Skip to main content
Cell Communication and Signaling : CCS logoLink to Cell Communication and Signaling : CCS
. 2025 Aug 25;23:380. doi: 10.1186/s12964-025-02381-y

African swine fever virus A179L inhibits interferon induced transmembrane protein 1 activation of NF-κB pathway

Xiamei Sun 1,#, Liqi Zhu 1,#, Chunxiao Mou 1, Jinyu Zhao 1, Yun Young Go 5, Kaichuang Shi 4, Zhenhai Chen 1,2,3,
PMCID: PMC12376476  PMID: 40855449

Abstract

African swine fever virus (ASFV) encodes over 150 viral proteins, several of which have roles in evading innate immune responses. Among these, A179L is the only Bcl-2-like protein involved in ASFV-induced apoptosis, but its other functions remain poorly understood. This study found that A179L inhibits the NF-κB signaling pathway, reducing the production of pro-inflammatory cytokines. Mechanistically, A179L was found to interact with Interferon Induced Transmembrane Protein 1(IFITM1), leading to enhanced recruitment of MARCH8 to IFITM1 and degradation of IFITM1 by K48 ubiquitination, thereby suppressing NF-κB activation. Interestingly, it was observed for the first time that IFITM1 can activate the NF-κB signaling pathway by interacting with IKKβ and promoting its phosphorylation. Additionally, inhibiting A179L gene expression in ASFV-infected cells via RNA silencing increased the transcription levels of tumor necrosis factor-α and interleukin-1β. Subsequently, a recombinant ASFV strain, ASFV-ΔA179L, was generated by knocking out the A179L gene from the virus genome. The results demonstrated that ASFV-ΔA179L enhanced the expression of pNF-κB and pro-inflammatory cytokines. The findings of this study suggest a novel mechanism through which A179L inhibits the NF-κB signaling pathway by degrading IFITM1.

Keywords: ASFV A179L, Interferon induced transmembrane protein 1(IFITM1), NF-kappa b (NF‐κB), Immune evasion, Innate immunity

Introduction

African swine fever (ASF), caused by the African swine fever virus (ASFV), is classified as a notifiable disease by the World Organization for Animal Health. It was initially described in East Africa (Kenya Colony) in 1921. Since then, the disease has become widespread throughout Africa, Europe, and Asia. In August 2018, ASF was first reported in China and rapidly spread across the country in the following months [1]. Despite extensive research efforts to develop ASF vaccines and antiviral drugs, no effective and safe commercial products are available, posing a significant challenge to global ASF prevention.

The ASFV is a complex, double-stranded linear DNA virus with icosahedral symmetry. Its genome ranges from 170 to 193 kb and encodes approximately 160 viral proteins [2, 3]. Previous studies have demonstrated that ASFV infection induces severe immunosuppression in its natural hosts, facilitating viral replication and infection establishment, ultimately leading to severe disease in pigs [46]. ASFV modulates host immune responses through various mechanisms, notably by regulating type I interferons (IFN-I) and inflammatory pathways [7]. The inflammatory response is an essential antiviral mechanism in the host immune system, and nuclear factor kappa-B(NF-κB) serves as a pivotal mediator of this response. The expression of various pro-inflammatory genes is induced by NF-κB, including those encoding cytokines and chemokines. The NF-κB also participates in inflammasome regulation [8, 9]. Several ASFV-encoded proteins, such as A238L, DP71L, and EP153R, have been reported to inhibit the NF-κB pathway [1012]. This inhibition dampens the production of key pro-inflammatory cytokines and antiviral factors, such as TNF-α and type I interferons, thereby weakening the innate immune response of host. As a result, ASFV may evade early immune detection and clearance more efficiently, potentially contributing to enhanced viral persistence and replication.

As an essential cytokine in innate immunity, IFN-α/β activates downstream antiviral genes to exert their antiviral effects [13]. However, ASFV encodes proteins that can suppress interferon production or signaling. For instance, the A276R protein inhibits the activation of interferon regulatory factors Interferon regulatory Factor 3 (IRF3) and Interferon regulatory Factor 7 (IRF7), thereby preventing IFN-I production. Furthermore, A276R disrupts downstream signaling from the type I interferon receptor, thereby reducing antiviral gene expression and eventually enhancing viral replication [14]. Although ASFV antagonizes IFN-I production, the host can still produce a small amount of IFN-I, which activates the transcription of interferon-stimulated genes involved in antiviral immunity. For instance, Interferon Induced Transmembrane Protein 1(IFITM1), a vital IFITM family member, plays a crucial role in host defense against various viruses by suppressing viral entry and replication [15]. Although IFITM1, IFITM2, and IFITM3 have all been revealed to inhibit ASFV replication, the inhibitory effect of IFITM1 is weaker than that of IFITM2 and IFITM3 [16]. The specific mechanism causing this difference remains unclear, and further exploration is needed to elucidate how the function of IFITM1 is attenuated in ASFV replication.

A non-structural protein A179L, encoded by ASFV, is consistently expressed during the early, middle, and late stages of viral infection. As a Bcl-2-like protein (Proteins with homologous structural domains to B-cell lymphoma 2), A179L inhibits apoptosis by binding to pro-apoptotic proteins such as Bcl-2-associated X protein (Bax), Bcl-2 Antagonist/Killer 1 (Bak), and BH3 Interacting Domain Death Agonist (Bid) [17]. Besides, A179L inhibits cellular autophagy through the Beclin-1 pathway [18]. These functions suggest that A179L plays an essential role in immunomodulation, making it an important protein that helps ASFV achieve immune escape. ASFV encodes multiple proteins to regulate apoptosis, and A179L is one of the few viral proteins expressed throughout the entire infection process. If A179L functions solely as an apoptosis inhibitor, its expression would not be required during the entire course of viral infection. This suggests that A179L may have additional, yet undiscovered functions.

This study first revealed the mechanism through which IFITM1 activates the NF-κB signaling pathway. Subsequently, the inhibitory mechanism of A179L on the NF-κB signaling pathway via IFITM1 was elucidated.

Materials and methods

Cells and viruses

HEK-293 A(Human Kidney cells), ST(Swine Testis cells), SK6 (Swine Kidney-6 cells), and LLC-PK1 (porcine kidney cells) cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum(FBS). The cells mentioned above are from the American Typical Culture Collection (ATCC). Primary porcine alveolar macrophages(PAMs) were stored in our laboratory. PAMs were cultured in 1640 (Gibco) medium supplemented with 10% fetal bovine serum and 1% penicillin, streptomycin, and amphotericin B. All cells were maintained at 37 ℃ with 5% CO2. VSV-GFP was maintained in our laboratory. The ASFV strain, ASFV CN/JS-1/2024 (GenBank accession number: PQ463787.1) was isolated from the lung tissue of diseased pigs at a pig farm in Jiangsu, China. Experiments involving ASFV infection were performed under animal biosecurity level 3 conditions at the Key Laboratory of Livestock and Poultry Infectious Diseases, Ministry of Agriculture, Yangzhou University.

Plasmids and molecular cloning

The A179L gene from the ASFV CN/JS-1/2024 strain was synthesized and inserted into the pCAGGS-Flag vector via Xho I and Kpn I sites. It was then PCR-amplified and cloned into the pCAGGS-HA (Kpn I/Xho I) and pEGFP-C3 (Bgl II/EcoR I) vectors using MultiF Seamless Assembly Mix (Abclonal, Wuhan, China), yielding pCAGGS-HA-A179L and pEGFP-A179L. Porcine IFITM1 was amplified from ST cell DNA and inserted into pCAGGS-HA at Kpn I and Xho I sites to generate pCAGGS-HA-IFITM1. Primer sequences are listed in Table 1. Plasmids for human cGAS (pcDNA3.1-HA-cGAS), STING (pcDNA3.1-HA-STING), and IKK (pcDNA3.1-HA-IKK) were available from previous lab work.

Table 1.

