BRG1 inhibits glycolysis by promoting SHP1-mediated dephosphorylation of PKM2 in non-small cell lung cancer

Abstract

Glucose metabolic reprogramming serves as a regulatory mechanism to support tumor growth. Here, we identified that BRG1, a subunit of the SWI/SNF chromatin remodeling complex encoded by SMARCA4, can inhibit the glycolysis and proliferation of non-small cell lung cancer (NSCLC) cells. Mechanistically, BRG1 promotes the interaction between SHP1 and PKM2, which affects the subcellular localization and pyruvate kinase activity of PKM2 by reducing its phosphorylation at tyrosine 105 and facilitating PKM2 tetramer formation. Thus, we explored a novel biological function of BRG1 in NSCLC, elucidated the impact of BRG1 on glucose metabolism, and provided insights for clinical strategies targeting tumors with this genetic mutation.

Introduction

Metabolic reprogramming is a key hallmark of cancer, with glucose metabolism serving as its core component and playing a critical role in tumor progression [1]. The Warburg effect posits that even in the presence of sufficient oxygen, cancer cells preferentially utilize glycolysis for energy production. Although this ATP-generating method is less efficient than oxidative phosphorylation, cancer cells sustain their energy supply by enhancing glucose uptake. Additionally, the metabolic intermediates generated from glycolysis support macromolecular biosynthesis in cancer cells, thereby endowing them with unlimited proliferation potential [2]. Increased lactate production inhibits the function of various immune cells and influences cancer progression through multiple pathways [3], while intracellular ATP also significantly contributes to chemotherapy resistance [4]. Nevertheless, the specific regulatory mechanisms and potential therapeutic targets associated with cancer metabolic reprogramming remain to be elucidated.

Lung cancer can be classified into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) based on its pathological type, with NSCLC accounting for 85% of cases, and approximately 50% of patients are diagnosed with locally advanced or metastatic disease. Despite the continuous emergence and development of various treatment, the 5-year survival rate remains low [5]. NSCLC tumors exhibit enhanced glycolysis compared to adjacent normal tissue [6], but the regulatory mechanisms warrant further investigation. Mutations in the SWI/SNF chromatin remodeling complex occur in nearly 20% of human tumors, with SMARCA4 being one of the most frequently mutated genes, which encodes BRG1 protein [7]. BRG1 is thought to exert tumor-suppressive effects in cancers such as lung and ovarian cancer [8, 9] and shows abnormal expression in about 10% of NSCLC cases [10], performing various biological functions including regulation of gene expression, DNA replication, and cell differentiation [11]. Patients with NSCLC harboring SMARCA4 mutations typically have a poor prognosis and limited response to conventional chemotherapy [12]. Investigating the role of BRG1 in NSCLC progression may provide new therapeutic strategies and improve prognostic outcomes. However, the specific function of BRG1 in tumor glycolysis remains unclear.

In the process of glucose metabolism, PKM2 functions as pyruvate kinase, catalyzing the conversion of phosphoenolpyruvate to pyruvate while generating ATP. Its enzymatic activity is modulated by allosteric regulation and post-translational modifications. For example, the binding of fructose 2,3-bisphosphate (FBP) to PKM2 promotes the formation of a high-activity tetramer, and the release of FBP leads to a transition from tetramer to dimer in PKM2, resulting in reduced pyruvate kinase activity [13]. Post-translational modifications like phosphorylation, acetylation, and sumoylation favor the formation of dimeric PKM2 in tumor cells. For instance, phosphorylation at tyrosine 105 induces FBP release from the tetramer and facilitates dimer formation. These dimers exhibit lower enzymatic activity and are involved in macromolecular biosynthesis, thereby supplying essential materials for rapid tumor cell proliferation [14, 15]. Furthermore, PKM2 also acts as a transcriptional cofactor or protein kinase. Dimeric PKM2 translocates into the nucleus, where it activates transcription factors such as HIF-1α, STAT3, and β-catenin, thereby enhancing the expression of genes essential for tumor growth [16]. Consequently, modulating the oligomeric state and pyruvate kinase activity of PKM2 represents a significant strategy in cancer therapy.

Protein phosphorylation is a prevalent post-translational modification that plays a critical role in nearly all cellular biological processes [17]. SHP1 belongs to the non-receptor protein tyrosine phosphatase (NRPTP) family, encoded by PTPN6, and is involved in various signal transduction pathways. Prior research has demonstrated that chemotherapy-resistant leukemia stem cells (crLSCs) with PTPN6 deficiency exhibit enhanced glycolytic capacity, including increased glucose uptake as well as ATP and lactate production [18]. Beyond its role in cellular metabolism, cGAS mediates the dephosphorylation of p85 by SHP1 to inhibit hepatocellular cancer progression [19]. Protein kinases and phosphatases are important targets for the treatment of cancers, but the specific mechanisms and potential targets require further investigation.

In this study, we observed that BRG1 is downregulated in NSCLC. Overexpression of BRG1 inhibited glycolysis and proliferation in NSCLC cells and suppressed tumor growth in vivo. To be specific, BRG1 promoted the interaction between SHP1 and PKM2 within the nucleus, which reduced phosphorylation of PKM2 at Y105 and induced PKM2 tetramer formation, thereby enhancing its cytoplasmic localization and pyruvate kinase activity. Our results uncovered novel biological functions and mechanisms of BRG1 in glucose metabolism, offering potential therapeutic strategies for NSCLC patients.

