Peach Gum Polysaccharide Prevents Chemotherapy-Induced Intestinal Injury and Degenerative Behavior

Abstract

This study investigated the effects of peach gum polysaccharide (PGP) on chemotherapy-induced intestinal injury and behavioral changes in mice. Female C57BL/6 mice were injected with E0771 breast cancer cells and divided into 3 groups: control, chemotherapy (pirarubicin), and PGP treatment (pirarubicin plus PGP). Behavioral tests, colon length measurement, tissue staining, 16S rDNA sequencing, and metabolomics were performed. Transcriptomic data of colon and hippocampal tissues were analyzed and validated by Western blotting. PGP significantly alleviated colon damage, reduced inflammation and apoptosis, and restored colon length. It mitigated depressive behaviors by suppressing inflammasome activation in the hippocampus, increased gut microbiota diversity, and improved depression-associated metabolites. After the depletion of the intestinal flora, the antidepressant effect of PGP is significantly weakened. These findings suggest that PGP protects against chemotherapy-induced intestinal and behavioral damage by modulating the gut microbiota and gut-brain axis.

Introduction

Chemotherapy remains a cornerstone of cancer treatment; however, its clinical application is frequently associated with significant adverse effects that diminish patient quality of life and can lead to early treatment discontinuation. Among these effects, chemotherapy-induced gastrointestinal (GI) toxicity and behavioral impairments are particularly pronounced. GI toxicity manifests through symptoms such as mucosal barrier damage, diarrhea, and dysbiosis of the gut microbiota, increasing the risks of malnutrition, secondary infections, and systemic inflammation.^1,2 Concurrently, behavioral side effects—including fatigue, depression-like symptoms, anxiety, and cognitive dysfunction—collectively referred to as chemotherapy-induced behavioral impairments (CIBI), can severely impact patients’ mental health and treatment adherence. These complications underscore the urgent need for supportive therapies that mitigate these side effects without compromising chemotherapy efficacy.

In this context, food therapy has gained importance in health maintenance and disease prevention, with an increasing focus on natural bioactive compounds, particularly plant-derived polysaccharides, due to their promising therapeutic potential. These polysaccharides are recognized for their diverse bioactivities, including immunomodulatory, anti-inflammatory, antioxidant, and gut-protective effects, positioning them as essential components in medicinal foods. Over a 100 types have been identified from sources such as Ganoderma lucidum, Radix astragali, Poria cocos, and Chinese yam.^{3 -5} Extensive research has demonstrated their anti-tumor, immunomodulatory, anti-inflammatory, antioxidant, anti-aging, and gut microbiota-modulating functions.^6,7 Moreover, clinical studies indicate that polysaccharides effectively reduce chemotherapy-induced side effects, such as vomiting, diarrhea, and fatigue, highlighting their potential in advancing functional foods and therapeutic strategies. ⁸

Peach gum is a natural resin extracted from the bark of Prunus persica, a fruit-bearing tree extensively cultivated throughout Asia. For centuries, it has been employed in traditional Chinese medicine due to its detoxifying, anti-inflammatory, and wound-healing properties. ⁹ Recent pharmacological investigations have demonstrated that peach gum polysaccharide (PGP), a principal component of the resin, exhibits a variety of beneficial biological activities, including anti-inflammatory, antioxidant, and modulation of gut microbiota. ¹⁰ These diverse attributes have sparked considerable interest in the potential therapeutic applications of PGP, particularly in mitigating chemotherapy-induced adverse effects. A key physiological pathway involved in both chemotherapy-induced toxicity and related behavioral disturbances is the gut-brain axis, a bidirectional communication network that transmits signals between the central nervous system and the gastrointestinal tract. Chemotherapeutic agents can disrupt the gut-brain axis by causing intestinal barrier dysfunction, microbial dysbiosis, and systemic inflammation, which in turn can worsen cognitive impairment, anxiety, and depression. ¹¹ The diverse bioactivities of PGP, including its anti-inflammatory, mucosal regenerative, and gut microbiota-modulating properties, suggest that it may have potential in stabilizing the disrupted gut-brain axis and alleviating both gastrointestinal symptoms and chemotherapy-induced behavioral disturbances. ¹²

Despite the promising properties of PGP, its therapeutic potential in mitigating chemotherapy-induced side effects remains underexplored. This study aims to evaluate whether PGP can prevent or alleviate chemotherapy-induced gastrointestinal damage and behavioral impairments in animal models. Specifically, we examine the effect of PGP on intestinal injury phenotypes, relevant molecular markers, and behavioral degeneration in chemotherapy-treated mice. To explore the mechanisms underlying chemotherapy-induced damage to intestinal tissues and the central nervous system, we utilized transcriptome sequencing. Furthermore, we used 16S rDNA high-throughput sequencing and metabolomics to analyze alterations in species composition, abundance, and metabolites within the intestinal microbiota of chemotherapy-treated mice. This research aims to elucidate the pharmacological mechanisms of PGP in preventing chemotherapy-induced intestinal damage and associated behavioral decline, focusing on the roles of the intestinal microbiota and the central nervous system. Our findings are expected to provide valuable insights into the potential of PGP as a natural adjuvant therapy, enhancing patients’ physical and mental well-being during chemotherapy and offering a novel approach to address unmet clinical needs in cancer care.

Materials and Methods

Extraction of Polysaccharides from Peach Gum

Add a certain amount of ultra-pure water to the peach gum powder and mix well. Rehydrated at 60°C for 15 minutes, treated with high-voltage pulsed electric field, centrifuged at 4000 r/min for 15 minutes, the supernatant was taken, evaporated and concentrated by rotary evaporator, and collected for use when the supernatant was concentrated to one-fifth of the original volume. Anhydrous ethanol was added to the distilled supernatant at the ratio of 1:4 after rotary evaporation, and then precipitated for 40 minutes and kept overnight at a low temperature at 4°C. The polysaccharide components after alcohol precipitation were collected, and the upper ethanol solution after alcohol precipitation was reduced under pressure and concentrated. The above operations were repeated to collect the brown precipitate obtained by alcohol precipitation. The brown precipitates were pre-cooled at −4°C for 1 night, then frozen at −80°C for 1 night and freeze-dried. The proteins in the polysaccharides were removed using Sevag’s method and the crude polysaccharide was purified by dialysis bag, and the purity of the polysaccharides was determined to be 94% using the phenol-sulfuric acid method. Previous studies have shown that PGP is primarily composed of monosaccharides such as arabinose, galactose, xylose, mannose, and glucuronic acid. ¹³

Cell Culture

Mouse E0771 (ATCC, RRID:CVCL_GR23) breast cancer cells identified by short tandem repeat sequences (STR) were cultured in DMEM high-glucose medium containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin, and placed in a tri-gas incubator with 5% CO₂ at a constant temperature of 37°C in a humidified environment. The medium was changed every 48 hours. When the cells reached 90% confluence, they were routinely passaged, and cells in the logarithmic growth phase were used for subsequent experiments.