The primers used in this study

Primers Forward (5’−3’)/Reverse (5’−3’) Description
A179L GGTACCATGGAGGGAGAAGAGTTAATATATCAT Construction plasmid
CTCGAGCTATATCAAATTGCAGTTTCTTAATAACTGTACACAG
A179L-1-75 GGTACCATGGAGGGAGAAGAGTTAATATATCAT Construction plasmid
GCACTCGAGCAGTCACAACCCCAGTAAACTGGGTTTTAATTTC
A179L-1-95 GCAGGTACCATGGAGGGAGAAGAGTTAATATATCATAATATC Construction plasmid
GCACTCGAGGGCAGAAAAGACGATAAATCCACAAATTC
A179L-141-179 GCAGGTACCATGCTACACAGTGACATGTATTCTGTG Construction plasmid
CTCGAGCTATATCAAATTGCAGTTTCTTAATAACTGTACACAG
A179L-43-134 GCAGGTACCATGTTAACCTATTATGATGAGTGTTTGAACAAAC Construction plasmid
GCAGGTACCATGCTACACAGTGACATGTATTCTGTG
A179L-96-179 GCAGGTACCATGAAGATGGCAAAGTATTGCAAAGATGCCA Construction plasmid
GCACTCGAGCTATATCAAATTGCAGTTTCTTAATAACTGTACA
A179L(Δ30-40aa) CATTAATGATATTTCAGAGAAAATTTTAACCTATTATG Construction plasmid
CATAATAGGTTAAAATTTTCTCTGAAATATCATTAATG
sus-IKKα GAAAAGGCTATCCACTATGCTG Construction plasmid
TAGGGGCTCTTCTGTAGCTC
sus-NEMO CGTGCTGGGTGAAGAGTC Construction plasmid
CATCTCGGAGCTCTTGATTCTC
cGAS ACGATGACAAGGGTACCATGGCGGCCCGGCGG Construction plasmid
GATGAGTTTTTGTTCCTCGAGTCACCAAAAAACTGGAAATCCATTG
STING GACGATGACAAGGGTACCATGACGATGACAAGGGTACCA Construction plasmid
ATGAGTTTTTGTTCCTCGAGGGTACCCTAGCTAGCTACG
IFITM1 GCAGAATTCATGCTCAGGGAGGAGCAC Construction plasmid
GCACTCGAGCTAGTAGCCTCTGTTACTCTTTGCGC
sus-IKKβ ATGACGATGACAAGGGTACCATGAGCTGGTCACCTTCCC Construction plasmid
GTTTTTGTTCCTCGAGTCACGAGGCCTGCTCCAGGC
A179L-LA TGTCGTACCTGGGCGTTGCCG For left arm
CTTTTCCTCCGGCGACCCCTTTTATATACAATGTGCGCAGGATTTTACGT
A179L-RA CTGGGGATGCGGTGGGCTCTATGGTTTATATATTTATAAAAGCGGCACCCTA For right arm
AATGCTCACGGTTGATAAGAGAATTATTGTTGATTTGTGGGCC
p72 Promoter ACGTAAAATCCTGCGCACATTGTATATAAAAGGGGTCGCCGGAGGAAAAG For marker gene
CTCTAGACATATATATAATGTTATAAAAATAATTTATTGTTTTTATTAAATATGGCGGT
BGF-polyA GGCATGGACGAGCTGTACAAGTAACTGTGCCTTCTAGTTGCCAGC For marker gene
TAGGGTGCCGCTTTTATAAATATATAAACCATAGAGCCCACCGCATCCCCAG
EGFP AATAAAAACAATAAATTATTTTTATAACATTATATATATGTCTAGAGTGAGCAAGGGC For marker gene
GCTGGCAACTAGAAGGCACAGTTACTTGTACAGCTCGTCCATGCC
qIL1-β CCCAAAAGTTACCCGAAGAGG For qPCR
TCTGCTTGAGAGGTGCTGATG
qTNF-α ACCACGCTCTTCTGCCTACTGC For qPCR
TCCCTCGGCTTTGACATTGGCTAC
qIFITM1 TGCCTCCACCGCCAAGT For qPCR
GTGGCTCCGATGGTCAGAAT
qp72 TACTGCGAATACCCCGGAGA For qPCR
AGCGTTGTGACATCCGAACT
qGADPH ACATGGCCTCCAAGGAGTAAGA For qPCR
GATCGAGTTGGGGCTGTGACT

Antibodies and reagents

The following murine monoclonal antibodies were used: P30 (CP204L) was prepared and supplied by our laboratory; HA (AE008), FLAG (AE061) (Abclonal); GAPDH (10494-1-AP; Proteintech); Caspase3 (#9502), Caspase8 (#9746) and Caspase9(#14220) (Cell Signaling Technology). The following rabbit polyclonal antibodies were used: NF-κB (A3108), p-NF-κB (AP1355), p-IκBα (AP1069), IκBα (A1187), IKKβ (A0714), p-IKKβ (AP0546) and GFP (AE078) (Abclonal). Goat Anti-Rabbit/Mouse immunoglobulin G (IgG) (H + L) was acquired from Abclonal, antibody Alexa Fluor 488/555/647 was sourced from Thermo Fisher Scientific, and Lipofectamine 3000 transfection reagent was received from Thermo Fisher Scientific.

Yeast two-hybrid assay

The Matchmaker® Gold yeast two-hybrid system was used in this study. The bait plasmid PDHB1-A179L, porcine alveolar macrophage cDNA plasmid library, and yeast strains were constructed and used according to the manufacturer’s protocol (DUAL membrane Starter Kit N, P01201–P01229). PDHB1-A179L and the porcine alveolar macrophage cDNA plasmid library were co-transformed into yeast strain NMY51. Subsequently, the transformed yeast strains were cultured. Over 34 clones grew on SD/-leu-trp-his-ade + 5 mM 3AT selective plates, indicating positive clones. These positive clones were then cultured and preserved. Yeast plasmids were extracted from the 34 amplified positive clones, transformed into competent bacterial cells, and then plated on Luria broth agar plates supplemented with ampicillin. Single bacterial colonies were picked for plasmid amplification, and all 34 plasmids were sequenced. Finally, 18 positive genes were identified.

Co-IP assay and western blotting analysis

HEK-293 A cells were transfected with the indicated plasmids for 24 h and then lysed with cell lysis buffer. The cell lysates were incubated with anti-FLAG (M2) beads (Sigma) overnight at 4 ℃ on a roller. The immunoprecipitates were then subjected to electrophoresis. For Western blotting analysis, equal volumes of cell lysates and immunoprecipitates were resolved using 12% SDS-PAGE before being transferred to polyvinylidene difluoride membranes (catalog no.: ISEQ00010; Merck-Millipore). After incubation with the relevant primary and secondary antibodies, the membranes were visualized using an ECL system (Tanon, China) and Image-Pro software (Media Cybernetics, USA).

Indirect immunofluorescence

ST cells were inoculated into 24-well glass-bottom plates and transfected with the relevant plasmids. After 24 h of transfection, the cells were fixed with 4% paraformaldehyde for 10 min and permeabilized in Phosphate-Buffered Saline (PBS) containing 0.3% Triton X-100. After three PBS washes, the cells were incubated with 2% bovine serum albumin at 37 ℃ for 1 h and then incubated with anti-GFP and anti-RFP antibodies (1:200 or 1:50 dilutions). Samples were incubated with primary antibody overnight at 4 ℃ and secondary antibody (Alexa Fluor 488/555/647) for 1 h at room temperature (RT). Subsequently, the cells were stained with 6-diamidino-2-phenylindole (Beyotime, Inc.) for 15 min, and fluorescence images were acquired using a confocal laser scanning microscope (Leica TCS SP8).

Luciferase reporter assay

Luciferase activity was measured using a dual-luciferase reporter assay system (Yeasen) following the manufacturer’s protocol. Cells (1 × 10⁵/well in 24-well plates) were co-transfected with IFN-β or NF-κB firefly luciferase reporters (200 ng), Renilla luciferase reporter (10 ng), and the indicated plasmids or vector controls (500 ng), using Lipofectamine 3000. Total DNA was adjusted to 50 ng/well with empty vector. After 24 h, cells were lysed at room temperature for 15 min, and luciferase signals were detected. Firefly luciferase activity was normalized to Renilla to account for transfection efficiency. Results were expressed as fold induction of IFN-β or NF-κB activity relative to vector control.