Results

BRG1 inhibits NSCLC proliferation in vitro and in vivo

To investigate the role of BRG1 in NSCLC progression, we collected 12 pairs of human NSCLC samples, western blot analysis showed that the expression of BRG1 in tumor tissues was lower than that in the adjacent normal tissues (Fig.1A, B). Immunohistochemical (IHC) staining assays also showed the same results (Supplementary Fig. 1A). These results are consistent with prior studies that suggest BRG1 functions as a tumor suppressor. Additionally, we evaluated the expression levels of BRG1 across five NSCLC cell lines. The results indicated that BRG1 was relatively lowly expressed in A549 cells and exhibited higher expression in PC9 cells (Supplementary Fig. 1B). Consequently, we established stable overexpression and knockdown models of BRG1 in these two cell lines, followed by validation at both protein and mRNA levels (Supplementary Fig. 1C–F). The BrdU assays demonstrated that the overexpression of BRG1 significantly inhibited the proliferation of NSCLC cells in vitro (Fig. 1C, D), whereas the knockdown of BRG1 facilitated tumor cell proliferation (Supplementary Fig. 1G, H). Consistent results were obtained from the CCK8 assays (Supplementary Fig. 2A, B) and colony formation assays (Supplementary Fig. 2C, D). Using subcutaneous xenograft models, we assessed the size of subcutaneous tumors at 7-day intervals and collected the xenografts on day 28 post-inoculation. Our findings revealed that BRG1 overexpression markedly inhibited tumor growth in vivo, resulting in reduced tumor size and weight (Fig. 1E–G). Conversely, BRG1 knockdown accelerated tumor growth, leading to increased tumor size and weight (Supplementary Fig. 2E–G).

Fig. 1. BRG1 inhibits NSCLC proliferation in vitro and in vivo.

A, B The protein level of BRG1 was detected by western blot assays in 12 paired NSCLC tissues and adjacent normal tissues. C, D The proliferation of indicated NSCLC cells in vitro evaluated by BrdU assays (n = 3). E Representative image of subcutaneous xenografts (n = 5) formed by the indicated A549 cells in nude mice. F Tumor size (n = 5) were calculated every 7 days, and the growth curve was drawn. G Tumor weight (n = 5) of the subcutaneous xenografts were measured. H, I Co-immunoprecipitation (Co-IP) assays were performed in A549 and PC9 cells using anti-BRG1 or anti-PKM2 antibodies to examine the endogenous interaction between BRG1 and PKM2. All western blotting experiments were independently replicated three times, yielding consistent results. J, K Indicated NSCLC cells (n = 3) were subjected to pyruvate kinase activity analyses. *p < 0.05, **p < 0.01, ***p < 0.001.

BRG1 interacts with PKM2, enhancing its pyruvate kinase activity

To further elucidate the biological role of BRG1 in tumor progression, we employed mass spectrometric analysis to identify proteins that interact with BRG1 and discovered that PKM is a potential binding partner (Supplementary Table 1). Glucose metabolism, central to cancer metabolic reprogramming, plays a crucial role in tumor progression. Considering that PKM2 is one of the key enzymes within the glucose metabolic pathway and the function of BRG1 in this process remains unclear, we conducted an in-depth investigation into the interaction between BRG1 and PKM2. The interaction between endogenous BRG1 and PKM2 was corroborated through the application of anti-BRG1 or anti-PKM2 antibodies (Fig. 1H, I). Co-transfect GST-BRG1 and Flag-PKM2 plasmids into HEK293T cells, and subsequent co-immunoprecipitation (co-IP) assays confirmed the exogenous interaction between BRG1 and PKM2 (Supplementary Fig. 3A, B). Furthermore, to ascertain whether the interaction between BRG1 and PKM2 affects the function of PKM2 in glucose metabolism, we conducted an assessment of BRG1’s regulatory effect on the pyruvate kinase activity of PKM2, and observed that overexpression of BRG1 significantly enhanced its pyruvate kinase activity (Fig. 1J), whereas knockdown of BRG1 resulted in a marked reduction in its pyruvate kinase activity (Fig. 1K).

BRG1 suppresses glycolytic metabolism in NSCLC cells

Subsequently, we conducted further investigations to determine whether BRG1 influences tumor glucose metabolism. Our findings revealed that the basal glycolysis, glycolytic capacity, and glycolytic reserve in NSCLC cells overexpressing BRG1 were significantly diminished as assessed by XFe Seahorse energy metabolic stress assays (Fig. 2A, B), whereas these parameters were markedly enhanced in NSCLC cells with BRG1 knockdown (Supplementary Fig. 3C, D). In addition, oxygen consumption rate (OCR) measurements revealed that the basal mitochondrial respiration level, maximum rate of oxidative phosphorylation (OXPHOS), and reserve capacity of OXPHOS were all significantly enhanced in A549 cells overexpressing BRG1(Supplementary Fig. 3E, F). Conversely, in PC9 cells with BRG1 knockdown, these parameters were markedly reduced (Supplementary Fig. 3G, H). The overexpression of BRG1 resulted in a reduction of glucose uptake, as well as lactate and ATP production in NSCLC cells (Fig. 2C–E). Conversely, the knockdown of BRG1 led to an enhancement in glucose uptake along with increased lactate and ATP production in NSCLC cells (Supplementary Fig. 4A-C). These findings suggest that BRG1 plays a role in suppressing tumor glycolysis in NSCLC cells.