Animals and Drugs

Forty-five 8-week-old SPF-grade female C57BL/6 mice (RRID: IMSR_JAX:000664), weighing 19 ± 1 g, were purchased from Guangdong Charles River Laboratory Animal Technology Co., Ltd. and housed at the Center for Laboratory Animal Management, Jinan University. The Laboratory Animal Use Permit number is SCXK (Guangdong) 2022-0174. The experimental protocols were reviewed and approved by the Ethics Committee for Laboratory Animal Welfare of Jinan University, in compliance with the principles of animal protection, welfare, and ethics. The approval number for animal ethics is IACUC-20240318-02. The pirarubicin (Cat. #HY-13725) used in this study was purchased from MedChemExpress.

Establishment, Grouping and Administration of Animal Models

The method for establishing tumor-bearing animal models was adapted from our previous research. ¹⁴ After a 1-week acclimation period, 30 C57BL/6 mice were injected with 3 × 10⁵ E0771 cells into the right fourth mammary fat pad to create a tumor-bearing breast cancer model. Two weeks post-injection, the mice were randomly assigned to 1 of 3 groups: Negative Control (NC), Chemotherapy (M), or Peach Gum Polysaccharide (PGP). Intervention treatments commenced immediately after grouping. The PGP group were gavaged with PGP (400 mg/kg/day) for 10 consecutive days, while the M and PGP groups received intraperitoneal injections of pirarubicin (5 mg/kg/day) on the 3rd and 10th days post-grouping. For all other control procedures, physiological saline was used in place of the drugs. Three days before the experiment concluded, all mice were administered intraperitoneal injections of 5-ethynyl-2′-deoxyuridine (EdU; 5 mg/kg/d) for 3 consecutive days.

In the pseudo-germ-free mouse experiment, after a 1-week acclimation period, 15 C57BL/6 mice were provided with drinking water containing a mixture of 4 antibiotics: ampicillin, neomycin sulfate, metronidazole, and vancomycin. The concentration of vancomycin was 500 mg/L, while the other 3 antibiotics were each 1 g/L. The water was refreshed daily for 2 weeks. Following this, the tumor-bearing breast cancer model was established as described earlier, and the germ-free tumor-bearing mice were randomly divided into 3 groups: Germ-free Control (GF-NC), Germ-free Chemotherapy (GF-M), and Germ-free Peach Gum Polysaccharide (GF-PGP). These groups were treated according to the previously described protocols.

Behavioral Analysis

Morris Water Maze (MWM)

The Morris water maze was utilized to assess cognitive deficits in mice. This setup consisted of a circular pool, 100 cm in diameter, filled with water maintained at a constant temperature of 37°C. The pool was divided into 4 quadrants, with a platform 7 cm in diameter located at the center of the second quadrant (target quadrant), positioned 5 mm below the water surface. At the onset of training, each mouse was allotted 60 seconds to locate the submerged platform. If the platform was not found within this time frame, the experimenter placed the mouse on the platform. All mice underwent 4 training sessions per day for 5 consecutive days, during which the time taken to find the platform, referred to as the escape latency, was recorded. On the sixth day, the platform was removed to conduct the spatial probe test. Each mouse was placed in the pool at a random starting point, and both the escape latency and the number of times the mouse crossed the previous platform location within 60 seconds were recorded.

Novel Object Recognition Test (NOR)

To assess cognitive impairment in mice using a novel object recognition test, mice from each group were placed in a 40 cm × 40 cm × 40 cm behavioral chamber for 10 minutes for acclimatization. After acclimatization, the mice were returned to their original cages. The behavioral chamber was cleaned with 75% ethanol after each experiment to reduce olfactory cues. On the day of the formal experiment, mice from each group were placed in the behavioral chamber in sequential order with 2 identical objects for 10 minutes for familiarization, and then returned to their original cages. Two hours later, the mice were tested in the behavioral chamber, where 2 different objects (1 new and 1 old) were placed. The number of explorations of the new and old objects by each mouse was recorded. The cognitive index (%) was calculated as follows: Cognitive Index (%) = [Number of explorations of the new object/(Number of explorations of the new object + Number of explorations of the old object)] × 100%.

Open Field Test (OFT)

To evaluate depressive and anxious behaviors in mice using the open field test, following the methods outlined in a previous study by the team were used. ¹⁵ Mice were placed in an open field chamber (40 cm × 40 cm × 30 cm). Their spontaneous movement was recorded using a camera, and the test was conducted under dim lighting for a duration of 10 minutes. The movement trajectories were analyzed using EthoVision XT 14 software [Noldus Information Technology B.V., Beijing, China] to display the total distance traveled and the time spent in the central area (20 cm × 20 cm) as a proportion.

Sucrose Preference Test (SPT)

To evaluate depressive and anxious behaviors in mice using the sucrose preference test, the animals were first accustomed to a 2% sucrose solution. After acclimatization, the mice were deprived of drinking water for 24 hours. Two pre-weighed bottles (1 with 2% sucrose solution and 1 with tap water) were then provided for the mice to choose from over an 8-hour period. To avoid position preference, the positions of the 2 bottles were swapped after 4 hours of the experiment. The weights of the bottles before and after the exchange were recorded, and the sucrose preference rate (%) was calculated using the following formula: Sucrose Preference Rate (%) = (Sucrose consumption/(Sucrose consumption + Tap water consumption)) × 100%.

Elevated Plus-Maze (EPM)

To evaluate depressive and anxious behaviors in mice using the elevated plus maze test, mice were placed on the central platform (5 cm × 5 cm) and allowed to explore the maze freely for 5 minutes while their behavior was recorded using a camera. The maze consisted of 2 open arms (30 cm × 5 cm × 0.5 cm) and 2 closed arms (30 cm × 5 cm × 15 cm). The number of times the mouse’s head entered the open arms was analyzed using EthoVision software.