Generation of ST-IFITM1 and ST-MARCH8 knockout cell lines

The ST-IFITM1 and ST-MARCH8 knockout cell lines were constructed using the CRISPR-Cas9 method. To generate the cell line, one CRISPR guide RNA (single guide RNA [sgRNA]) sequence targeting the IFITM1 locus in the genome was selected based on specificity scores (http://crispr.mit.edu/). The IFITM1 sgRNA sequence was as follows: 5’-GGGAACACTGGGGCCCTTCTG-3’. 5’-CCCCGCATCCCTCCTCCACT-3’. Lentiviruses expressing IFITM1 were generated by co-transfecting HEK-293A cells with pLVX-IFITM1, packaging vector psPAX2, and envelope vector pMD2.G using Lipofectamine 3000 (Thermo Fisher Scientific, China). Culture supernatants containing lentiviruses were harvested at 24 and 48 h post-transfection and filtered through a 0.45 µm pore size filter. ST cells were infected with IFITM1-expressing lentiviruses and selected using hygromycin B to generate an ST-IFITM1 KO stable cell line. Furthermore, the expression of IFITM1 in ST-IFITM1 KO cells was analyzed by Western blotting. ST-MARCH8 KO cell line was generated by the same way. The MARCH8 sgRNA sequence was as follows: 5’- GGAAGAGACUCAAGGCUUATT-3’ 5’-UAAGCCUUGAGUCUCUUCCTT-3’.

RNA extraction and RT-qPCR

Total RNA was isolated using a RaPure Total RNA Micro Kit (Magen, China). The RNA was then reverse-transcribed into cDNA using HiScript® III-RT SuperMix for RT-qPCR (Vazyme, China). RT-qPCR was performed using SYBR Green Mix (Vazyme, China) on a CFX96 machine (Bio-Rad, USA). Porcine actin was used as a housekeeping gene to normalize the total RNA. The qPCR primers are listed in Table 1. Experiments were performed in triplicate.

Homologous recombination

Recombinant ASFV-ΔA179L was generated in PAMs through homologous recombination between the parental ASFV CN/JS-1/2024 strain and a recombinant gene fragment using infection and transfection techniques. The recombinant gene (p72-EGFPΔA179L) contained two flanking arms (approximately 1000 bp to the left and right of the A179L gene) and a reporter cassette (EGFP gene with the ASFV p72 late gene promoter). The recombinant ASFV-ΔA179L was purified using a series of plaque purification in PAMs based on EGFP expression. Finally, the purified ASFV-ΔA179L virus was successfully obtained through limited dilution, expanded culture, PCR identification of the target gene (Primer F: GGTACCATGGAGGGAGAAGAGTTAATATATCAT; Primer R: CTCGAGCTATATCAAATTGCAGTTTCTTAATAACTGTACACAG), and Sanger sequencing(Primer F: TGTCGTACCTGGGCGTTGCCG; Primer R: AATGCTCACGGTTGATAAGAGAATTATTGTTGATTTGTGGGCC) of the recombinant region.

Downregulation of ASFV A179L by shRNA knockdown

The shRNA was designed based on the full genome of ASFV CN/JS-1/2024, and the plasmid containing shRNA (pLVX-shRNA) was acquired from Beijing Tsingke Biotech. The shRNA sequence was as follows: 5’- GGATCCCGAGTGTTCAAGAAATTAACTCGAGTTAATTTCTTGAACACTCGTTTTTGAATTC-3’. The transfection mixtures were prepared by adding pLVX-shRNA and HiPerFect transfection reagent (Qiagen) to Opti-MEM medium (Gibco, Life Technologies) according to the manufacturer’s instructions. PAM grown in 24-well plates (2.0 × 104 cells/cm2) were transfected with pLVX-shRNA at 50 nM. After 8 h, the transfection complexes were replaced with fresh DMEM supplemented with 10% FBS before ASFV infection at an MOI of 0.1. The efficacy of shRNA knockdown was evaluated by RT-qPCR by comparing A179L mRNA levels between mock-transfected cells and cells transfected with shRNA-A179L.

Statistical analysis

All the statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc). Data are presented as the mean ± SD, and p values were calculated with one-way ANOVA (*, p < 0.05; **, p < 0.01; ***, p < 0.001; “ns” stands for not statistically significant, and bar indicates mean).

Results

A179L inhibits the NF-κB signaling pathway

Upon ASFV infection, cytosolic DNA is mainly detected by the key DNA sensor cGAS, which activates the STING-dependent immune response [19]. A179L significantly suppressed the promoter activity of NF-κB induced by cGAS-STING and tumor necrosis factor-alpha (TNF-α) (Fig. 1A and B). Moreover, A179L inhibited the transcription levels of IFN-β, TNF-α, and interleukin (IL)−1β stimulated by TNF-α (Fig. 1C-E). Additionally, Western blotting analysis revealed that A179L effectively attenuated the phosphorylation of NF-κB and IκBα at various time points following TNF-α stimulation (Fig. 1F). To verify the regulation of NF-κB signaling pathway by A179L in ASFV infection, the mRNA level of A179L was silenced by transfection with shRNA (Fig. 1G). Silencing A179L in ASFV-infected cells resulted in p72 gene transcription levels comparable to those observed in ASFV-WT-infected PAMs (Fig. 1H), while significantly increasing the transcription of TNF-α and IL-1β(Fig. 1I)., as well as markedly enhancing the expression levels of p-NF-κB and p-IκBα (Fig. 1J). These findings suggested that A179L exerts inhibitory effects on the NF-κB signaling pathway, thus suppressing the transcription of inflammatory factors.

Fig. 1.

Fig. 1

ASFV A179L inhibits the NF-κB signaling pathway. A-B. HEK-293 A cells were co-transfected with pCAGGS-Flag-A179L and pRL-TK internal control plasmid, along with either pNF-κB-luc, pIFN-β-luc, or pISRE-luc reporter plasmid. The luciferase activity was detected at 24 24 h post-transfection. C-E. HEK-293 A cells were transfected with empty vector or pCAGGS-Flag-A179L for 24 h and then transfected with poly (I: C) for another 24 h. The mRNA levels of IL-1β and TNF-α were determined by RT-qPCR. F HEK-293 A cells were transfected with pCAGGS-Flag-A179L for 24 h, then treated with or without TNF-α (10 ng/mL) for 10 min, 20 min and 40 min. Protein levels of NF-κB, p-NF-κB, IκBα, and p-IκBα were analyzed by Western blot. G PAMs were transfected with shRNA-A179L (50 nM) or shRNA-NC (50 nM) for 8 h and then infected with ASFV. A179L mRNA levels were quantified using RT-qPCR at 6 and 12 hpi. H The transcription levels of the p72 (B646L) gene were detected using RT-qPCR. I Transcription levels of inflammatory cytokines were measured 12 h post-infection using RT-qPCR. J Protein levels of NF-κB, p-NF-κB, IκBα, and p-IκBα were analyzed by Western blot

A179L interacts with IFITM1

To identify the host target proteins of A179L, the yeast two-hybrid system was used in this study to screen the PAM genomic library (unpublished results). Through this approach, 18 host proteins that interact with A179L were successfully identified (Fig. 2A). Subsequently, co-immunoprecipitation (Co-IP) and indirect immunofluorescence assays were conducted to validate the interactions of ASFV-A179L with these host proteins. The findings demonstrated a specific association between ASFV A179L and IFITM1 (Fig. 2B), as confirmed by their co-localization in the cytoplasm of ST cells (Fig. 2C).

Fig. 2.