Fig. 2. The overexpression of BRG1 suppresses glycolytic metabolism in NSCLC cells and is contingent upon the pyruvate kinase activity of PKM2.

A, B, ECAR of A549 cells stably overexpressing BRG1 was measured with the Seahorse XF24 analyzer platform (n = 4). Glycolysis, glycolytic capacity and glycolytic reverse in each group were analyzed. C Glucose uptake assay was performed in A549 cells with BRG1 overexpression (n = 3). D Lactate level was measured in A549 cells with BRG1 overexpression (n = 3). E Intracellular ATP level was measured in A549 cells with BRG1 overexpression (n = 3). F, G PC9 cells with BRG1 knockdown (shBRG1) were treated with either vehicle control (DMSO) or 30 μM TEPP-46 for 36 hours, followed by ECAR analysis using the Seahorse XF24 analyzer (n = 5). Glycolysis, glycolytic capacity and glycolytic reverse in each group were analyzed. H Glucose uptake assay was performed in PC9 cells with BRG1 knockdown (shBRG1) and treated with either vehicle control (DMSO) or 30 μM TEPP-46 for 36 hours (n = 3). I Lactate level was measured in PC9 cells with BRG1 knockdown (shBRG1) and treated with either vehicle control (DMSO) or 30 μM TEPP-46 for 36 hours (n = 3). J Intracellular ATP level was measured in PC9 cells with BRG1 knockdown (shBRG1) and treated with either vehicle control (DMSO) or 30 μM TEPP-46 for 36 hours (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns, no significant.

The specific PKM2 activator TEPP-46 enhances pyruvate kinase activity and suppressed glycolytic metabolism in NSCLC cells, thus counteracting the elevated basal glycolysis, glycolytic capacity, and glycolytic reserve induced by BRG1 knockdown (Fig. 2F, G). Moreover, the presence of TEPP-46 reversed the enhanced glucose uptake, as well as lactate and ATP production in NSCLC cells induced by BRG1 knockdown (Fig. 2H–J). The application of TEPP46 significantly inhibited the in vitro proliferation of NSCLC cells exhibiting lower BRG1 expression (Supplementary Fig. 4D), and counteracted the enhancement of in vivo tumor growth induced by BRG1 knockdown, resulting in a deceleration of tumor growth, reduced tumor size and decreased tumor weight (Supplementary Fig. 4E–G). On the contrary, upon treatment with the specific PKM2 inhibitor PKM2-IN-1, the overexpression of BRG1 failed to suppress glycolysis or attenuate cell proliferation (Supplementary Fig. 5A–C). Our results indicate that BRG1 modulates glycolytic metabolism and proliferation of NSCLC cells through the regulation of PKM2 pyruvate kinase activity.

BRG1 induces PKM2 tetramer formation by reducing its Y105 phosphorylation

To elucidate how BRG1 affects the pyruvate kinase activity of PKM2, we first tested whether BRG1 influences the expression level of PKM2 and found that neither overexpression nor knockdown of BRG1 altered the total protein level of PKM2 (Supplementary Fig. 6A, B). Secondly, considering that the oligomeric state of PKM2 is a critical determinant affecting its pyruvate kinase activity, we examined the oligomerization of PKM2 under varying conditions of BRG1 expression. The results showed that overexpression of BRG1 facilitated PKM2 tetramer formation (Fig. 3A), whereas knockdown of BRG1 led to an increase in its dimer content (Supplementary Fig. 6C). To further investigate the specific mechanism by which BRG1 facilitates the transition of PKM2 from dimer to tetramer, and in light of previous research indicating that the phosphorylation of PKM2 is a critical factor influencing its oligomeric state, we performed immunoprecipitation of endogenous PKM2 using anti-PKM2 antibody and subsequently assessed its phosphorylation levels in NSCLC cells with either overexpression or knockdown of BRG1 under EGF stimulation. Our findings revealed that BRG1 modulated the tyrosine phosphorylation of PKM2, while having no significant effect on serine/threonine phosphorylation. Specifically, overexpression of BRG1 resulted in a decrease in tyrosine phosphorylation at position 105 (Fig. 3B), whereas BRG1 knockdown led to an increase in Y105 phosphorylation (Fig. 3C).

Fig. 3. BRG1 induces PKM2 tetramer formation and cytoplasmic localization by reducing its Y105 phosphorylation.