Forced Swimming Test (FST)

To evaluate depressive and anxious behaviors in mice using the forced swim test, the mice were gently placed on the surface of a cylindrical container (inner diameter 22 cm, depth 25 cm) filled with 15 cm of tap water (22°C-24°C). The mice’s behavior was recorded from the side using a camera for 6 minutes. The total immobility time, defined as the time when the mice’s movement speed was ≤1.25 cm/s, was analyzed.

Tail Suspension Test (TST)

To evaluate depressive and anxious behaviors in mice using the tail suspension test, the mice were suspended by their tails using a tail suspension apparatus. Their behavior was recorded from the side using a camera for 5 minutes. The mice’s movement speed was measured by tracking their center of mass, and the total immobility time (when the movement speed was ≤0.5 cm/s) was analyzed.

Euthanasia and Sample Collection

After the completion of drug treatment and behavioral tests, the mice were euthanized with an overdose of sodium pentobarbital (100 mg/kg, i.p.). The serum, brain tissue, colon tissue, and cecal contents were immediately collected and properly preserved for subsequent experiments.

Tissue Section Pathological Staining

Hematoxylin-Eosin (HE) Staining

Fresh colon tissue was fixed in 4% paraformaldehyde for 48 hours, followed by tissue processing, dehydration, paraffin embedding, and sectioning at 4 μm thickness using a microtome to prepare paraffin sections. The sections were deparaffinized with xylene and gradient alcohols, stained with hematoxylin for 5 seconds, differentiated with 1% hydrochloric acid-alcohol for 25 seconds, counterstained with eosin for 5 seconds, and dehydrated with gradient alcohols and xylene. The sections were then mounted with neutral resin and allowed to air dry. Structural changes were observed under a light microscope at the same tissue level.

Terminal Deoxynucleotidyl Transferase Mediated dUTP Nick-End Labeling (TUNEL)

Paraffin sections were prepared using the above method. According to a previous study by the team, ¹⁶ cells were permeabilized with a permeabilization solution at 37°C for 8 minutes, washed with PBS 3 times for 3 minutes each, treated with proteinase K at 37°C for 20 minutes, and washed with PBS 3 times for 3 minutes each. Then, TDT and dUTP mixture (1:9) was added and incubated at 37°C for 1 hour, followed by PBS washing 3 times for 3 minutes each. Sections were then mounted with a fluorescence mounting medium containing DAPI. Structural changes were observed under a fluorescence microscope at the same tissue level.

5-Ethynyl-2′-deoxyuridine (EdU) Staining

Paraffin sections were prepared using the above method. EdU staining was performed using the BeyoClick™ EdU-555 Cell Proliferation Kit (Cat. #C0071S, Beyotime Biotechnology, Shanghai, China). Structural staining changes were observed under a fluorescence microscope at the same tissue level.

Transmission Electron Microscopy (TEM)

Fresh colon tissue tissue was fixed in 2.5% glutaraldehyde for 4 hours, followed by 3 washes in 0.01 M PBS, each lasting 15 minutes. Subsequently, the tissue was fixed in 1% osmium tetroxide for 2 hours, washed again with 0.01 M PBS, and dehydrated through a graded acetone series. The samples were infiltrated with Epon812 resin and embedded, followed by polymerization at 37°C for 6 hours, 45°C for 12 hours, and 63°C for 24 hours to prepare electron microscopy specimens. Ultrathin sections of 70 nm were prepared, stained with uranyl acetate and lead citrate, and examined under a transmission electron microscope to observe the ultrastructure of colon tissue in each group.

Immunohistochemistry (IHC) Staining

Paraffin sections were prepared using the above method. Sections were deparaffinized with xylene and gradient alcohols, followed by antigen retrieval in an antigen retrieval solution. They were washed with PBS 3 times for 5 minutes each, and incubated with primary antibodies: anti-occludin (1:200; Cat. #91131T; RRID:AB_2934013; Cell Signaling Technology), anti-claudin-1 (1:100; Cat. #ab307692; RRID:AB_3083082; Abcam), and anti-ZO-1 (1:250; Cat. #ab276131; RRID:AB_3083081; Abcam) at 4°C overnight. The next day, sections were washed with PBS 3 times for 5 minutes each, incubated with secondary antibodies at 37°C for 40 minutes, and washed with PBS 3 times for 5 minutes each. The sections were then stained with DAB for 1 minute, rinsed with water for 3 minutes, counterstained with hematoxylin for 10 seconds, and dehydrated with gradient alcohols and xylene. They were mounted with neutral resin. Structural staining changes were observed under a light microscope at the same tissue level.

mRNA Sequencing Data Acquisition and Analysis

Transcriptomic expression profile data of intestinal tissue after doxorubicin chemotherapy were obtained from the ArrayExpress database (Accession number E-MTAB-11297). Transcriptomic expression profile data of hippocampal tissue after doxorubicin chemotherapy were obtained from the Gene Expression Omnibus (GEO) database (Accession number GSE236404). Subsequent analysis and plotting were performed using the Omicshare cloud platform.

Western Blotting (WB) Analysis

Total protein was extracted from intestinal and hippocampal tissues using RIPA buffer and quantified using a BCA Protein Assay Kit. After electrophoresis, proteins were transferred to PVDF membranes and blocked with 5% non-fat milk in TBS for 2 hours at room temperature. The membranes were incubated overnight at 4°C with primary antibodies, including anti-HSPA5 (1:1000; Cat. #11587-1-AP; RRID:AB_2119855; Proteintech), anti-p53 (1:1000; Cat. #32532S; RRID:AB_2757821; Cell Signaling Technology), anti-Cleaved Caspase-7 (1:1000; Cat. #9491S; RRID:AB_2068144; Cell Signaling Technology), anti-Caspase-12 (1:1000; Cat. #58208S; RRID is not applicable; Cell Signaling Technology), anti-Cleaved Caspase-3 (1:1000; Cat. #9664T; RRID:AB_2070042; Cell Signaling Technology), anti-Toll-like Receptor 4 (TLR4; 1:2000; Cat. #14358S; RRID:AB_2798460; Cell Signaling Technology), anti-NF-κB p65 (NF-κB; 1:2000; Cat. #8242S; RRID:AB_10859369; Cell Signaling Technology), anti-NLRP3 (1:1000; Cat. #15101S; RRID:AB_2722591; Cell Signaling Technology), and anti-GAPDH (1:1000; Cat. #2118T; RRID:AB_561053; Cell Signaling Technology). The membranes were subsequently incubated with secondary antibodies (1:5000) for 2 hours at room temperature. Protein bands were visualized using chemiluminescent substrates and analyzed with ImageJ software through a multifunctional imaging system.

