Abstract
Autosomal Dominant Polycystic Kidney Disease (ADPKD) is a monogenic disorder caused by mutations in PKD1 or PKD2, encoding polycystin-1 and polycystin-2, respectively. These polycystins form a cilia-localized complex that, when mutated, fails to inhibit an uncharacterized cilia-dependent cyst activation (CDCA) signal. This leads to progressive bilateral cyst growth and ultimately compromised renal function. Previous in vitro and in vivo studies from our group demonstrated that Hedgehog (Hh) signaling inhibition reduced renal cystic severity in PKD models. To further investigate, we inactivated several Hh pathway components (Gli1, Gli2, Gli3, Smo) in a Pkd1 hypomorphic mouse model through conditional deletion by tamoxifen-induced Cre-Lox recombination. We assessed cystic severity using kidney weight assessment and a microCT-based 3D imaging assay. Contrary to expectations, inactivation of Gli1 and Smo significantly increased cystogenesis. These findings suggest that Hh signaling does not mediate the CDCA signal but may instead contribute to maintaining renal epithelial integrity.
Introduction
Polycystic kidney disease (PKD) refers to a group of monogenic disorders characterized by the formation of bilateral renal cysts. Autosomal dominant polycystic kidney disease (ADPKD), the most common form of PKD, is caused by mutations in the genes PKD1 (85% of cases) and PKD2 (15% of cases). The disease is marked by the progressive growth of fluid-filled cysts derived from renal tubular epithelial cells [1]. Over time, cyst expansion displaces and compresses the surrounding kidney parenchyma, impairing renal function and leading to end-stage renal disease at a median age of 58 for PKD1-related mutations and 79 for PKD2-related mutations [2].
While the precise pathogenesis of PKD remains unclear, primary cilia are strongly implicated in the disease mechanism [13, 4]. Primary cilia are non-motile, microtubule-based organelles that protrude from the apical surface of renal epithelial cells into the lumen, functioning as sensory structures that detect and respond to extracellular signals. Proper ciliary function relies on intraflagellar transport (IFT), a bidirectional protein transport system that moves components along the microtubule core [5]. Disruptions in IFT-related genes or other cilia related genes can lead to a spectrum of disorders collectively known as ciliopathies, one of which is PKD. Early studies showed that mutations in the IFT gene Tg737 (IFT88) result in ciliary malformations and cyst formation in renal tubular cells [6]. Moreover, evidence of NPHP proteins, encoded from genes involved in Nephronophthisis, a type of recessive cystic kidney disease, localize and are involved with proper ciliary function [14, 15]. For example, defects in the NIMA-related kinase (Nek) family, specifically Nek8, which are found in the basal bodies of cilia, cause the development of juvenile cystic kidney disease, further cementing the role of cilia in cystogenesis [33, 37].
Among the known primary cilia-associated proteins are polycystin-1 (PC1) and polycystin-2 (PC2), which are encoded by PKD1 and PKD2 respectively. PC1 and PC2 co-localize to the membrane of primary cilia in the epithelium of the kidney and act in tandem to form a receptor-ion channel complex that regulates cellular calcium ion levels [3]. Additionally, the polycystin complex has also been hypothesized to negatively regulate an uncharacterized cilia-dependent cyst activation (CDCA) signaling pathway, distinct from MAPK/ERK, mTOR, or cAMP pathways [4].
Given the established connection between cilia and PKD pathogenesis [11, 12] and the evidence of a novel cyst activation pathway that require functional primary cilia [4], we sought to investigate the role of Hedgehog (Hh) signaling, a pathway mediated by primary cilia, in ADPKD. Specifically, we hypothesized that aberrant Hh signaling could underlie the CDCA pathway involved in cyst growth activation. Previously, using a N-ethyl-N-nitrosourea–derived Ttc21b-mutant mouse model, which carries a mutation in an IFT gene and develops cystic kidneys [7], our group demonstrated that suppressing overactive Hh signaling both genetically and pharmacologically reduced the cystogenic potential of mutant kidney explants [8]. This was also observed in the jck cystic kidney disease model, which carrys a mutation in the Nek8 kinase [33]. Most importantly with respect to this study, inhibition of Hh signaling in Pkd1 null mutant kidney explant cultures reduced cyst formation [8].