A The oligomeric state of PKM2 was detected in control or BRG1 stable overexpression A549 cells. Cell lysates from the indicated cells were incubated in the presence or absence of 0.01% glutaraldehyde, followed by western blot analysis. GA, glutaraldehyde. B The phosphorylation of PKM2 was detected in control or BRG1 stable overexpression A549 cells under EGF stimulation via western blot assays. C The phosphorylation of PKM2 was detected in PC9 cells silenced with control (shNC) or BRG1 shRNA (shBRG1 #1 and #2) under EGF stimulation via western blot assays. D, E Cytoplasmic and nuclear proteins were isolated from the indicated cells, and the subcellular localization of PKM2 was detected via western blot assays. F, G Cytoplasmic and nuclear proteins were isolated from the indicated cells, and the subcellular localization of exogenous wild-type Flag-PKM2 and its phosphorylation mutant Y105F Flag-PKM2 was detected via western blot assays. All western blotting experiments were independently replicated three times, yielding consistent results.

In addition to modulating the pyruvate kinase activity, the oligomeric state of PKM2 also affects its subcellular localization. To test the effect of BRG1 on the cellular distribution of PKM2, cytoplasmic and nuclear proteins were isolated from the cells, and western blot assays showed that BRG1 overexpression led to an elevated level of PKM2 in the cytoplasm (Fig. 3D), while BRG1 knockdown resulted in an increased accumulation of PKM2 within the nucleus (Fig. 3E). The results presented above suggested that BRG1 induces PKM2 tetramer formation by reducing its Y105 phosphorylation, thereby altering the pyruvate kinase activity and subcellular localization of PKM2. This transformation shifts PKM2 from low-pyruvate kinase activity dimers localized in the nucleus to high-pyruvate kinase activity tetramers situated in the cytoplasm. Functionally, BRG1 enhances the pyruvate kinase activity of PKM2, leading to a reduction in glycolysis within tumor cells while simultaneously inhibiting the oncogenic function of dimeric PKM2 as a transcriptional cofactor in the nucleus.

To further validate that BRG1 modulates glycolytic metabolism in NSCLC cells by altering PKM2 Y105 phosphorylation, we transfected wild-type Flag-PKM2 and its phosphorylation mutant Y105F Flag-PKM2 plasmids into BRG1-overexpressing cells. The results showed that Y105F Flag-PKM2 predominantly localized in the cytoplasm, and overexpression of BRG1 promoted the cytoplasmic accumulation of WT Flag-PKM2 while exerting no effect on the cytoplasmic levels of Y105F Flag-PKM2 (Fig. 3F). Similarly, knockdown of BRG1 diminished the cytoplasmic content of WT Flag-PKM2 without affecting the levels of Y105F Flag-PKM2 (Fig. 3G). Furthermore, we replaced endogenous PKM2 with shRNA-resistant WT Flag-PKM2 or Y105F Flag-PKM2 in A549 cells and simultaneously overexpressed BRG1 (Supplementary Fig. 6D). The findings revealed that overexpression of BRG1 significantly increased pyruvate kinase activity in WT Flag-PKM2 cells (Supplementary Fig. 6E), concurrently inhibiting glycolysis (Fig. 4A, B), glucose uptake, as well as lactate and ATP production, with no impact on Y105F Flag-PKM2 cells (Fig. 4C–E). In vitro proliferation assays demonstrated that BRG1 specifically inhibited WT Flag-PKM2 cell growth but did not affect the proliferation rates of tumor cells expressing Y105F Flag-PKM2 (Supplementary Fig. 6F). Likewise, subcutaneous xenograft models corroborated that overexpression of BRG1 suppressed tumor growth in WT Flag-PKM2 cells. Conversely, tumors with Y105F Flag-PKM2 expression exhibited slower growth rates, reduced tumor size and tumor weight without being influenced by changes in BRG1 expression levels (Fig. 4F–H). The immunohistochemical analysis of tumor tissue revealed that BRG1 reduced PKM2 Y105 phosphorylation and Ki-67 expression level in WT Flag-PKM2 tumor, whereas no such effect was observed in Y105F Flag-PKM2 tumor (Supplementary Fig. 7A–C). These results indicated that BRG1 modulates the subcellular localization of PKM2, enhances pyruvate kinase activity, and alters glycolytic metabolism in NSCLC cells by modifying the phosphorylation status of PKM2 at Y105.

Fig. 4. BRG1 modulates glycolytic metabolism and in vivo proliferation through PKM2 Y105 phosphorylation.

A, B GST-BRG1 and recombinant shRNA-resistant Flag-PKM2 (wild type or Y105F mutant) were transfected into A549 cells previously treated with shPKM2. ECAR of the indicated cells was measured with the Seahorse XF24 analyzer platform (n = 5). Glycolysis, glycolytic capacity and glycolytic reverse in each group were analyzed. C Glucose uptake assay was performed in the indicated cells (n = 3). D Lactate level was measured in the indicated cells (n = 3). E Intracellular ATP level was measured in the indicated cells (n = 3). F Representative image of subcutaneous xenografts (n = 5) formed by the indicated A549 cells in nude mice. G Tumor size (n = 5) were calculated every 7 days, and the growth curve was drawn. H Tumor weight (n = 5) of the subcutaneous xenografts were measured. **p < 0.01, ***p < 0.001, ****p < 0.0001, ns, no significant.