Real Time-Quantitative Polymerase Chain Reaction (RT-qPCR)

Primers were designed using Primer Premier 5.0 software (Table 1). Total RNA extracted from mouse intestinal tissues was reverse-transcribed into cDNA using the FastQuant RT Kit, and real-time quantitative PCR was then performed with the SuperReal PreMix Plus (SYBR Green) Kit. The 20 µL PCR reaction mixture contained: 10.0 µL of 2× SuperReal Premix, 0.4 µL of 50× ROX Reference Dye, 0.6 µL of forward and reverse primers (10 µmol/L each), 1.0 µL of cDNA (200 ng/µL), and 7.4 µL of ddH₂O. PCR cycling conditions were as follows: 95°C for 15 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 32 seconds. Each sample was run in triplicate. Relative gene expression levels were calculated using the 2^−ΔΔCt method.

Table 1.

Primer Sequence Information.

Genes	Primer sequences (5′ → 3′)	Product length (bp)
IL-1β	F: GTGGCAGCTACCTGTGTCTT	164
	R: GGAGCCTGTAGTGCAGTTGT
IL-6	F: GCCTTCTTGGGACTGATGCT	99
	R: GACAGGTCTGTTGGGAGTGG
TNF-α	F: GACGTGGAACTGGCAGAAGA	192
	R: ACTGATGAGAGGGAGGCCAT
β-actin	F: CCACCATGTACCCAGGCATT	189
	R: CGGACTCATCGTACTCCTGC

Enzyme-Linked Immunosorbent Assay (ELISA)

ELISA kits specific to mouse LPS (Cat. #MM-0634M1, MEIMIAN, Jiangsu, China), mouse IL-1β (Cat. #PI301, Beyotime, Shanghai, China), mouse IL-6 (Cat. #PI326, Beyotime, Shanghai, China), and mouse TNF-α (Cat. #PT512, Beyotime, Shanghai, China) were used to measure the concentrations of inflammation-related factors in mouse intestinal tissue and serum, following the manufacturer’s protocols.

16S rDNA Sequencing and Metabolomics Analysis

Colon tissues from each group of mice were collected, and cecal contents were collected into sterile EP tubes and stored at −80°C, then transported on dry ice. 16S rDNA sequencing and metabolomics analysis were conducted by Novogene Co., Ltd. Beijing. Subsequent analysis and plotting were performed on the Novogene cloud platform.

Statistical Analysis

Statistical analyses were performed using SPSS 13.0 software. Experimental results were expressed as mean ± standard deviation (SD). For comparisons among multiple groups, homogeneity of variance was first tested, followed by one-way ANOVA. Pairwise comparisons were conducted using LSD test; for unequal variances, Dunnett’s T3 test was used. Statistical significance was set at P < .05.

Results

Effects of PGP on Pirarubicin-Induced Intestinal Damage

The appearance of the colon in mice is shown in Figure 1A. Compared to the NC group, the colon length in the chemotherapy group was significantly reduced. Preventive administration of PGP partially reversed this chemotherapy-induced colon shortening. Histological examination of the colon using HE staining, as shown in Figure 1B, revealed normal colonic morphology in the NC group, characterized by abundant intestinal glands, well-defined crypt structures, and intact mucosal layers. In contrast, the M group exhibited deeper and more loosely arranged crypts, a marked reduction in goblet cells within epithelial cells, focal mucosal erosion, and mild lymphocyte infiltration. Following treatment with PGP, the mucosal layer of the colon was preserved, with an increase in goblet cells and no lymphocyte infiltration. Tunel staining results presented in Figure 1C indicate a significant increase in the area of positive staining in the chemotherapy group compared to the NC group. However, treatment with PGP resulted in a significant reduction in this positive staining area. EdU staining results depicted in Figure 1D demonstrated that PGP significantly enhanced intestinal repair, as evidenced by a marked increase in the positive staining area. IHC staining for mucosal barrier-related proteins, shown in Figure 1E, revealed reduced expression levels of ZO-1, Occludin, and Claudin-1 in the chemotherapy group compared to the NC group. These protein levels were restored following treatment with PGP. TEM observations of the colon tissue, as illustrated in Figure 1F, showed disorganized ultrastructural arrangement and disrupted mitochondrial cristae in the M group. PGP effectively prevented the structural damage caused by chemotherapy.

Figure 1.

Pathological changes of colonic morphology in mice. (A) Colonic tissue appearance morphology. (B) HE staining; scale bar = 200 μm. (C) Tunel; scale bar = 200 μm. (D) EdU staining; scale bar = 100 μm. (E) IHC staining; scale bar = 400 μm. (F) TEM; scale bar = 2 μm or 750 nm.

Effects of Chemotherapy on mRNA Expression in Intestinal Tissue and Enrichment Analysis of Differentially Expressed Genes

We retrieved data on the mRNA changes of human intestinal organoids after chemotherapy with doxorubicin (an anthracycline) from publicly available databases and performed an analysis. Differential analysis revealed that after doxorubicin treatment, 480 transcripts in the intestinal organoids were upregulated, while 426 were downregulated (Figure 2A). A protein-protein interaction analysis of the differentially expressed transcripts identified GAPDH, UBC, HSP90AB1, RPS3, EEF2, ENO1, HSPA5, RACK1, RPS9, and EEF1A1 as the hub genes with the highest degree values (Figure 2B). GO enrichment analysis of the differentially expressed genes revealed significant enrichment in biological processes such as cytoplasmic translation, apoptosis, cell death, and programed cell death (Figure 2C). KEGG pathway enrichment analysis of the differentially expressed genes showed significant enrichment in the p53 signaling pathway and metabolic pathways (Figure 2D). Furthermore, an organ system analysis revealed significant enrichment in the immune system (Figure 2E). Based on the differential gene expression analysis, we performed Western Blot validation to assess the effects of PGP on HSPA5/p53/ER apoptosis. The results showed that after pirarubicin treatment, the ER stress marker HSPA5 significantly increased in the intestinal tissue, accompanied by elevated levels of ER apoptosis proteins, including p53, Cleaved Caspase-7, Cleaved Caspase-12, and Cleaved Caspase-3. However, PGP effectively prevented the alterations in apoptotic proteins induced by pirarubicin-mediated ER stress (Figure 2F).