Fig. 2

IFITM1 interacts with ASFV A179L. A The yeast two-hybrid technique for screening host proteins that interact with A179L. B Confocal microscopy examined the co-localization of A175L and IFITM1 in ST cells. The nuclei were stained with DAPI. C HEK-293 A cells were co-transfected with pFlag-A179L and pHA-IFITM1, and then Co-IP was performed. D-F. HEK-293 A cells were co-transfected with pCAGGS-Flag-IFITM1 and either pCAGGS-HA-A179L, pCAGGS-HA-A179L (1–75 aa), pCAGGS-HA-A179L (1–95 aa), pCAGGS-HA-A179L (96–179 aa), pCAGGS-HA-A179L (141–179 aa), pEGFP-A179L (1–75 aa), pEGFP-A179L (1–40 aa), or pEGFP-A179L (30–75 aa). After 24 h, the cells were collected, and Co-IP was performed with anti-Flag M2 magnetic beads. Protein levels were analyzed using Western blotting. G-I. HEK-293 A cells were co-transfected with either pCA-Flag-A179L or pCA-Flag-A179L(Δ30-40aa), along with pNF-κB-luc and pRL-TK for 24 h, and then stimulated with TNF-α for 8 h to assess the activity of the NF-κB promoter. The protein levels of NF-κB and NF-κB phosphorylation were detected by Western blotting. ImageJ software was used to calculate the gray value of the Western blotting results

Collectively, these findings provide compelling evidence that A179L interacts with IFITM1. To identify the binding domains of A179L with IFITM1, IFITM1 was co-transfected with full-length or truncated A179L recombinant plasmids (Fig. 2D-F), and then Co-IP was performed to verify their interaction.

The results revealed that IFITM1 interacted with ASFV-Flag-A179L (30–40 aa), a part of the Bcl-like motif. Co-transfection of pCAGGS-Flag-A179L (Δ30–40 aa) and pCAGGS-HA-IFITM1 into HEK293A cells revealed that A179L (Δ30–40 aa) abolished the ability to repress the NF-κB promoter and failed to inhibit NF-κB phosphorylation (Fig. 2G-I). These results suggested that the 30–40 aa region of A179L interacts with IFITM1, which played a vital role in inhibiting the NF-κB signaling pathway.

IFITM1 promotes the activation of NF-κB signaling induced by TNF-α

The regulation of the NF-κB signaling pathway by IFITM1 has been reported, but the specific mechanism remains unknown [20, 21]. This study demonstrated that IFITM1 can enhance the promoter activity of NF-κB induced by cGAS-STING and TNF-α (Fig. 3A and B). IFITM1 also promoted the phosphorylation of NF-κB and IκBα (Fig. 3C). To further clarify the role of IFITM1 in activating the NF-κB signaling pathway, CRISPR-Cas9 technology was used to knockout the IFITM1 gene from ST cells. Sanger sequencing and Western blotting results confirmed that the IFITM1 knocked-out cell line was obtained, named ST-IFITM1 KO (Fig. 3D and E). After stimulating ST and ST-IFITM1 KO cells with TNF-α, the promoter activity of NF-κB, IFN-β, and ISRE, as well as the expression level of phosphorylated NF-κB, were detected. The results revealed that the NF-κB pathway activated by TNF-α was inhibited in ST-IFITM1 KO cells compared with ST cells (Fig. 3F-J). These findings strongly supported that IFITM1 promotes the activation of NF-κB signaling induced by TNF-α.

Fig. 3.

Fig. 3

IFITM1 promotes the NF-κB activation. A HEK-293 A cells were transfected with pCA-HA-IFITM1 (1 µg), pCA-cGAS (0.5 µg), pCA-STING (0.5 µg), pNF-κB-luc, and pRL-TK for 24 h. The NF-κB promoter activity was detected using a dual-luciferase reporter assay. B HEK-293 A cells were transfected with pCA-Flag-IFITM1 (0, 200, 500, and 1000 ng), pNF-κB-luc and pRL-TK for 24 h and then treated with TNF-α (10 ng/mL) for 8 h. The NF-κB promoter activity was detected using a dual-luciferase reporter assay. C HEK-293 A cells were transfected with pCA-HA-IFITM1 and then treated with or without TNF-α (10 ng/mL) for 8 h. At 24 hpt, the cells were analyzed by Western blotting. D The knockout efficiency of IFITM1 was confirmed through Western blotting. E Comparative results of the IFITM1 gene sequences in ST and ST-IFITM1 KO cells. F-H ST and ST-IFITM1 KO cells were treated with TNF-α (10 ng/mL) for 8 h. The NF-κB, IFN-β, and ISRE promoter activities were detected using a dual-luciferase reporter assay. I ST and ST-IFITM1 KO cells were treated with TNF-α (10 ng/mL) for 8 h, and the cells were then analyzed by Western blotting. J ImageJ software was used to calculate the gray value of the Western blotting results

IFITM1 interacts with IKKβ and promotes IKKβ phosphorylation

Previous studies have demonstrated the regulatory role of IKK complex activation in the NF-κB signaling pathway [22]. However, whether IFITM1 modulates the IKK complex activation to regulate the NF-κB signaling pathway is unclear. Western blot analysis was used to examine the expression of IKKα, IKKβ, and NEMO in HEK-293 A cells after IFITM1 protein overexpression. The results demonstrated that IFITM1 enhanced IKKβ phosphorylation in a concentration -dependent manner (Fig. 4A) but did not significantly affect the expression of IKKα and NEMO. Co-IP experiments revealed that IKKβ interacts with IFITM1 (Fig. 4B and C). However, IFITM1 did not interact with IKKα or NEMO (Fig. 4D and E). These findings indicated that IFITM1 interacts with IKKβ and promotes its phosphorylation, activating the NF-κB signaling pathway.

Fig. 4.

Fig. 4

IFITM1 interacts with IKKβ and promotes its phosphorylation. A HEK-293 A cells were transfected with pFlag-IFITM1 (0, 200, 500, and 1000 ng) for 24 h and then treated with TNF-α (10 ng/mL) for 8 h. The cells were analyzed by Western blotting. B-C HEK-293 A cells were transfected with pCA-Flag-IFITM1 or pCA-HA-IFITM1, along with pCA-HA-IKKβ or pCA-Flag-IKKβ. The cells were lysed, and then immunocomplexes and whole cell lysates (WCL) were analyzed by Western blotting. D-E. HEK293A cells were transfected with pCA-Flag-IFITM1, pCA-HA-IKKβ, or pCA-HA-NEMO. The cells were lysed, and then immunocomplexes and WCL were analyzed by Western blotting

A179L inhibits the NF-κB signaling pathway by targeting IFITM1

To investigate whether A179L inhibits the NF-κB signaling pathway activated by IFITM1, VSV was used, which has been reported to be effectively inhibited by IFITM1. The results indicated that IFITM1 expression alone significantly reduced VSV-GFP infection, while VSV infection increased in the cells co-expressing A179L and IFITM1 (Fig. 5A and B). These results suggested that A179L disturbed the functions of IFITM1, preventing it from effectively restricting VSV-GFP infection. Furthermore, these findings indicated that IFITM1 expression alone reduced VSV-GFP infection. However, VSV infection increased in the cells that co-expressed A179L and IFITM1. HEK-293 A cells were co-transfected with IFITM1 and A179L expression plasmids and then stimulated with TNF-α. NF-κB promoter activity was measured using a dual-luciferase reporter assay. The results demonstrated that compared to the control group, cells expressing HA-IFITM1 alone exhibited a marked increase in NF-κB promoter activity, indicating that IFITM1 significantly enhances NF-κB signaling. Furthermore, co-expression of IFITM1 and A179L resulted in a significant reduction in NF-κB activity, although the level remained higher than in cells without IFITM1 expression (Fig. 5C). This suggests that A179L partially inhibits IFITM1-mediated NF-κB activation.

Fig. 5.