BRG1 mediates the phosphorylation of PKM2 through SHP1

Given that BRG1 lacks phosphatase activity, we sought to further elucidate the mechanism by which BRG1 regulates PKM2 phosphorylation. We hypothesized that this regulation may occur through modulation of the interactions between relevant phosphatases and PKM2. Considering that BRG1 is a nuclear protein facilitating the translocation of PKM2 from the nucleus to the cytoplasm, we posited that these potential phosphatases are also localized in the nucleus and interact with both BRG1 and PKM2 therein. Consequently, we screened three nuclear localization phosphatases: PTPN2, SHP1, and SHP2. Following co-transfection of HEK293T cells with Flag-PKM2 alongside HA-PTPN2, HA-SHP1 or HA-SHP2, our findings indicated no interaction between PTPN2 and PKM2. However, both SHP1 and SHP2 were capable of binding to PKM2, with only SHP1 effectively reducing PKM2 Y105 phosphorylation (Fig. 5A). Regardless of the presence of EGF stimulation, only overexpression of SHP1 can reduce endogenous PKM2 Y105 phosphorylation levels (Fig. 5B, C). The interaction between endogenous BRG1 and SHP1 was validated using anti-BRG1 or anti-SHP1 antibodies as demonstrated by Co-IP assays (Fig. 5D, E). Additionally, co-transfection of GST-BRG1 and HA-SHP1 plasmids into HEK293T cells revealed the interaction between exogenous BRG1 and SHP1 (Fig. 5F). Furthermore, overexpression of BRG1 enhanced the interaction between SHP1 and PKM2 in a dose-dependent manner while concurrently decreasing PKM2 Y105 phosphorylation (Fig. 5G). Similarly, BRG1 augmented the interaction between endogenous SHP1 and PKM2 in a dose-dependent fashion, accompanied by a reduction in PKM2 Y105 phosphorylation (Fig. 5H).

Fig. 5. BRG1 mediates PKM2 Y105 phosphorylation through SHP1.

A HEK293T cells were transfected with Flag-PKM2 plasmid, and then transfected with vector, HA-PTPN2, HA-SHP1 or HA-SHP2 plasmids. After EGF stimulation, whole cell lysates (WCL) were collected and subjected to immunoprecipitation using anti-Flag magnetic beads, followed by immunoblot analysis. B, C The protein level of p-PKM2^Y105 was detected by western blot assays in control or SHP1, SHP2 overexpression A549 cells with or without EGF stimulation. D, E Co-IP assays were performed in A549 and PC9 cells using anti-BRG1 or anti-SHP1 antibodies to examine the endogenous interaction between BRG1 and SHP1. F Co-IP assays were performed in HEK293T cells using antibodies against GST or HA to examine the exogenous interaction between GST-BRG1 and HA-SHP1. G HEK293T cells were transfected with Flag-PKM2 plasmid, along with HA-SHP1, with or without various amounts of GST-BRG1 (2, 4, and 6 μg). Whole cell lysates (WCL) were collected and subjected to immunoprecipitation using anti-Flag magnetic beads, followed by immunoblot analysis. The interaction between Flag-PKM2 and HA-SHP1 in control or EGF-stimulated cells was analyzed. H HEK293T cells were transfected with or without various amounts of GST-BRG1 (2, 4, and 6 μg). Whole cell lysates (WCL) were collected and subjected to immunoprecipitation using Protein A/G Magnetic Beads with anti-PKM2 antibodies, followed by immunoblot analysis. The interaction between PKM2 and SHP1 in control or EGF-stimulated cells was analyzed. I The protein level of p-PKM2^Y105 was detected in control (shNC) or shSHP1-treated A549 cells with or without BRG1 overexpression under EGF stimulation by western blot assays. All western blotting experiments were independently replicated three times, yielding consistent results.

To further validate that BRG1 regulates PKM2 phosphorylation and glycolytic metabolism in NSCLC cells dependent on SHP1, we established stable SHP1 low-expression A549 cell lines using lentiviral vectors containing SHP1 shRNA sequences. We found that when SHP1 expression was reduced, overexpression of BRG1 did not alter PKM2 Y105 phosphorylation (Fig. 5I). Following SHP1 knockdown, the overexpression of BRG1 no longer influenced the glycolysis (Fig. 6A, B), glucose uptake, or intracellular lactate and ATP production (Fig. 6C–E) in NSCLC cells. Moreover, BRG1 overexpression had no significant impact on the in vitro proliferation of SHP1 knockdown cells (Supplementary Fig. 8A). And similar results were observed in vivo using subcutaneous xenograft models, SHP1 knockdown impeded the tumor-suppressive effect of BRG1 (Supplementary Fig. 8B–D). Application of the specific SHP-1 inhibitor TPI-1 further confirmed that the inhibitory effect of BRG1 on NSCLC cell proliferation is partially mediated by SHP-1 (Supplementary Fig. 8E–G). These findings collectively indicated that BRG1 regulates PKM2 Y105 phosphorylation and oligomeric state by enhancing the interaction between SHP1 and PKM2, and that BRG1 modulates glycolysis in NSCLC cells through the BRG1/SHP1/PKM2 Y105 pathway (Fig. 6F).

Fig. 6. BRG1 modulates glycolytic metabolism through SHP1.