Figure 2.

Effect of PGP on the endoplasmic reticulum apoptosis in intestinal tissue induced by pirarubicin. (A) Volcano map of differentially expressed genes. (B) Protein-protein interaction analysis of differentially expressed genes. (C) GO enrichment analysis (Biological Process). (D and E) KEGG pathway enrichment analysis. (F) Western blot and protein relative expression statistics of intestinal tissues.

**P < .01 and ***P < .001 indicate comparison with the NC group; ^##P < .01 and ^###P < .001 indicates comparison with the M group; n = 3.

Effects of PGP on Pirarubicin-Induced Intestinal Inflammation and Serum Inflammation

Intestinal tissue damage is a major risk factor for inducing systemic inflammation. Therefore, we assessed the mRNA expression of inflammatory factors in colonic tissue. The results showed that pirarubicin chemotherapy significantly increased the mRNA expression of IL-1β, IL-6, and TNF-α in the intestinal tissue, while PGP effectively reduced the mRNA expression of these inflammatory factors (Figure 3A and B). Additionally, we measured the levels of inflammatory mediators in the intestinal tissue and serum using ELISA. The results showed that pirarubicin chemotherapy significantly increased the levels of LPS, IL-1β, IL-6, and TNF-α in both intestinal tissue and serum, whereas treatment with PGP significantly reduced the elevated levels of these inflammatory mediators (Figure 3C-I).

Figure 3.

The effect of PGP on pirarubicin-induced inflammation in intestinal tissue and serum. (A) mRNA expression levels in intestinal tissue; (B) LPS levels in intestinal tissue; (C) LPS levels in serum; (D-F) Inflammatory mediator levels in intestinal tissue; (G-I) Inflammatory mediator levels in serum.

**P < .01 and ***P < .001 indicate comparison with the NC group; ^##P < .01 and ^###P < .001 indicates comparison with the M group; n = 3.

Effects of PGP on Pirarubicin-Induced Degenerative Behavior

A high inflammatory state in the serum typically induces regressive behaviors such as cognitive impairment and depression. Compared with the NC group, the M group mice showed a significantly prolonged escape latency and a reduced number of platform crossings in the Morris water maze test (Figure 4A and B). The cognitive index in the novel object recognition test also decreased significantly (Figure 4C). In the open field test, the total distance traveled and time spent in the central zone were significantly reduced (Figure 4D and E). In the sucrose preference test, the preference ratio for sucrose decreased significantly (Figure 4F). The number of entries into the open arms in the elevated plus-maze test was reduced (Figure 4G). Additionally, the immobility time in the forced swim and tail suspension tests increased significantly (Figure 4H and I). Preventive treatment with PGP resulted in a significant improvement in these behavioral indicators compared to the M group. Behavioral changes are usually caused by alterations in the brain. Therefore, we attempt to link behavioral changes to alterations in brain tissue.

Figure 4.

Behavioral changes in mice. (A and B) Morris water maze. (C) Novel object recognition test. (D and E) Open field test. (F) Sucrose preference test. (G) Elevated plus-maze. (H) Forced swimming test. (I) Tail suspension test.

^ns*P > 0.05, *P < .05, **P < .01, and ***P < .001 versus NC group; ^##P < .01 and ^###P < .001 versus M group; n = 6.

Effects of PGP on Chemotherapy-Induced Hippocampal Damage

The hippocampal tissue in the brain plays a crucial role in memory formation and emotional regulation. Therefore, we obtained and analyzed data on mRNA changes in the hippocampus following chemotherapy with pirarubicin analogs (doxorubicin) from publicly available databases. Differential analysis showed that doxorubicin treatment led to the upregulation of 558 transcripts and downregulation of 645 transcripts in the hippocampus (Figure 5A). Protein-protein interaction analysis of differentially expressed transcripts identified the proteins with the highest degree values (hub genes) as Stat3, Cdc42, Hif1a, Itgad, Kdr, Stat1, Csf1r, Ccnd1, Myc, and Pwp2 (Figure 5B). GO enrichment analysis of the differentially expressed genes indicated enrichment in biological processes such as signal regulation, cell surface receptor signaling pathways, response to stimuli, and nervous system development (Figure 5C). KEGG pathway enrichment analysis revealed enrichment in pathways including cytokine-receptor interactions, NOD-like receptor signaling, Toll-like receptor signaling, and NF-κB signaling (Figure 5D). Furthermore, environmental information processing analysis revealed significant enrichment in signal transduction and signaling molecule interactions, while organ system analysis indicated significant enrichment in the immune system (Figure 5E). Based on the differential gene expression analysis results, we used Western blotting to validate the effect of PGP on the LPS-activated TLR4/NF-κB/NLRP3 inflammasome pathway. Results showed that pirarubicin treatment significantly activated the inflammasome pathway in the hippocampus, while PGP effectively prevented the associated protein changes induced by pirarubicin (Figure 5F).

Figure 5.

Effect of PGP on pirarubicin-induced hippocampal inflammatome. (A) Volcano map of differentially expressed genes. (B) Protein-protein interaction analysis of differentially expressed genes. (C) GO enrichment analysis (Biological Process). (D and E) KEGG pathway enrichment analysis. (F) Western blot and protein relative expression statistics of hippocampal tissues.

*P < .05 and **P < .01 indicate comparison with the NC group; ^#P < .05 and ^##P < .01 indicates comparison with the M group; n = 3.

Quality Assessment of Gut Microbiota Sequencing and α-Diversity Analysis

The therapeutic effects of plant polysaccharides are often related to their ability to modulate gut microbiota. Therefore, we randomly selected 6 mice from each group to analyze their gut microbiota samples using 16S rDNA sequencing to assess changes in microbial diversity and structure. The Shannon and Simpson indices are commonly used to evaluate species diversity, while the Chao1 index is a non-parametric method for assessing species richness. As shown in Figure 6A to C, the rarefaction curves for each group initially steeply increase and then level off, indicating that the sequencing depth is sufficient to reflect the diversity of the gut microbiota, with PGP significantly enhancing microbial diversity and richness. The rank abundance curve is a common method for assessing microbial evenness, while the species accumulation curve is used to evaluate the adequacy of sample size. As shown in Figure 6D and E, the rank abundance curve indicates a relatively even species distribution, and the species accumulation curve levels off at the end, suggesting that the sample size is adequate and the data quality is high. The Venn diagram reflects the number of shared and unique operational taxonomic units (OTUs) among groups and the similarity of sample community composition. As shown in Figure 6F, there are 481 overlapping OTUs among the 3 groups, with 145, 180, and 285 OTUs unique to the NC, M, and PGP groups, respectively.