Fig. 5

ASFV A179L inhibits the NF-κB signaling pathway by targeting IFITM1. A HEK-293 A cells were co-transfected with pCA-HA-IFITM1 or pCA-Flag-A179L for 24 h, followed by infection with VSV-GFP at an MOI of 0.1 for 6 h. Viral infection was assessed by fluorescence microscopy. B VSV-GFP infection levels were further confirmed by Western blotting. C HEK-293 A cells were transfected with pCA-Flag-A179L or pCA-HA-IFITM1 for 24 h and then stimulated with TNF-α (10 ng/mL) for 8 h. NF-κB promoter activity was measured using a dual-luciferase reporter assay. D-E. ST and ST-IFITM1 KO cells were transfected with pCA-Flag-A179L for 24 h and treated with TNF-α (10 ng/mL) for 8 h. NF-κB promoter activity was measured using a dual-luciferase assay. Protein levels of NF-κB and phosphorylated NF-κB (pNF-κB) were analyzed by Western blotting. F ImageJ software was used to calculate the gray value of the Western blotting results

Taken together, these findings support the conclusion that A179L suppresses NF-κB signaling by interfering with the function of IFITM1. However, in ST-IFITM1 KO cells, the inhibitory effect of A179L on NF-κB activity was reversed in ST-IFITM1 KO cells (Fig. 5D-F). These results indicated that IFITM1 is required for A179L to exert its inhibitory effect on the NF-κB signaling pathway. In the absence of IFITM1, A179L loses its functional target and can no longer effectively inhibit the pathway.

A179L promotes IFITM1 degradation via the ubiquitin-proteasome pathway

To investigate whether IFITM1 can be transcriptionally induced in various porcine cell lines under stimulatory conditions, we examined IFITM1 mRNA expression levels in ST, PK1, SK6, and PAM cell lines following treatment with IFN-β and TNF-α. (Fig. 6A-H). Notably, PAMs exhibited the highest levels of IFITM1 transcripts when stimulated with IFN-β or TNF-α. PAMs were then infected with ASFV to examine IFITM1 expression during viral infection. Subsequently, the mRNA and protein levels of IFITM1 were measured using RT-qPCR and Western blotting, respectively. The results revealed that the mRNA level of IFITM1 in PAMs exhibited sustained elevation between 0 and 24 h during ASFV infection (Fig. 6I). However, IFITM1 protein expression level in PAMs started to decrease after 10 h post-ASFV infection, suggesting that ASFV may regulate IFITM1 protein levels (Fig. 6J and K). To determine whether A179L regulates IFITM1 protein levels, pCA-Flag-A179L was transfected, and the IFITM1 protein level was detected. The results indicated that IFITM1 protein levels were decreased in the presence of A179L (Fig. 7A). Then, to investigate whether A179L mediates IFITM1 degradation through specific pathways, MG132 or NH4Cl and CHX were used to inhibit proteasomal and lysosomal degradation, respectively. The results revealed that MG132 can block A179L-induced IFITIM1 degradation (Fig. 7B and C). Furthermore, these findings indicate that A179L promotes IFITM1 degradation via the proteasome pathway.

Fig. 6.

Fig. 6

ASFV inhibits the protein expression level of IFITM1. A-H SK-6, PK1, PAM, and ST cells were stimulated with IFN-β and TNF-α. The mRNA levels of IFITM1 were determined using RT-qPCR. I PAMs were infected with ASFV, and cellular RNA was collected. The mRNA levels of IFITM1 were measured using RT-qPCR. J IFITM1 protein levels during ASFV infection were detected by Western blotting. K ImageJ software was used to calculate the gray value of the Western blotting results

Fig. 7.

Fig. 7

A179L promotes IFITM1 degradation via the ubiquitin-protein pathway. A. HEK-293 A cells were transfected with increasing amounts of pCA-Flag-A179L (0, 200, 500, or 1000 ng) for 12 h, followed by stimulation with TNF-α (10 ng/mL) to induce IFITM1 expression. Endogenous IFITM1 protein levels were analyzed by Western blot. Flag-A179L and β-actin were used as transfection and loading controls, respectively. B-C. HEK-293 A cells were transfected with pCA-Flag-A179L for 12 h, followed by stimulation with TNF-α (10 ng/mL) for 6 h to induce IFITM1 expression. Cells were then treated with the protein synthesis inhibitor cycloheximide (CHX, 10 ng/mL), with or without the proteasome inhibitor MG132 (10 µM) or NH4Cl (10 µM), for various time points. Cell lysates were collected for Western blot analysis of endogenous IFITM1, Flag-A179L, and β-actin protein levels. D. GFP-A179L, HA-Ub, and Flag-IFITM1 were overexpressed in HEK-293 A cells for 24 h, followed by the addition of MG132. After 12 h of treatment, the cells were incubated with beads, and the expression level of each protein was detected by Western blotting. E-H. GFP-A179L and Flag-IFITM1, along with either HA-Ub-K63O, HA-Ub-K48O, HA-Ub-K11O, or HA-Ub-K48R were overexpressed in HEK-293 A cells for 24 h, followed by the addition of MG132. After 12 h of treatment, the cells were incubated with Flag beads, and the expression of each protein was detected by Western blotting

A179L promotes K48-linked IFITM1 ubiquitination

Protein degradation mediated via the ubiquitin-proteasome pathway can occur by either monoubiquitination or polyubiquitination [23]. To explore whether A179L enhances IFITM1 ubiquitination, the interaction between IFITM1 and ubiquitin was investigated. The results revealed that A179L promoted IFITM1 ubiquitination (Fig. 7D). To investigate the specific type of ubiquitination promoted by A179L on IFITM1, HEK293A cells were transfected with wild-type ubiquitin (Ub) or lysine-only ubiquitin mutants (Ub-K11O, Ub-K48O, and Ub-K63O), each retaining only a single lysine residue at position 11, 48, or 63, respectively. After 12 h, the cells were transfected with pCAGGS-Flag-IFITM1 and pEGFP-A179L. The cells were then collected to demonstrate the interaction between IFITM1 and Ub (or Ub mutants) using Western blotting. Western blot analysis demonstrated that A179L specifically promotes the interaction between IFITM1 and K48-linked ubiquitin (Ub-K48O), indicating that A179L may promotes K48-linked polyubiquitination of IFITM1 (Fig. 7E-G). To confirm this, we used the Ub-K48R mutant, in which the K48 residue is replaced with arginine, thereby preventing K48-linked ubiquitination. The results showed that in the presence of Ub-K48R, A179L was no longer able to promote IFITM1 ubiquitination (Fig. 7H). In contrast, when wild-type ubiquitin or K48-only ubiquitin (Ub-K48O) is expressed, A179L significantly increases IFITM1 ubiquitination. These findings further support that A179L specifically facilitates K48-linked ubiquitination of IFITM1.

A179L promotes the interaction between IFITM1 and MARCH8

During ubiquitination, the E3 ubiquitination ligase determines the target protein for specific identification [24]. IFITM1 is degraded through the ubiquitin-proteasome pathway. This study aimed to identify the E3 ubiquitin ligases that interact with IFITM1. E3 ubiquitin ligases involved in protein degradation were selected, and Co-IP was performed to detect their interactions with IFITM1 [2528]. Subsequently, pCA-HA-TRIM3(Tripartite motif-containing 3), pCA-HA MARCH8(membrane-associated RING-CH 8 protein), pCA-HA-TRIM21(tripartite -motif protein 21), pCA-HA-RNF166(Ring Finger Protein 166), and pCA-HA-HRD1(HMG-CoA reductase degradation 1) were co-transfected with pCA-3Flag-IFITM1. The results revealed that IFITM1 can interact with MARCH8 (Fig. 8A-C), and this interaction is further enhanced by the presence of GFP-A179L (Fig. 8D). Additionally, GFP-A179L was shown to interact with endogenous IFITM1 and promote the interaction between endogenous MARCH8 and IFITM1 (Fig. 8E). Consequently, A179L enhances the MARCH8-IFITM1 interaction, ultimately facilitating the degradation of IFITM1.

Fig. 8.