A, B BRG1 were transfected into control (shNC) or shSHP1-treated A549 cells. ECAR of indicated cells was measured with the Seahorse XF24 analyzer platform (n = 5). Glycolysis, glycolytic capacity and glycolytic reverse in each group were analyzed. C Glucose uptake assay was performed in the indicated cells (n = 3). D Lactate level was measured in the indicated cells (n = 3). E Intracellular ATP level was measured in the indicated cells (n = 3). F The working model proposes that BRG1 inhibits glycolysis by promoting SHP1-mediated dephosphorylation of PKM2 and its tetramer formation as well as cytoplasmic localization. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns, no significant.

Discussion

Lung cancer continues to be one of the foremost causes of cancer-related mortality on a global scale. As indicated by global cancer statistics from the International Agency for Research on Cancer (IARC), there were approximately 2.5 million new cases of lung cancer, representing 12.4% of all global cancer diagnoses in 2022; it also stood as the primary cause of cancer fatalities, accounting for approximately 18.7% of total deaths [20]. Over recent decades, substantial advancements have been achieved in the systematic management of patients with advanced diseases, guided by molecular subtyping. The ongoing identification of novel molecular targets holds promise for the development of innovative therapies that may ultimately enhance patient survival rates [21].

Tumor cells exhibit rapid adaptation and survival advantages under conditions of hypoxic and nutritional deficiency, which is partly dependent on the “metabolic reprogramming” of tumor cells and is recognized as one of the ten hallmarks of cancer [1]. The progression of cancer, including proliferation, invasion, and metastasis, requires metabolic reprogramming, with the Warburg effect being a significant component [22]. Dysregulation of glucose metabolism is one of the characteristics of NSCLC, even in oxygen-rich environments, tumor cells preferentially engage in glycolysis to generate ATP. Inhibiting glycolytic pathways can significantly impede tumor proliferation [23]. Thus, targeting glycolytic metabolism represents a promising strategy for treating NSCLC and other cancers. For instance, the oncoprotein cancerous inhibitor of protein phosphatase 2 A (CIP2A) facilitates PKM2 tetramer formation to suppress glycolysis. Combining the glycolytic inhibitor 2-DG with CIP2A-targeting compounds yields synergistic antitumor effects [24]. Aldehyde dehydrogenase 3A1 (ALDH3A1) enhances NSCLC glycolysis via the HIF-1α/LDHA pathway while β-elemene downregulates ALDH3A1 to inhibit glycolysis and proliferation of NSCLC [25]. Additionally, LDHB, PDK1, GLUT1, and PFKM may serve as promising targets for cancer therapies aimed at disrupting glycolytic processes in tumor cells [26, 27].

The SWI/SNF chromatin remodeling complex comprises 10-15 subunits in various combinations, which alter the DNA-histone topology to transition the chromatin from a compact state to an open configuration, thereby regulating gene expression [28]. During cancer progression, the SWI/SNF complex typically functions as a tumor suppressor [29, 30]. Previous studies utilizing whole-exome sequencing have identified mutations within the SWI/SNF complex across 18 types of cancer, ranking second only to TP53 with a frequency of 19%, of which 15.8% are attributed to SMARCA4, encoding the BRG1 protein [31]. As one of the most frequently aberrant subunits in this complex, BRG1 plays a critical role in transcriptional processes across various cancers and has important effects on tumorigenesis, tumor progression, treatment response, and prognosis of NSCLC [32]. A comprehensive investigation into the biological functions of BRG1 can enhance our understanding of cancer development mechanisms and facilitate the identification of potential therapeutic targets. However, its role in metabolic reprogramming within tumor cells remains unclearly. In this study, we demonstrated that BRG1 regulated glycolysis in NSCLC cells. Overexpression of BRG1 inhibited tumor glycolysis, decreasing glucose uptake along with lactate and ATP production. Conversely, BRG1 knockdown enhanced cellular glycolytic capacity.

Subsequently, we identified that BRG1 interacts with PKM2 by protein mass spectrometry analysis. PKM1 and PKM2 are generated from the PKM gene via differential selective splicing of primary mRNA. PKM2 expression is upregulated in tumor cells and promotes tumor proliferation and metastasis [33]. As a key rate-limiting enzyme in glucose metabolism and a critical regulator of tumor metabolic reprogramming, investigating the function of PKM2 and its regulatory mechanisms is highly significant. Previous studies have demonstrated that ALYREF stabilizes PKM2 and enhances glycolysis and proliferation in bladder cancer cells [34]. OTUB2 binds to PKM2 and inhibits its ubiquitination by obstructing its interaction with E3 ubiquitin ligase Parkin, thus augmenting PKM2 activity and facilitating glycolysis in colorectal cancer cells [35]. Alterations in the polymerization state, cellular localization and pyruvate kinase activity of PKM2 significantly influence tumor progression. Therefore, elucidating the specific regulatory mechanisms may provide valuable therapeutic strategies for cancer treatment. Our data indicated that BRG1 reduced PKM2 Y105 phosphorylation, which increased cytoplasmic accumulation and pyruvate kinase activity of PKM2, thereby regulating glycolysis and proliferation in NSCLC cells.