Figure 6.

Quality evaluation and α diversity analysis of 16S rDNA sequencing. (A) Shannon index. (B) Simpson index. (C) Chao1 index. (D) Rank abundance curve. (E) species accumulation curves. (F) Venn diagrams of OTUs in each group.

n = 6.

Analysis of Gut Microbiota Structural Differences and β-Diversity

β-Diversity is used to further evaluate microbial composition differences between groups. Principal components analysis (PCA), principal coordinates analysis (PCoA), and non-metric multidimensional scaling (NMDS) are common methods for visualizing β-diversity. The distance between samples is inversely related to the similarity of microbial community composition, meaning that closer sample points indicate more similar species compositions. As shown in Figure 7A, compared to the NC group, the M group shows significant shifts in both PCoA1 and PCoA2 axes, indicating substantial changes in the gut microbiota structure and composition. In contrast, the PGP group more closely resembles the NC group in PCoA1 and PCoA2, suggesting that the polysaccharide treatment resulted in significant changes to the overall gut microbiota structure. NMDS analysis and PCoA results are consistent with the PCA trends (Figure 7B and C). Further LEfSe analysis (Figure 7D and E) identified significant differential taxa at the genus level among the groups. The results show that the key characteristic genera in the NC group are DNF00809, Prevotellaceae_NK3B31_group, and Eubacterium brachy_group; in the M group, they are Halomonas, Halomonadaceae, and Lachnospiraceae_UCG_001; and in the PGP group, they are Spirochaetaceae, Spirochaetota, and Spirochaetia. Compared to the NC and M groups, the PGP group has a significantly higher number of characteristic genera. At the class level, as shown in Figure 7F, Bacteroidia and Clostridia are the predominant classes. Compared to the NC group, the relative abundance of Bacteroidia in the M group is significantly reduced, while the relative abundance of Bacilli is significantly increased. The PGP treatment significantly reverses these changes. At the order level, as shown in Figure 7G, Bacteroidales and Lachnospirales are predominant. Compared to the NC group, the relative abundance of Bacteroidales is significantly reduced, while the relative abundance of Lactobacillales is significantly increased. Similarly, the polysaccharide treatment significantly reverses these changes. At the family level, as shown in Figure 7H, Lachnospiraceae and an unidentified Muribaculaceae are predominant. Compared to the NC group, the relative abundance of the unidentified Muribaculaceae is significantly reduced, while the relative abundance of Lactobacillaceae is significantly increased. The PGP treatment significantly reverses these changes. Notably, PGP enhances microbiota diversity and evenness at the class, order, and family levels (Figure 7F-H).

Figure 7.

Analysis of intestinal microbial cluster structure. (A) PCA analysis. (B) PCoA analysis. (C) NMDS analysis. (D) LDA column chart of LEFSe analysis. (E) Cladograms of LEFSe analysis. (F) Top 10 class level changes of intestinal microbiota. (G) Top 10 Order level changes of intestinal microbiota. (H) Top 10 family level changes of intestinal microbiota.

n = 6.

Screening and Enrichment Analysis of Potential Differential Metabolites

Changes in the gut microbiota influence systemic physiology by altering gut metabolites. Metabolomic analysis of intestinal contents showed that both pirarubicin chemotherapy and PGP affected gut metabolite composition (Figure 8A and E). In positive ion mode, compared to the NC group, 58 metabolites were elevated and 75 were decreased in the M group; in the PGP group, 110 metabolites were elevated and 33 were decreased relative to the M group (Figure 8B and C), with 19 metabolites showing reversal after PGP treatment (Figure 8D). In negative ion mode, 85 metabolites were elevated and 17 were decreased in the M group compared to the NC, while 70 metabolites were elevated and 31 were decreased in the PGP group relative to the M group (Figure 8F and G), with 12 metabolites showing reversal following PGP treatment (Figure 8H). Heatmaps comparing metabolite levels between the NC and M groups are shown in Figure 8I. KEGG pathway enrichment analysis indicated that differential metabolites between the 2 groups were enriched in pathways related to alanine, aspartate, and glutamate metabolism as well as long-term depression (Figure 8J). Heatmaps comparing metabolite levels between the M and PGP groups are shown in Figure 8K, with KEGG analysis revealing enrichment in cholinergic synapse and D-glutamine and D-glutamate metabolism pathways (Figure 8L).

Figure 8.

Analysis of gut microbial metabolites. (A) PLS-DA analysis of metabolites in positive ion mode; (B and C) Volcano plots of metabolites in positive ion mode; (D) Upset plot of differential metabolites in positive ion mode; (E) PLS-DA analysis of metabolites in negative ion mode; (F and G) Volcano plots of metabolites in negative ion mode; (H) Upset plot of differential metabolites in negative ion mode; (I and J) Heatmap of metabolite abundance and KEGG pathway enrichment analysis for differential metabolites between the NC and (M) groups; (K and L) Heatmap of metabolite abundance and KEGG pathway enrichment analysis for differential metabolites between the M and PGP groups.

n = 6.

Depletion of Gut Microbiota Attenuates the Therapeutic Effects of PGP

To further validate that PGP reverse chemotherapy-induced regressive behaviors through the modulation of gut microbiota, we depleted the gut microbiota in mice and reassessed their behavioral changes. The results demonstrated that, following gut microbiota depletion, the ability of PGP to prevent chemotherapy-induced regressive behaviors was substantially reduced compared to mice with intact gut microbiota (Figure 9A-I).

Figure 9.

Behavioral changes in pseudo-germ-free mice. (A and B) Morris water maze; (C) Novel object recognition test; (D and E) Open field test; (F) Sucrose preference test; (G) Elevated plus maze test; (H) Forced swim test; (I) Tail suspension test. Statistical significance is indicated as follows: ***P < .001 (compared to GF-NC group); ^ns#P > .05, ^#P < .05, and ^##P < .01 (compared to GF-M group); n = 5.