Fig. 8

A179L promotes the interaction between IFITM1 and MARCH8. A HEK-293 A cells were transfected with pCA-Flag-IFITM1 and either pCA-2HA-TRIM3, pCA-2HA-MARCH8, pCA-2HA-TRIM21, pCA-2HA-RNF166, and pCA-2HA-HRD1. After 24 h, the cells were incubated with Flag beads, and the expression level of each protein was measured by Western blotting. B-C. HA-MARCH8 and Flag-IFITM1 (or HA-IFITM1) were co-transfected in HEK-293 A cells. After 24 h, the cells were incubated with Flag or HA beads, and the expression of each protein was detected. D. pGFP-A179L, pCA-HA-MARCH8, and pCA-Flag-IFITM1 were overexpressed in HEK-293 A cells, and MG132 was added after 24 h. After 12 h of treatment, the cells were incubated with Flag beads, and the expression of each protein was detected. E ST cells were transfected with or without pCA-GFP-A179L. After 12 h of expression, cells were stimulated with TNF-α (10 ng/mL) for 6 h, followed by treatment with the proteasome inhibitor MG132 (10 µM) for an additional 6 h. Cell lysates were then incubated with magnetic beads conjugated to anti-MARCH8 antibody for 5 h. The expression of endogenous IFITM1, MARCH8, and GFP-A179L was analyzed by Western blotting

A179L promotes MARCH8 targeting of IFITM1 for degradation

To further investigate the role of MARCH8 in IFITM1 degradation, RFP-IFITM1, HA-MARCH8, and Flag-A179L were co-expressed in HEK-293 A cells. Western blot analysis showed that A179L promoted MARCH8-mediated degradation of IFITM1 in a dose-dependent manner (Fig. 9A). We then examined the effect of A179L and MARCH8 on endogenous IFITM1 expression. The results revealed that increasing levels of A179L expression led to a corresponding decrease in endogenous IFITM1 protein levels (Fig. 9B). To further confirm whether A179L specifically facilitates MARCH8-dependent degradation of IFITM1, we generated a MARCH8-knockout cell line (ST-MARCH8 KO) using the CRISPR-Cas9 system. The knockout efficiency was validated by both Western blotting and DNA sequencing (Fig. 9C and D). In the ST-MARCH8 KO cells, A179L overexpression failed to promote the degradation of RFP-tagged IFITM1, in contrast to its strong effect observed in MARCH8-sufficient ST cells (Fig. 9E and G). Consistent results were obtained when examining endogenous IFITM1 protein levels, further confirming the dependence on MARCH8 (Fig. 9F and H). Moreover, reintroduction of HA-MARCH8 into the ST-MARCH8 KO cells restored the ability of A179L to facilitate IFITM1 degradation, both for exogenous and endogenous IFITM1 (Fig. 9I and J). Collectively, these results demonstrate that A179L specifically promotes MARCH8-mediated degradation of IFITM1.

Fig. 9.

Fig. 9

A179L promotes MARCH8-mediated degradation of IFITM1. A HEK-293 A cells were co-transfected with pCA-Flag-A179L (0, 200, 500, or 1000 ng), pCA-HA-MARCH8 (1000 ng), and pCA-RFP-IFITM1 (1000 ng). After 24 h, the expression levels of A179L, MARCH8, and exogenous IFITM1 were analyzed by Western blotting using anti-Flag, anti-HA, and anti-RFP antibodies. B Cells were treated as in (A) but without exogenous IFITM1 plasmid. Endogenous IFITM1 expression was detected using an anti-IFITM1 antibody. C The knockout efficiency of MARCH8 in ST-MARCH8 KO cells was confirmed by Western blot. D Comparison of MARCH8 gene sequences between wild-type ST and ST-MARCH8 KO cells. E-F. ST cells were transfected with pCA-RFP-IFITM1 alone or co-transfected with pCA-Flag-A179L. Protein expression of A179L and either exogenous (E) or endogenous (F) IFITM1 was analyzed. G-H. ST-MARCH8 KO cells were transfected as in (EF) to assess the effect of MARCH8 deficiency on A179L-mediated IFITM1 degradation. I-J. ST-MARCH8 KO cells were rescued by transfection with pCA-HA-MARCH8 and then transfected with pCA-RFP-IFITM1 alone or with pCA-Flag-A179L. Protein levels of A179L, MARCH8, and either exogenous (I) or endogenous (J) IFITM1 were detected by Western blotting.β-actin was used as a loading control in all panels

A179L gene-deleted ASFV activates the NF-κB signaling pathway in PAMs

To examine the role of A179L in regulating the NF-κB signaling pathway during ASFV infection, recombinant ASFV-ΔA179L was generated from ASFV-WT by homologous recombination. The A179L gene was replaced with EGFP, a fluorescent gene controlled by the ASFV p72 promoter (Fig. 10A). ASFV-ΔA179L was generated and purified by fluorescence screening (Fig. 10B). Subsequently, the PCR results showed that the A179L gene fragment was absent in ASFV-ΔA179L (Fig. 10C).The genome sequencing and analysis of ASFV-ΔA179L confirmed that A179L was successfully knocked out (Fig. 10D). Furthermore, the growth kinetics of ASFV-ΔA179L were similar to that of ASFV-WT (Fig. 10E), indicating that deletion of A179L gene did not affect the replication of ASFV in PAMs. The phosphorylation levels of IKKβ, IκBα, and NF-κB were measured using Western blotting to determine whether the NF-κB signaling pathway is activated in the ASFV-ΔA179L-infected PAMs. The phosphorylation levels of IκBα, NF-κB, and IKKβ in ASFV-ΔA179L-infected PAMs increased compared with those in the ASFV-WT-infected cells (Fig. 10F). These results indicated that the NF-κB signaling was activated on ASFV-ΔA179L infection. Moreover, infection with ASFV-ΔA179L significantly upregulated IFITM1 protein levels compared to ASFV-WT (Fig.10F). Finally, ASFV-ΔA179L induced significantly higher transcription levels of TNF-α and IL-1β than ASFV-WT (Fig. 10G). These findings suggested that A179L inhibits the NF-κB signaling pathway in ASFV infection by degrading IFITM1.

Fig. 10.

Fig. 10

ASFV-ΔA179L activates the NF-κB signaling pathway in PAMs. A Schematic representation of the A179L gene deletion region in ASFV. B PAMs infected with ASFV-ΔA179L exhibited green fluorescence. C PCR amplification of A179L was performed using ASFV-WT and ASFV-ΔA179L genomes as templates. D Results of the partial sequence alignment of ASFV-WT and ASFV-ΔA179L after genome sequencing. E PAMs were infected with ASFV-WT (MOI = 0.01) or ASFV-ΔA179L (MOI = 0.01), and the viral titer in the sample was determined using the HAD50 method at the indicated times after infection. F PAMs were infected with ASFV-WT and ASFV-ΔA179L for 24 h, and then the expression levels of related proteins in the NF-κB signaling pathway were detected by Western blotting. G Transcription levels of inflammatory factors were detected 24 h after virus infection

Discussion

The NF-κB pathway is essential for the innate immune system to regulate the transcription of antiviral genes, including IFNs, cytokines, chemokines, their modulators, immunoreceptors, and genes involved in cell cycle, apoptosis, and stress response [29]. Various ASFV-encoded proteins have been found to inhibit NF-κB signaling. This study identified a novel mechanism by which A179L inhibits NF-κB pathway. The ASFV-encoded A179L protein is a potent anti-apoptotic factor that primarily exerts its effects by mimicking Bcl-2 family proteins to inhibit mitochondria-mediated apoptosis. A179L, unlike other ASFV proteins, inhibits NF-κB signaling through a distinct mechanism. For instance, MGF505-7R inhibits NF-κB activation by interacting with IKKα and inhibiting IKK complex formation [30]. Meanwhile, I226R promotes NEMO degradation to suppress NF-κB signaling [31]. In summary, MGF505-7R and I226R directly interact with key components of the NF-κB pathway, thereby modulating its activation. In contrast, these findings revealed that A179L promoted the degradation of IFITM1, an immune factor that positively regulates NF-κB signaling, leading to NF-κB pathway inhibition(Fig. 11).

Fig. 11.

