to maintain cellular homeostasis [26]. In recent years, a large number of studies have illuminated the complex role of autophagy in tumor progression. During the early stages of tumor formation, activating autophagy can prevent the occurrence, proliferation, invasion, and metastasis of tumors, serving as an inhibitory measure against cancer; however, when a tumor progresses to its advanced stages, activating autophagy can stimulate cells to employ protective mechanisms, enhancing cancer cells’ resilience to stress, and facilitating the growth and development of tumors [27]. Collectively, autophagy plays a dual role in cancer, both as a cancer promoter and a cancer suppressor. Therefore, we herein assessed changes in autophagy levels in LUAD cells, observing that overexpression of PYCR1 elevated autophagy levels. We speculated that PYCR1 may facilitate tumor progression by activating autophagy. Furthermore, activation of autophagy represses the activation of T cells by hindering antigen degradation and then curbs the release of proinflammatory cytokines (IL-1β and IFN-β), thereby dampening the anti-tumor immune response [28], suggesting that activation of autophagy can negatively modulate the immune response of cancer cells. In this study, overexpression of PYCR1 repressed the cytotoxicity of CD8+ T cells. The addition of autophagy inhibitor 3-MA effectively alleviated the inhibitory effect of PYCR1 overexpression on CD8+ T cell function, indicating that PYCR1 may create a tumor immunosuppressive environment by activating autophagy, thereby reducing LUAD cell death. These results suggested that the use of functional autophagic status in tumors to regulate cancer therapy and prevention provides a new opportunity for cancer therapy.

Subsequently, this investigation further delved into the potential mechanism by which PYCR1 activated autophagy to suppress the antitumor immune function of CD8+ T cells, identifying FOXA1 as an upstream TF of PYCR1 through bioinformatics analysis, luciferase reporter gene detection, and ChIP experiments. FOXA1 is a member of the FOXA protein family, functionally participating in the normal development of multiple organs such as the liver, lungs, and prostate. Mechanistically, it serves as a pioneering TF that constructs gene expression ability, with its high expression closely tied to cancer cell proliferation, migration, invasion, and chemotherapy resistance [29]. FOXA1 was greatly upregulated in LUAD cells in this study, being able to positively modulate the expression of PYCR1. In addition, in a previous study, FOXA1 has been found to dampen the activity of CD8+ T cells by activating the glycolysis pathway and to facilitate immune evasion in LUAD, indicating the potential for immune regulation by FOXA1 [30]. We herein discovered that downregulating FOXA1 could suppress autophagic levels and enhance the function of CD8+ T cells, and this effect was reversed by overexpression of PYCR1. Taken together, these data highlighted the suppressive role of the FOXA1/PYCR1 axis in LUAD antitumor immunity and provided an effective therapeutic target for LUAD immunotherapy.

Although this study revealed the important role of the FOXA1/PSYR1 axis in LUAD, there are still limitations. In future research, animal models, organoids, and more clinical samples are needed to validate the mechanism of this axis and to explore its potential applications in immunotherapy.

Supplementary Information

Below is the link to the electronic supplementary material.

262_2025_4144_MOESM1_ESM.tif (2MB, tif)

Supplementary Figure 1. The impact of PYCR1 on CD8+ T cell anti-tumor immune responseA: qPCR assessed PYCR1 expression in Calu-3 cells; B-C: Flow cytometry detected TNF-α and IFN-γ levels in the co-culture system; D: LDH activity assay kit was used to detect CD8+ T cell toxicity in the co-culture system; E: Transwell assay assessed the chemotactic potential of CD8+ T cells in the co-culture system; F: Calcein-AM/PI staining and statistical analysis of PI positivity rate in Calu-3 cells. * represents P<0.05. (TIF 2086 kb)

Author contributions

KL Conceptualization, Methodology, Data curation, Investigation, Resources, Writing-original draft; XY Formal Analysis, Investigation, Validation, Writing-review and editing; XT Data curation, Visualization, Writing-original draft; BT Conceptualization, Investigation, Project administration, Supervision, Writing-review and editing.