These results suggested Hh signaling as a candidate for the CDCA pathway. To explore this, we used the hypomorphic Pkd1 p.R3277C (RC) mouse model [9], which mimics the cystogenic process observed in human ADPKD and provides an attractive choice for our study. Mice that carry the typical human disease genotype Pkd1+/− or Pkd2+/− only develop a few kidney cysts, making them poor models to study PKD. Biallelic Pkd1 inactivation models are embryonically lethal at mid gestation while inducible Pkd1 deletion models can present with a spectrum in the intensity and progression of the PKD phenotype depending on timing of inactivation or recombination efficiency, which could differ between mice [10]. The RC allele offers a consistent model of progressive cyst growth, which facilitates quantitative assessment of disease severity and amelioration
Using this model, we aimed to assess the effect of Hh pathway inactivation on cyst progression and further elucidate the mechanistic role of Hh signaling in ADPKD pathogenesis. We leveraged the Cre-LoxP system to conditionally delete components of the Hh signaling pathway (Smo, Gli2, and Gli3) at postnatal day 13.5 (p13.5) and assessed the cystic state of the kidneys at 90 days using gross morphology and microcomputed tomography (micro-CT) analysis. Gli1 null homozygous cystic kidneys were also analyzed. In contrast to our previous results, we found that repression of the Hh pathway increased the progression of polycystic disease in a hypomorphic Pkd1 model and we conclude that it does not contribute to PKD pathogenesis as a CDCA signal.
Results
Micro-CT analysis of Pkd1RC/RC mice illustrates progressive renal cyst development 90 days postnatally
To investigate the role of Hedgehog (Hh) signaling in PKD pathogenesis, we utilized a mouse model carrying the knock-in Pkd1 p.R3277C mutation (Pkd1tm1.1Pcha, called here Pkd1RC). This mutation mimics the human PKD1 p.R3277C allele and leads to approximately a 60% reduction in mature PC1 due to inefficient cleavage and folding [9]. Homozygous Pkd1RC/RC mice exhibit early-onset cystogenesis, with cystic expansion progressing throughout their lifespan.
To evaluate the cystic profile of the diseased kidneys, we utilized micro-CT imaging, a method that enables a comprehensive and quantitative assessment. This technique allowed for efficient and high-throughput analysis of kidney samples. To validate the reliability of micro-CT for assessing renal cystic burden and to establish the time-course of postnatal cyst development of Pkd1RC/RC kidneys, we compared the cystic volume (CV) index derived from micro-CT imaging to the conventional kidney weight-to-body weight (KW/BW) ratio metric. Kidneys were collected and analyzed at four time points: 21, 44, 67, and 90 days postnatally.
We observed a correlation between CV index and KW/BW ratio, with an R2 value of 0.65 (p < 0.0001), confirming the validity of micro-CT as an independent measure in the evaluation of cystic kidneys (Figure 1D). These findings validate the utility of micro-CT for cystic analysis and establish this model as a robust platform for studying progressive PKD pathogenesis and therapeutic interventions.
Figure 1.

Pkd1RC/RC kidneys progressively develop cysts 90 days postnatally. (A) Micro-CT cross sections from representative Pkd1RC/RC kidneys from each time point (P21, P44, P67, P90) in the time series analysis with a P90 Pkd1+/+ control. (B) Average cystic volume percentage (CV %) and (C) kidney weight-to-body weight (KW/BW) ratio of cystic kidneys at each time point with standard deviation. (D) CV % and KW/BW % plotted for each mouse to assess correlation between the two metrics. P21 mice excluded due to weak correlation, likely reflecting early disease stage and minimal cystic burden. n=11 P21; n=20 P44; n=12 P67; n=13 P90.
Gli1 Absence Increases Cystic Severity in Pkd1 Mutant Mice
To evaluate the role of Hh signaling in PKD pathogenesis, we first investigated the effects of inactivating Gli1, a transcriptional activator that mediates Hh signaling expression. Unlike other Hh-associated transcription factors, Gli1 is not essential for mouse embryonic development or postnatal survival [16, 19], allowing us to generate viable Gli1 null homozygous mice. Using the Gli1lacZ null mutant knock-in mouse [16], we crossed Gli1 null homozygous mice to Pkd1RC/RC mice to produce double mutants.
We compared the cystic profiles of Gli1; Pkd1 double mutant kidneys and Pkd1 single mutant kidneys at 90 days postnatally. Analysis revealed a significantly larger cystic burden in the double mutant kidneys compared to the single mutants, with KW/BW ratio indicating a 1.45 average fold increase (Figure 2A) and CV index indicating a 1.78 average fold increase (Figure 2B). These findings demonstrate that attenuated Hh pathway activity via Gli1 inactivation exacerbates renal cyst development and expansion in the context of Pkd1 mutations.
Figure 2.

Attenuated Hedgehog signaling through Gli1 inactivation increases cystic severity in Pkd1RC/RC mice. (A) KW/BW ratio and (B) CV % of 90-day Pkd1RC/RC mouse kidneys with and without Gli1 expression. Comparison of the datasets were done using the Mann-Whitney test and presented as mean ± standard error of mean (SEM). ***P=0.0001; ****P<0.0001.