Fig. 11

Schematic overview of the mechanism model of ASFV-A179L inhibits the NF-κB signaling pathway. Upon ASFV infection, the cGAS-STING-NF-κB signaling pathway is activated, leading to the production of inflammatory cytokines and IFN-I. These cytokines, via the JAK-STAT pathway and TNFR1 signaling, enhance the transcription of IFITM1(indicated by black arrows). IFITM1 interacts with IKKβ and promotes its phosphorylation, thereby positively regulating NF-κB activation (indicated by red arrows). A179L binds to IFITM1 and facilitates its interaction with the E3 ligase MARCH8, promoting K48-linked ubiquitination of IFITM1 (indicated by green arrows). This post-translational modification targets IFITM1 for proteasomal degradation, ultimately suppressing NF-κB signaling

To investigate the role of A179L in ASFV infection, ASFV-ΔA179L was generated through homologous recombination. The viral growth curve showed that there was no statistically significant difference in viral titers between ASFV-WT and ASFV-ΔA179L during the 72-hour infection period. This result is consistent with the previously reported Benin∆A179L recombinant virus strain. Meanwhile, our research elucidates the mechanism by which the absence of A179L induces cells to produce higher levels of inflammatory factors, thereby significantly enriching our understanding of the functional roles of A179L. In addition, previous reports found that the deletion of A179L gene reduced the spread of virus between macrophages, but the specific explanation has not been elucidated [32]. Here, we propose an alternative explanation: ASFV-ΔA179L infection prompts cells to secrete high levels of inflammatory factors, activates antiviral signals and then communicates infection status to neighbouring cells, finally hindering viral spread among macrophages.

IFITM1 exerts a broad-spectrum antiviral effect by inhibiting viral entry and membrane fusion, significantly restricting the spread of various enveloped viruses, including influenza, hepatitis B, dengue, and Zika [33]. In addition to its antiviral activity, IFITM1 contributes to immune system regulation. However, the specific mechanisms by which IFITM1 regulates the NF-κB signaling pathway remain poorly understood. This study provided new insights into the interaction between IFITM1 and IKKβ, activating the NF-κB signaling pathway. Previous studies have demonstrated that IFITM1 has a weak inhibitory effect on ASFV compared to IFITM2 and IFITM3, possibly due to the ASFV-mediated modulation of IFITM1 activity. Further investigation is required to elucidate why ASFV selectively attenuates the activity of IFITM1. First, the coding sequences of IFITM1, IFITM2, and IFITM3 are highly homologous, sharing over 90% identity across 70% of the sequence, although their noncoding regions differ significantly. For instance, IFITM2 and IFITM3 exhibit 91% similarity even in noncoding regions, while the similarity between IFITM1 and the other two proteins is only 65%. Second, IFITM2 and IFITM3 localize primarily in endosomes and lysosomes, whereas IFITM1 is predominantly expressed on the cell surface and in the endoplasmic reticulum [33, 34]. These structural and localization differences suggest that IFITM1 employs a distinct mechanism to exert its antiviral effects.

IKKβ plays a central role in the classical NF-κB pathway by regulating NF-κB activation and IFN production by phosphorylating IκB family members, which subsequently mediate the transcription of antiviral factors [35]. Various viral proteins have been reported to interact with IKKβ to modulate the NF-κB signaling pathway. Some of these interactions block IKKβ phosphorylation. For instance, ASFV-pF317L interacts with IKKβ, inhibiting its phosphorylation and suppressing NF-κB activation, ultimately promoting viral replication [36]. In contrast, this study found that IFITM1 interaction with IKKβ enhances IKKβ phosphorylation. One possible explanation is that IFITM1 binding can induce a conformational change in IKKβ, exposing additional phosphorylation sites and increasing phosphorylation levels.

Among the various mechanisms by which viral proteins promote host protein degradation, a common strategy is to entrap host E3 ubiquitin ligases and degrade antiviral proteins. Viruses exploit the host ubiquitin system as a common mechanism of achieving immune escape. For instance, the Vpr protein encoded by HIV-1 promotes LAPTM5 ubiquitination, rapidly degrading in macrophages and lifting the restriction of LAPTM5 to viral replication [37]. Similarly, in this study, A179L was found to interact with IFITM1, enhancing MARCH8 recruitment to IFITM1 and eventually promoting IFITM1 degradation. The mechanism by which A179L enhances IFITM1 recruitment to MARCH8 requires further investigation. A reasonable explanation is that the interaction between A179L and IFITM1 facilitates the formation of a multiprotein complex involving MARCH8. Such complex formation can, in turn, play a crucial role in regulating MARCH8 recruitment and activity.

When stimulated by viruses or other pathogens, the host secretes IFN-I and other cytokines. These interferons activate antiviral factors, including IFITM1, through signaling pathways such as JAK-STAT, leading to the transcriptional upregulation of these factors and contributing to pathogen clearance and cellular protection [38]. Typically, IFITM1 is located on the cell membrane and functions as an antiviral factor to prevent viral entry. This study found that IFITM1 also plays a role in the upregulation of inflammatory cytokines by activating the NF-κB signaling pathway, further enhancing its role in host protection. During ASFV infection, IFITM1 expression is increased to exert its antiviral function. In response, ASFV encodes the A179L protein, which interacts with IFITM1 to promote its degradation, thereby disrupting the defensive response of the host. This enables ASFV to create an environment favorable for viral replication and proliferation. This finding enhances our understanding of how ASFV regulates host immune responses.

In conclusion, this study successfully demonstrated the interaction of IFITM1 with IKKβ to activate NF-κB signaling pathway, thereby providing an updated understanding of IFITM1 roles. Moreover, the NF-κB signaling pathway was inhibited by A179L by promoting IFITM1 degradation, which significantly helps to address the relationship between ASFV infection and NF-κB regulation. Overall, these findings contributed substantially to our understanding of the immune evasion strategies of ASFV.

Conclusion

In conclusion, our study demonstrated that IFITM1 activates the NF-κB signaling pathway by interacting with IKKβ and promoting its phosphorylation, thereby upregulating pro-inflammatory responses. Moreover, ASFV A179L counteracts IFITM1 activity by enhancing its degradation through MARCH8-mediated K48 ubiquitination, thereby suppressing NF-κB activation. More importantly, A179L deletion in ASFV enhanced NF-κB activation and increased pro-inflammatory cytokine production. These findings provide novel insights into the roles of IFITM1 in innate immunity and reveal a novel mechanism by which A179L regulates the NF-κB signaling pathway.

Acknowledgements

We thank all of members at Dr. Chen’s lab for their suggestions and excellent technical assistance.

Authors’ contributions

X.S., L.Z. and J.Z. carried out experiments and analyzed the data. K.S., Z.C. and Y.Y.G. conceived and supervised the study. X.S., Z.C. and C.M. designed the experiments and wrote the manuscript. All authors read and approved the final manuscript.

Funding

This work was funded by the National Key Research and Development Program of China (2021YFD1800104), the 111 Project D18007, and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) to Z.C.

Data availability

Data is provided within the manuscript.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xiamei Sun and Liqi Zhu shared the first authorship.