Funding

This study did not receive any funding support.

Data availability statement

No datasets were generated or analysed during the current study.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical statement

This study was conducted after approval by the Ethics Committee of Zigong Fourth People’s Hospital (No. 2024-028). Patient informed consent was obtained throughout the research process. All animal experimental protocols were approved by the The Laboratory Animal Welfare and Ethics Committee of Zigong Fourth People’s Hospital (No. 2025-008).

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Erratum (2020) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 70:313 [DOI] [PubMed]
  • 2.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 71:209–249 [DOI] [PubMed] [Google Scholar]
  • 3.Chen Z, Huang Y, Hu Z, Zhao M, Li M, Bi G et al (2021) Landscape and dynamics of single tumor and immune cells in early and advanced-stage lung adenocarcinoma. Clin Transl Med 11:e350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jiang X, Li Y, Zhang N, Gao Y, Han L, Li S et al (2021) RRM2 silencing suppresses malignant phenotype and enhances radiosensitivity via activating cGAS/STING signaling pathway in lung adenocarcinoma. Cell Biosci 11:74 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Jiang ZB, Huang JM, Xie YJ, Zhang YZ, Chang C, Lai HL et al (2020) Evodiamine suppresses non-small cell lung cancer by elevating CD8(+) T cells and downregulating the MUC1-C/PD-L1 axis. J Exp Clin Cancer Res 39:249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Maimela NR, Liu S, Zhang Y (2019) Fates of CD8+ T cells in tumor microenvironment. Comput Struct Biotechnol J 17:1–13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cui Y, Li J, Zhang P, Yin D, Wang Z, Dai J et al (2023) B4GALT1 promotes immune escape by regulating the expression of PD-L1 at multiple levels in lung adenocarcinoma. J Exp Clin Cancer Res 42:146 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Russell RC, Guan KL (2022) The multifaceted role of autophagy in cancer. EMBO J 41:e110031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Miao CC, Hwang W, Chu LY, Yang LH, Ha CT, Chen PY et al (2022) LC3A-mediated autophagy regulates lung cancer cell plasticity. Autophagy 18:921–934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu Y, Du Y (2021) Influence of autophagy inhibition on lung adenocarcinoma cell migration and invasion ability, and efficacy of gefitinib. Technol Cancer Res Treat 20:15330338211049000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yamamoto K, Venida A, Yano J, Biancur DE, Kakiuchi M, Gupta S et al (2020) Autophagy promotes immune evasion of pancreatic cancer by degrading MHC-I. Nature 581:100–105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang ZH, Li Y, Zhang P, Xiang X, Wei XS, Niu YR et al (2021) Development and validation of a prognostic autophagy-related gene pair index related to tumor-infiltrating lymphocytes in early-stage lung adenocarcinoma. Front Cell Dev Biol 9:719011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wang H, Mao W, Lou W, Jin D, Wu W, Wang D et al (2022) PYCR1: a potential prognostic biomarker in pancreatic ductal adenocarcinoma. J Cancer 13:1501–1511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cui B, He B, Huang Y, Wang C, Luo H, Lu J et al (2023) Pyrroline-5-carboxylate reductase 1 reprograms proline metabolism to drive breast cancer stemness under psychological stress. Cell Death Dis 14:682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Xu Y, Zuo W, Wang X, Zhang Q, Gan X, Tan N et al (2021) Deciphering the effects of PYCR1 on cell function and its associated mechanism in hepatocellular carcinoma. Int J Biol Sci 17:2223–2239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang L, Zhao X, Wang E, Yang Y, Hu L, Xu H et al (2023) PYCR1 promotes the malignant progression of lung cancer through the JAK-STAT3 signaling pathway via PRODH-dependent glutamine synthesize. Transl Oncol 32:101667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gao Y, Luo L, Xie Y, Zhao Y, Yao J, Liu X (2020) Pycr1 knockdown inhibits the proliferation, migration, and invasion by affecting JAK/STAT signaling pathway in lung adenocarcinoma. Mol Carcinog 59:503–511 [DOI] [PubMed] [Google Scholar]