Our data showed that BRG1 facilitated the dephosphorylation of PKM2 at Y105 through SHP1, which resulted in diminished glycolysis in NSCLC cells and exerted anti-cancer effects. SHP1 has been identified as a tumor suppressor, particularly noted for its role in inhibiting STAT3 activation, such as luteolin, a plant flavonoid, facilitates SHP1-mediated dephosphorylation of STAT3, thereby suppressing gastric cancer growth [36]. Targeting the E3 ubiquitin ligase RNF6 reduces SHP-1 ubiquitination and degradation, subsequently inhibiting the activation of JAK/STAT3 pathway and suppressing colorectal cancer progression [37]. TGF-β stimulates tumor cells to enhance SHP1 phosphatase activity in an AKT-smad3-dependent manner, leading to decreased tyrosine phosphorylation of JAK1/2 and STAT1 and inhibiting the expression of immune evasion-related molecules in lung cancer cells [38]. Therefore, targeting SHP1 presents significant potential for cancer therapy. Here, we found that BRG1 regulated glycolysis through the dephosphorylation of PKM2 mediated by SHP1, however, SHP1 may also exhibit a pro-oncogenic role across various tumor types. For instance, in colorectal cancer, inhibition of SHP1 enhances the efficacy of immunotherapy by diminishing its suppression of STING pathway activation [39].

In summary, our study elucidated a novel biological function of BRG1 in NSCLC. Specifically, BRG1 facilitates the SHP1-mediated dephosphorylation of PKM2 at Y105, thereby inhibiting glycolysis in NSCLC cells and tumor growth both in vivo and in vitro. This newly identified biological function offers potential targets and theoretical foundation for cancer therapies aimed at glycolysis. However, further investigation is required to assess the impact of BRG1 on other metabolic pathways as well as its additional significant biological functions in cancer. Strategies for selecting targeted drugs and appropriate combinations needs further exploration.

Materials and Methods

Cell lines and cell culture

Human embryonic kidney cell HEK293T and human NSCLC cells (A549, PC9) utilized in this study were obtained from the American Type Culture Collection (ATCC). STR certificates for each cell line were provided. Cells were maintained in DMEM (Gibco) or RPMI-1640 (Gibco) with 10% fetal bovine serum, 1% penicillin and 1% streptomycin. All cells were incubated in cell-culture incubators at 37 °C, containing 5% CO₂.

Plasmids and construction of lentiviral-infected cell lines

The genes of BRG1, PKM2 and SHP1 were inserted into the pCMV vector, respectively. The pLV3 puro vectors expressing shBRG1(#1:5’-CGCGCTACAACCAGATGAAAG TTCAAGAGACTTTCATCTGGTTGTAGCGCG-3’, #2:5’-CGGCAGACACTGTGA TCATTT-3’); shPKM2(#1:5’- CGGGTGAACTTTGCCATGAAT-3’, #2: 5’-CTTTCCTGTGTGTACTCTGTC-3’); shSHP1(#1:5’-GGAGCATGACACAACCGAATATTCAAGAGATATTCGGTTGTGTCATGCTCCTTTTTT-3’, #2:5’GATTCGGGAGATCTGGCATTATTCAAGAGATAATGCCAGATCTCCCGAATCTTTTTT-3’). Following the co-transfection of above plasmids along with PMD2.G and psPAX2 into HEK293T cells for 72 hours, the cell culture supernatants were collected and used to infect tumor cells for an additional 48 hours. Subsequently, the cells were incubated with 2.0 µg/ml puromycin for 48 hours, after which selection was performed and validated using Western blotting and qPCR.

Antibodies and reagents

BRG1(3508; Cell Signaling Technology), PKM2(3198; Cell Signaling Technology), p-PKM2^Y105(3827; Cell Signaling Technology), Flag tag(14793S; Cell Signaling Technology), GST tag(AE001;Abclonal), HA tag (AE008; Abclonal), β-actin (AC038; Abclonal), LAMIN B1(A16909; Abclonal), SHP1(A19111;Abclonal), SHP2(A19112; Abclonal), TEPP-46(HY-18657; MedChemExpress), Anti-GST Magnetic Beads (HY-K0222; MedChemExpress), Anti-Flag Magnetic Beads(HY-K0207; MedChemExpress), Anti-HA Magnetic Beads (HY-K0201; MedChemExpress), Protein A/G Magnetic Beads(HY-K0202; MedChemExpress) were commercially purchased.

Western blot and Co-IP assays

In the western blot assays, total protein was extracted using NP40 lysis buffer supplemented with protease and phosphatase inhibitors. The protein concentration was subsequently determined using the Bicinchoninic Acid Assay (BCA) kit (Thermo Fisher Scientific). Cytosolic and nuclear proteins were extracted from the indicated cells using the subcellular structure cytosol and nucleus protein extraction kit (AR0106; Boster). For Co-IP assays, the cell lysate was incubated with the corresponding magnetic beads under gentle rotation at 4°C. Following overnight incubation, the magnetic beads were washed four times with NP40 lysis buffer. Protein samples were resolved by SDS-PAGE and subsequently transferred to PVDF membranes. After blocking with 5% skim milk in TBST for 1 hour at room temperature, overnight incubation at 4 °C with the corresponding primary antibodies was followed. On the following day, after washing with TBST, the membranes were incubated with the respective secondary antibodies for 1 hour at room temperature. Finally, the blots were visualized using ECL reagents (Abbkine). For the detection of PKM2 oligomeric states, 0.01% glutaraldehyde was added to the indicated cell lysate and incubated at 37 °C for 9 minutes. Subsequently, samples were loaded onto 5% gel without SDS under non-reducing and non-denaturing conditions.