References

  • 1.Galindo I, Alonso C. African swine fever virus: a review. Viruses. 2017;9(5):103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rajkhowa TK, Kiran J, Hauhnar L, Zodinpui D, Paul A, Sagolsem S. Molecular detection and characterization of African swine fever virus from field outbreaks in domestic pigs, Mizoram, India. Transbound Emerg Dis. 2022;69(4):e1028-36. [DOI] [PubMed] [Google Scholar]
  • 3.Wu J, Zheng H, Gong P. Crystal structure of African swine fever virus pE301R reveals a ring-shaped trimeric DNA sliding clamp. J Biol Chem. 2023;299(7): 104872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wang Y, Kang W, Yang W, Zhang J, Li D, Zheng H. Structure of African swine fever virus and associated molecular mechanisms underlying infection and immunosuppression: a review. Front Immunol. 2021;12:715582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Afe AE, Shen ZJ, Guo X, Zhou R, Li K. African swine fever virus interaction with host innate immune factors. Viruses. 2023;15(6):1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zheng W, Xia N, Zhang J, Cao Q, Jiang S, Luo J, Wang H, Chen N, Zhang Q, Meurens F, Zhu J. African swine fever virus structural protein p17 inhibits cGAS-STING signaling pathway through interacting with STING. Front Immunol. 2022;13:941579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.He WR, Yuan J, Ma YH, Zhao CY, Yang ZY, Zhang Y, Han S, Wan B, Zhang GP. Modulation of host antiviral innate immunity by African swine fever virus: a review. Anim (Basel). 2022;12(21):2935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yu M, Chen J, Bao Y, Li J. Genomic analysis of NF-κB signaling pathway reveals its complexity in Crassostrea gigas. Fish Shellfish Immunol. 2018;72:510–8. [DOI] [PubMed] [Google Scholar]
  • 9.Hayden MS, West AP, Ghosh S. NF-κB and the immune response. Oncogene. 2006;25:6758–80. [DOI] [PubMed] [Google Scholar]
  • 10.Miskin JE, Abrams CC, Dixon LK. African swine fever virus protein A238L interacts with the cellular phosphatase calcineurin via a binding domain similar to that of NFAT. J Virol. 2000;74(20):9412–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang F, Moon A, Childs K, Goodbourn S, Dixon LK. The African swine fever virus DP71L protein recruits the protein phosphatase 1 catalytic subunit to dephosphorylate eIF2alpha and inhibits CHOP induction but is dispensable for these activities during virus infection. J Virol. 2010;84(20):10681–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hurtado C, Granja AG, Bustos MJ, Nogal ML, González de Buitrago G, de Yébenes VG, Salas ML, Revilla Y, Carrascosa AL. The C-type lectin homologue gene (EP153R) of African swine fever virus inhibits apoptosis both in virus infection and in heterologous expression. Virology. 2004;326(1):160–70. [DOI] [PubMed] [Google Scholar]
  • 13.Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev. 2001;14(4):778–809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhuo Y, Guo Z, Ba T, Zhang C, He L, Zeng C, Dai H. African swine fever virus MGF360-12L inhibits type i interferon production by blocking the interaction of importin α and NF-κB signaling pathway. Virol Sin. 2021;36(2):176–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Liao Y, Goraya MU, Yuan X, Zhang B, Chiu SH, Chen JL. Functional involvement of interferon-inducible transmembrane proteins in antiviral immunity. Front Microbiol. 2019;10:1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Muñoz-Moreno R, Cuesta-Geijo MÁ, Martínez-Romero C, Barrado-Gil L, Galindo I, García-Sastre A, Alonso C. Antiviral role of IFITM proteins in African swine fever virus infection. PLoS One. 2016;11(4):e0154366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Banjara S, Caria S, Dixon LK, Hinds MG, Kvansakul M. Structural insight into African swine fever virus A179L-mediated inhibition of apoptosis. J Virol. 2017;91(6):e02228-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hernaez B, Cabezas M, Muñoz-Moreno R, Galindo I, Cuesta-Geijo MA, Alonso C. A179l, a new viral Bcl2 homolog targeting Beclin 1 autophagy related protein. Curr Mol Med. 2013;13(2):305–16. [PubMed] [Google Scholar]
  • 19.Dodantenna N, Ranathunga L, Chathuranga WAG, Weerawardhana A, Cha JW, Subasinghe A, Gamage N, Haluwana DK, Kim Y, Jheong W, et al. African swine fever virus EP364R and C129R target cyclic GMP-AMP to inhibit the cGAS-STING signaling pathway. J Virol. 2022;96(15):e0102222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Provance OK, Geanes ES, Lui AJ, Roy A, Holloran SM, Gunewardena S, Hagan CR, Weir S, Lewis-Wambi J. Disrupting interferon-alpha and NF-kappaB crosstalk suppresses IFITM1 expression attenuating triple-negative breast cancer progression. Cancer Lett. 2021;514:12–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Xiong C, Li B, Song R, Ma Z, Huber SA, Liu W. IFITM3 mediates inflammation induced myocardial injury through JAK2/STAT3 signaling pathway. Mol Immunol. 2024;167:1–15. [DOI] [PubMed] [Google Scholar]
  • 22.Israël A. The IKK complex, a central regulator of NF-kappaB activation. Cold Spring Harb Perspect Biol. 2010;2(3): a000158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang X, Pattison JS, Su H. Posttranslational modification and quality control. Circ Res. 2013;112(2):367–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ardley HC, Robinson PA. E3 ubiquitin ligases. Essays Biochem. 2005;41:15–30. [DOI] [PubMed] [Google Scholar]
  • 25.Hatakeyama S. Trim family proteins: roles in autophagy, immunity, and carcinogenesis. Trends Biochem Sci. 2017;42(4):297–311. [DOI] [PubMed] [Google Scholar]
  • 26.Fujita H, Iwabu Y, Tokunaga K, Tanaka Y. Membrane-associated RING-CH (MARCH) 8 mediates the ubiquitination and lysosomal degradation of the transferrin receptor. J Cell Sci. 2013;126(Pt 13):2798–809. [DOI] [PubMed] [Google Scholar]
  • 27.Heath RJ, Goel G, Baxt LA, Rush JS, Mohanan V, Paulus GLC, Jani V, Lassen KG, Xavier RJ. RNF166 determines recruitment of adaptor proteins during antibacterial autophagy. Cell Rep. 2016;17(9):2183–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu X, Siggel M, Ovchinnikov S, Mi W, Svetlov V, Nudler E, Liao M, Hummer G, Rapoport TA. Structural basis of ER-associated protein degradation mediated by the Hrd1 ubiquitin ligase complex. Science. 2020;368(6489):eaaz2449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hiscott J, Nguyen TL, Arguello M, Nakhaei P, Paz S. Manipulation of the nuclear factor-kappaB pathway and the innate immune response by viruses. Oncogene. 2006;25(51):6844–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yang K, Xue Y, Niu T, Li X, Cheng M, Bao M, Zou B, Shi C, Wang J, Yang W, et al. African swine fever virus MGF505-7R protein interacted with IRF7and TBK1 to inhibit type I interferon production. Virus Res. 2022;322: 198931. [DOI] [PubMed] [Google Scholar]
  • 31.Hong J, Chi X, Yuan X, Wen F, Rai KR, Wu L, Song Z, Wang S, Guo G, Chen JL. I226R protein of African swine fever virus is a suppressor of innate antiviral responses. Viruses. 2022;14(3):575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Reis AL, Rathakrishnan A, Goulding LV, Barber C, Goatley LC, Dixon LK. Deletion of the gene for the African swine fever virus BCL-2 family member A179L increases virus uptake and apoptosis but decreases virus spread in macrophages and reduces virulence in pigs. J Virol. 2023;97(10):e0110623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ren L, Du S, Xu W, Li T, Wu S, Jin N, Li C. Current progress on host antiviral factor IFITMs. Front Immunol. 2020;11:543444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yang G, Xu Y, Chen X, Hu G. IFITM1 plays an essential role in the antiproliferative action of interferon-gamma. Oncogene. 2007;26(4):594–603. [DOI] [PubMed] [Google Scholar]
  • 35.Schmid JA, Birbach A. IkappaB kinase beta (IKKbeta/IKK2/IKBKB)-a key molecule in signaling to the transcription factor NF-kappaB. Cytokine Growth Factor Rev. 2008;19(2):157–65. [DOI] [PubMed] [Google Scholar]
  • 36.Yang J, Li S, Feng T, Zhang X, Yang F, Cao W, Chen H, Liu H, Zhang K, Zhu Z, et al. African swine fever virus F317L protein inhibits NF-κB activation to evade host immune response and promote viral replication. mSphere. 2021;6(5):e0065821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ayinde D, Maudet C, Transy C, Margottin-Goguet F. Limelight on two HIV/SIV accessory proteins in macrophage infection: is vpr?x overshadowing vpr?? Retrovirology. 2010;7:35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhu H, Zheng C. The race between host antiviral innate immunity and the immune evasion strategies of herpes simplex virus 1. Microbiol Mol Biol Rev. 2020;84(4):e00099–20. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data is provided within the manuscript.


Articles from Cell Communication and Signaling : CCS are provided here courtesy of BMC

RESOURCES