  • 18.Sun L, Tuo Z, Chen X, Wang H, Lyu Z, Li G (2024) Identification of cell differentiation trajectory-related gene signature to reveal the prognostic significance and immune landscape in prostate cancer based on multiomics analysis. Heliyon 10:e27628 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu D, Li M, Zhao Z, Zhou L, Zhi F, Guo Z et al (2024) Targeting the TRIM14/USP14 axis enhances immunotherapy efficacy by inducing autophagic degradation of PD-L1. Cancer Res 84:2806–2819 [DOI] [PubMed] [Google Scholar]
  • 20.Cheng X, Wang J, Qiu C, Jin Y, Xia B, Qin R et al (2022) Feasibility of iNKT cell and PD-1+CD8+ T cell-based immunotherapy in patients with lung adenocarcinoma: preliminary results of a phase I/II clinical trial. Clin Immunol 238:108992 [DOI] [PubMed] [Google Scholar]
  • 21.Zheng K, Sha N, Hou G, Leng Z, Zhao Q, Zhang L et al (2023) IGF1R-phosphorylated PYCR1 facilitates ELK4 transcriptional activity and sustains tumor growth under hypoxia. Nat Commun 14:6117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kuo CL, Chou HY, Chiu YC, Cheng AN, Fan CC, Chang YN et al (2020) Mitochondrial oxidative stress by Lon-PYCR1 maintains an immunosuppressive tumor microenvironment that promotes cancer progression and metastasis. Cancer Lett 474:138–150 [DOI] [PubMed] [Google Scholar]
  • 23.Krishnan N, Dickman MB, Becker DF (2008) Proline modulates the intracellular redox environment and protects mammalian cells against oxidative stress. Free Radic Biol Med 44:671–681 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang H, He D (2023) LINC01123 acts as an oncogenic driver in lung adenocarcinoma by regulating the miR-4766-5p/PYCR1 axis. Histol Histopathol 38:1475–1486 [DOI] [PubMed] [Google Scholar]
  • 25.Xu X, Wang Y, Hu X, Zhu Y, Wang J, Guo J (2023) Effects of PYCR1 on prognosis and immunotherapy plus tyrosine kinase inhibition responsiveness in metastatic renal cell carcinoma patients. Neoplasia 43:100919 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Amaravadi RK, Kimmelman AC, Debnath J (2019) Targeting autophagy in cancer: recent advances and future directions. Cancer Discov 9:1167–1181 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Li X, He S, Ma B (2020) Autophagy and autophagy-related proteins in cancer. Mol Cancer 19:12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Duan Y, Tian X, Liu Q, Jin J, Shi J, Hou Y (2021) Role of autophagy on cancer immune escape. Cell Commun Signal 19:91 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu N, Wang A, Xue M, Zhu X, Liu Y, Chen M (2024) FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov 10:172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pu J, Zhang D, Wang B, Zhu P, Yang W, Wang K et al (2024) FOXA1/UBE2T inhibits CD8(+)T cell activity by inducing mediates glycolysis in lung adenocarcinoma. Front Biosci (Landmark Ed) 29:134 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

262_2025_4144_MOESM1_ESM.tif (2MB, tif)

Supplementary Figure 1. The impact of PYCR1 on CD8+ T cell anti-tumor immune responseA: qPCR assessed PYCR1 expression in Calu-3 cells; B-C: Flow cytometry detected TNF-α and IFN-γ levels in the co-culture system; D: LDH activity assay kit was used to detect CD8+ T cell toxicity in the co-culture system; E: Transwell assay assessed the chemotactic potential of CD8+ T cells in the co-culture system; F: Calcein-AM/PI staining and statistical analysis of PI positivity rate in Calu-3 cells. * represents P<0.05. (TIF 2086 kb)

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from Cancer Immunology, Immunotherapy : CII are provided here courtesy of Springer

RESOURCES