Seahorse metabolic assays

Indicated cells were seeded into XF24 cell culture plates (Seahorse Bioscience) and the extracellular acidification rate (ECAR) was measured using the Seahorse analyzer, with 10 mM glucose, 1.5 μM oligomycin, and 50 mM 2-DG added. The glycolysis, glycolytic capacity, and glycolytic reverse in each group were calculated utilizing WAVE software (Seahorse Bioscience, Agilent).

Measurement of glucose uptake, Intracellular lactate and ATP production and pyruvate kinase activity

Glucose uptake was quantified using Glucose Uptake Assay Kit (Promega). In the culture medium, sequentially added 50 μL of 1 mM 2DG, followed by 25 μL of stop buffer, 25 μL of neutralization buffer, and finally 100 μL of the 2DG6P detection reagent. Incubate at room temperature and utilize a luminometer to detect and record the luminescence signal.

For lactate measurement, using lactate content detection kit (Nanjing Jian-Cheng), the indicated cells were collected and centrifuged at 14,000 g at 4 °C in culture medium for 5 min. Then the lactate level was detected.

Intracellular ATP level in the indicated cells was measured by ATP detection kit (Beyotime). 200 μL of ATP detection buffer was used to lyse cells, and the supernatants were collected via centrifugation. The luminescence intensity was then measured after the supernatants were mixed with the prepared working solution.

Pyruvate kinase activity in the indicated cells was measured by a colorimetric-based pyruvate kinase activity assay kit (Biovision).

Mouse tumor xenograft model

6-weeks-old Balb/c nude female mice were kept in the Laboratory Animal Center of Wuhan Tongji Hospital. The indicated NSCLC tumor cells were suspended in the PBS and mixed with Matrigel in a 1:1 ratio. Mice were randomly allocated to different groups (n = 5 per group) using a computer-generated random number sequence (Excel RAND function). Sample sizes were chosen based on similar experiments in the field. Researchers were blinded to group assignments until data analysis. Each nude mouse was injected with 100 μl cell suspension containing 5 × 10⁵ indicated NSCLC tumor cells. In some trials, the tumor-bearing mice were treated with the DMSO or TEPP-46 (100 mg/kg, orally daily). 28 days post-procedure, the mice were sacrificed, and the xenografts were collected for further analysis.

Tumor specimens, and immunohistochemistry staining

Clinical specimens were collected from patients who underwent lung cancer surgery at Tongji Hospital, Wuhan, China. Immunohistochemical analysis was conducted on clinical samples or mouse tumor xenograft tissues. The tissue sections were incubated with blocking buffer at room temperature for 30 minutes after dewaxing, hydration, and antigen retrieval. Subsequently, the sections were incubated overnight at 4°C with the designated primary antibody. The next day, the sections were incubated with the corresponding secondary antibody. The IHC scores depended on the density and intensity of the stained positive cells. The density of positive cells was categorized into four levels: 1 (<5%), 2 (5–30%), 3 (30% - 70%), and 4 (>70%). The intensity of positive staining was classified as follows: 0 (no signal), 1 (weak), 2 (moderate), and 3 (strong). The immunohistochemistry (IHC) score was calculated by multiplying the density score by the intensity score, resulting in a range from 0 to 12.

Statistical analysis

All experiments were conducted at least for three independent times and the number of repetitions for each experiment is shown in the legend. Data were quantified as the mean ± standard deviation (SD). Variance homogeneity was confirmed by Levene’s test (p > 0.05 for all comparisons). Statistical analyses of intergroup differences were conducted using two-sided unpaired Student’s t-tests or one-way ANOVA, as appropriate. Statistical evaluations and graphical representations were performed using GraphPad Prism 8.0 and SPSS 22.0 software. A P value < 0.05 was considered statistically significant.

Author contributions

WZ, HL and JL conceived and designed the experiments; WZ, HZ, and XS conducted biochemical and cellular experiments. GZ and JZ assisted in animal experiments. XL gave suggestions for many experiments. WZ, HL and JL organized and analyzed the data and wrote the manuscript. All authors read and approved the final paper.

Funding

This work is supported by the National Natural Science Foundation of China (No. 82103283, 81902851).

Data availability

All the data can be obtained by contacting the corresponding author.

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

For experiments involving human participants, including the use of tissue samples, all participants provided explicit and informed consent. All patients had been informed and agreed. The analysis of NSCLC patients’ samples in this study adhered to the Declaration of Helsinki and was approved by the committee on the ethics of Tongji Hospital, Huazhong University of Science and Technology. All animal experiments adhered to the NC3Rs ARRIVE guidelines and were conducted with the approval of the Committee on the Ethics of Animal Experiments of Tongji Hospital. All experiments conducted in this study were performed in compliance with the relevant ethical guidelines and regulations.

Supplementary information

The online version contains supplementary material available at 10.1038/s41389-025-00577-y.