Discussion

Natural polysaccharides have emerged as promising therapeutic agents due to their diverse biological activities and excellent safety profiles.^17,18 Recent advances in glycobiology have revealed that polysaccharides can modulate various cellular processes through specific receptor-mediated interactions and complex signaling networks. ¹⁹ Particularly, accumulated evidence suggests that bioactive polysaccharides exhibit remarkable potential in maintaining gut homeostasis and preventing various pathological conditions through sophisticated mechanisms involving microbiota modulation and immune regulation.^19,20 While numerous polysaccharides have demonstrated protective effects against various diseases, the potential of PGP, which has good biocompatibility and food safety, ¹² in preventing chemotherapy-induced intestinal injury and subsequent behavioral disorders remains largely unexplored. In this comprehensive study, we demonstrated that PGP administration significantly ameliorated chemotherapy-induced intestinal barrier dysfunction, attenuated both local and systemic inflammation, restored gut microbiota homeostasis, and prevented behavioral disorders. More importantly, we uncovered novel molecular mechanisms involving ER stress-mediated apoptosis, TLR4/NF-κB/NLRP3 inflammasome signaling, and microbiota-dependent metabolic regulation, which collectively contribute to the therapeutic effects of PGP.

The integrity of the intestinal barrier, a complex and dynamic structure, is maintained through sophisticated molecular interactions, particularly involving tight junction proteins and cellular stress response mechanisms. ²¹ Our detailed ultrastructural and molecular analyses revealed that chemotherapy disrupted intestinal barrier function through multiple interconnected mechanisms. Initially, transmission electron microscopy demonstrated severe ultrastructural damage, including distinctive mitochondrial cristae disruption, tight junction disassembly, and cellular architectural perturbations, which were effectively prevented by PGP pretreatment. This remarkable protective effect likely involves the maintenance of mitochondrial function and energy homeostasis, as previous studies have shown that specific polysaccharides can preserve mitochondrial membrane potential and reduce oxidative stress through direct interaction with mitochondrial membrane components. ²² Furthermore, our molecular analysis revealed significant downregulation of critical tight junction proteins (ZO-1, Occludin, and Claudin-1) following chemotherapy, which was substantially restored by PGP treatment. This restoration process appears to be mediated through the activation of AMPK signaling pathways, as recent research has demonstrated that AMPK phosphorylation can enhance tight junction protein expression through direct regulation of their transcription factors and post-translational modifications. ²³

Mechanistically, our comprehensive transcriptome analysis of intestinal organoids revealed a central and previously unrecognized role of endoplasmic reticulum (ER) stress in chemotherapy-induced intestinal injury. The significant upregulation of HSPA5, a key molecular chaperone and ER stress marker, was accompanied by systematic activation of the unfolded protein response (UPR) pathway, as evidenced by increased phosphorylation of PERK and IRE1α signaling components. ²⁴ PGP treatment effectively suppressed these ER stress markers and downstream apoptotic signaling cascades, including p53 and various caspase family members. This protective mechanism likely involves direct modulation of the PERK-eIF2α-ATF4 signaling axis, as recent groundbreaking studies have demonstrated that specific polysaccharide structures can regulate this pathway through precise glycan-receptor interactions and subsequent signal transduction events. ²⁵ Furthermore, the prevention of ER stress-induced apoptotic cascades by PGP may be mediated through concurrent activation of the PI3K/Akt survival pathway, which has been extensively documented to counteract p53-dependent apoptotic processes in intestinal epithelial cells through multiple molecular mechanisms. ²⁶

The molecular signaling networks underlying PGP’s protective effects demonstrate remarkable complexity and interconnectivity. Our investigations revealed that the AMPK pathway, a fundamental regulator of cellular energy metabolism and stress responses, was significantly activated following PGP treatment. This AMPK activation has been shown to enhance cellular autophagy processes through direct phosphorylation of ULK1 and concurrent inhibition of mTOR signaling cascades, potentially contributing to the efficient clearance of damaged cellular components during chemotherapy-induced stress. ²⁷ Of particular significance, AMPK activation promotes the nuclear translocation of Nrf2, a master transcription factor regulating antioxidant responses and cellular defense mechanisms. ²⁸ This newly identified AMPK-Nrf2 signaling axis may provide a molecular explanation for the observed reduction in oxidative stress markers in PGP-treated experimental subjects.

The gut-brain axis, representing an intricate bidirectional communication network, encompasses complex neural, immune, and endocrine pathways that facilitate constant information exchange between the gastrointestinal system and central nervous system. ²⁹ Our comprehensive study revealed that chemotherapy-induced intestinal injury led to significant behavioral alterations through multiple interconnected mechanisms. Initial transcriptome analysis of hippocampal tissue demonstrated pronounced activation of the TLR4/NF-κB/NLRP3 inflammasome pathway, suggesting that peripheral inflammatory signals can trigger neuroinflammatory responses through this sophisticated signaling cascade. This novel finding aligns with recent research demonstrating that compromised intestinal barrier function can activate brain TLR4 signaling through circulating bacterial products and damage-associated molecular patterns. ³⁰ Notably, PGP treatment effectively suppressed this inflammatory cascade, potentially through direct inhibition of TLR4-mediated NF-κB activation, as comprehensively supported by our Western blot analyses and recent studies examining polysaccharide-TLR4 interactions. ³¹

Recent advances in understanding gut-brain communication have revealed previously unrecognized mechanisms involving both neural and humoral pathways. The discovery of specific neural circuits connecting the enteric nervous system to the brain via vagal afferents has shed light on how intestinal signals influence behavioral responses. ³² These circuits are highly responsive to neurotransmitters and metabolites produced by the gut microbiota, including γ-aminobutyric acid (GABA), serotonin, and short-chain fatty acids (SCFAs). ³³ Our metabolomic analysis demonstrated that PGP treatment significantly modulated these neuroactive compounds, particularly enhancing pathways related to D-glutamine and D-glutamate metabolism. Glutamate, a key excitatory neurotransmitter involved in synaptic plasticity and neuroinflammation, is often dysregulated in depression and other neuropsychiatric disorders. ³⁴ By altering microbial taxa capable of producing or metabolizing glutamate and related compounds, PGP may rebalance gut-derived signaling molecules, thereby positively influencing gut-brain communication and associated behavioral outcomes.

The regulation of metabolic pathways by PGP demonstrates remarkable complexity and nutritional significance. Our detailed untargeted metabolomics analysis revealed comprehensive changes in both primary and secondary metabolites, particularly affecting bioactive compounds with potential nutraceutical properties. Of particular interest, we observed significant modulation in sphingolipid metabolism, especially concerning ceramide synthesis pathways. Ceramides have recently been identified as crucial bioactive lipids mediating cellular stress responses and inflammatory processes in the context of nutritional intervention. ³⁵ PGP treatment effectively normalized ceramide profiles in both intestinal tissue and hippocampus, potentially through modulation of sphingomyelinase activity, suggesting a novel mechanism by which dietary polysaccharides can influence lipid metabolism and cellular homeostasis.

Building upon the normalization of ceramide profiles, our findings also emphasize the critical role of gut microbiota in mediating these effects. Dysbiosis in the M group was characterized by an overrepresentation of pro-inflammatory taxa, such as Lactobacillales, and a reduction in beneficial taxa, including Bacteroidales and Lachnospiraceae, which are associated with anti-inflammatory and gut-barrier-protective effects. These shifts likely contributed to intestinal barrier dysfunction, leading to enhanced translocation of lipopolysaccharides (LPS) and systemic inflammation—a known driver of regressive behaviors. ³⁶ PGP treatment effectively restored the balance of these microbial communities, enhancing the abundance of SCFA-producing taxa such as Bacteroidia. SCFAs, including butyrate and acetate, have been shown to strengthen tight junction integrity in intestinal epithelial cells and suppress the activation of nuclear factor-kappa B (NF-κB), a key regulator of inflammatory signaling. ³⁷ This reduction in intestinal permeability and systemic inflammation may underlie the observed improvements in depressive-like behaviors and cognitive function.

Furthermore, our metabolomic profiling revealed significant alterations in amino acid metabolism and their derivatives, with particular emphasis on tryptophan metabolic pathways. PGP treatment significantly enhanced the production of various bioactive tryptophan metabolites, including kynurenic acid and indole derivatives. ³⁸ These metabolic changes are particularly relevant from a nutritional perspective, as tryptophan metabolites have been increasingly recognized as important mediators in the diet-gut-brain axis. ³⁹ Additionally, our pathway analysis identified significant enrichment in the metabolism of several essential nutrients, including branched-chain amino acids and polyunsaturated fatty acids, suggesting that PGP might exert its protective effects partially through optimization of nutrient utilization and energy metabolism.

The indispensable role of gut microbiota in mediating PGP’s therapeutic effects was conclusively demonstrated through systematic antibiotic depletion experiments, which significantly attenuated its protective outcomes. This underscores PGP’s potential as a novel prebiotic compound, likely acting through structure-dependent interactions that promote the growth of beneficial bacteria. Our comprehensive 16S rDNA sequencing analysis revealed that PGP intervention significantly enhanced the abundance of SCFA-producing species, including Faecalibacterium, Roseburia, and Bifidobacterium, which are well-documented producers of butyrate and other bioactive metabolites.^40,41 These SCFAs, through mechanisms involving G-protein coupled receptor activation and tight junction protein regulation, have been shown to enhance intestinal barrier integrity and modulate systemic inflammation. ⁴² Furthermore, microbiota-derived metabolites such as indole derivatives and SCFAs can cross the gut-brain axis, influencing microglial activity and mitigating neuroinflammation.^43,44 By restoring microbial diversity and metabolic function, PGP appears to exert multifaceted effects, addressing both localized intestinal health and systemic signaling pathways essential for reversing regressive behaviors.

The intricate molecular interactions between PGP, gut microbiota, and host metabolism warrant further comprehensive investigation. First, the specific structural features of PGP that mediate its interactions with microbial enzymes and host receptors should be systematically characterized using advanced glycomic approaches. This could involve the application of targeted enzymatic degradation combined with high-resolution mass spectrometry to identify bioactive oligosaccharide fragments and their specific biological functions. ⁴⁵ Second, the role of specific bacterial species in metabolizing PGP and producing neuroactive compounds requires detailed investigation using gnotobiotic animal models and sophisticated metabolic tracing techniques. ⁴⁶

The molecular mechanisms linking intestinal metabolites to behavioral changes deserve particular attention in future investigations. Advanced neuroscience techniques, including cell-specific genetic manipulation and optogenetic approaches, should be employed to delineate the specific neural circuits influenced by gut-derived signals. ⁴⁷ Additionally, the potential synergistic effects between PGP and other therapeutic agents, particularly those targeting neuroinflammation or oxidative stress, warrant systematic evaluation. ²⁹

Several emerging research directions deserve particular attention in future investigations: (1) The role of extracellular vesicles, including exosomes, in mediating PGP’s effects on distant organs, particularly focusing on their cargo of regulatory molecules and metabolites. ⁴⁸ (2) The impact of natural polysaccharides supplementation on circadian rhythms and metabolic oscillations, which have recently been shown to significantly influence both intestinal and brain function. ⁴⁹ (3) The potential epigenetic modifications induced by PGP treatment, particularly examining long-term neuroprotective effects and transgenerational impacts. ⁵⁰ (4) The development of advanced delivery systems to enhance PGP’s therapeutic efficacy and target specificity. ⁵¹

Of particular significance for future therapeutic applications, the development of structure-optimized PGP derivatives could enhance its beneficial effects. This might involve systematic structure-activity relationship studies to identify the most potent structural features for specific therapeutic outcomes. Additionally, the potential for personalized therapeutic approaches based on individual microbiota compositions and metabolic profiles should be explored, as recent research has highlighted significant inter-individual variations in responses to dietary interventions. ⁵²

Conclusions

In this study, we demonstrated that PGP effectively protects against chemotherapy-induced intestinal injury and subsequent behavioral disorders through maintaining intestinal barrier integrity, modulating ER stress-apoptosis pathways, and suppressing inflammation via the TLR4/NF-κB/NLRP3 inflammasome pathway. The protective effects of PGP were closely associated with its ability to regulate host-microbial metabolism and enhance beneficial gut microbiota, highlighting its potential as a therapeutic agent for preventing chemotherapy-induced complications through gut-brain axis modulation (Figure 10).

Figure 10.

Schematic illustration of the potential underlying mechanism by which PGP prevents chemotherapy-induced intestinal injury and degenerative behavior.