Deletion of Gli2 and Gli3 Does Not Affect the Cystic Phenotype in Pkd1 Mutant Mice
Given that Gli1 is not a primary driver of Hh signaling and functions as a downstream target of Gli2 and Gli3 to amplify their activity [20, 21, 22, 23], we next investigated whether the deletion of Gli2 and Gli3, the primary modulators of Hh signaling, influences the cystic phenotype in Pkd1 mutant mice. To test this, we utilized R26CreER [24], a tamoxifen-inducible Cre-mediated recombination system that is ubiquitously expressed, to inactivate Gli2 and Gli3 floxed genes [34, 35]. Progeny from crosses between Gli2flox/flox; Gli3flox/flox; Pkd1RC/RC and ROSA26CreERT/+ carriers were used to generate two groups: experimental mice (Gli2; Gli3; Pkd1 triple mutants with Cre expression) and control mice (Gli2; Gli3; Pkd1 triple mutants without Cre expression) (Supplemental Figure 2).
At p13.5, we administered tamoxifen to induce Cre-mediated recombination for Gli2 and Gli3 deletion. At 90 days, we assessed the cystic profiles of the kidneys. Both groups exhibited comparable cystic phenotypes, with the average KW/BW ratio being 2.4% in the experimental group and 2.5% in the control group (Figure 3A), while the CV indices were 80.7% and 80.9%, respectively (Figure 3B). Since both kidneys from the experimental mice were fixed and stained for imaging, we tested a subsequent litter to assess recombination efficiency of our protocol. This revealed an average recombination rate of 21% for Gli2 and 74% for Gli3 (Table 1). These results indicate that reduction of Gli2 and Gli3 gene expression does not ameliorate cyst formation or progression in a mutant Pkd1 mouse model.
Figure 3.

Attenuated Hedgehog signaling through Gli2 and Gli3 inactivation has no effect on cystic severity in Pkd1RC/RC mice. (A) KW/BW ratio and (B) CV % of mice with and without Cre recombinase expression. Gli2flox/flox; Gli3flox/flox; Pkd1RC/RC mice with or without R26CreER were administered tamoxifen at P13.5 to induce the deletion of Gli2 and Gli3. Kidneys were analyzed at 90 days. Comparison of the datasets were done using the Mann-Whitney test, presented as mean ± SEM, and demonstrated no significant differences.
Table 1:
qPCR analysis of tamoxifen-mediated gene deletion in Gli2flox/flox; Gli3flox/flox; Pkd1RC/RC; ROSA26CreERT/+ mice.
| Sample | Gli2 Recombination % | Gli3 Recombination % |
|---|---|---|
| 643 | 6.0 | 21.2 |
| 646 | 13.8 | 67.4 |
| 651 | 50.6 | 95.4 |
| 653 | 20.2 | 117.5 |
| Average | 22.6 | 75.4 |
| Standard deviation | 16.9 | 36.0 |
Deletion of Smo Increases the Cystic Burden on Pkd1 Mutant Kidneys
To definitively characterize the role of Hh signaling in cyst formation in Pkd1 cystic kidneys, we examined the effects of inactivating Hh signaling through the deletion of Smoothened (Smo). Smo serves as a primary activator of Hh signaling through mediating canonical, ligand-dependent pathway activation by accumulating at the distal tip of the primary cilium to facilitate the processing of Gli transcription factors into their active forms [17, 18].
One potential confounder for this analysis is the evidence that the severity of the RC mutation is sensitive to strain background [40]. We therefore introgressed a well-characterized floxed Smo allele [38] into the C57BL/6J (B6) background for >10 generations [39] and mated these with Pkd1RC/RCand ROSA26Cre+/+ mice to generate progeny with the genotypes Smoflox/flox; Pkd1RC/RC; ROSA26Cre+/+ (control) and Smoflox/flox; Pkd1RC/RC; ROSA26CreERT/+ (experimental) (Supplemental Figure 3). Pups were administered tamoxifen at p13.5 and euthanized at 90 days to assess their phenotypes.
qPCR analysis confirmed partial deletion of Smo, with an average deletion efficiency of 40% across the experimental cohort (Table 2). Despite this incomplete deletion, the mice exhibited a more severe cystic phenotype. Compared to controls, the experimental group demonstrated a 1.24-fold increase in KW/BW ratio (Figure 4A) and a 1.61-fold increase in CV percentage (Figure 4B). These findings suggest that inactivation of Hh signaling through Smo deletion exacerbates, rather than mitigates, the cystic phenotype associated with the Pkd1 mutation, even when deletion is incomplete.
Table 2:
qPCR analysis of tamoxifen-mediated gene deletion in Smoflox/flox; Pkd1RC/RC; ROSA26CreERT/+ mice.
| Sample | Smo Recombination % |
|---|---|
| 505 | 67.8 |
| 552 | 38.0 |
| 553 | 20.5 |
| 557 | 27.2 |
| 558 | 23.7 |
| 565 | 74.1 |
| 569 | 46.6 |
| Average | 40.0 |
| Standard deviation | 18.8 |
Figure 4.

Attenuated Hedgehog signaling through Smo inactivation increased cystic severity in Pkd1RC/RC mice. (A) KW/BW ratio and (B) CV % of mice with and without Cre recombinase expression. Smoflox/flox; Pkd1RC/RC; mice with or without R26CreER were administered tamoxifen at P13.5 to induce the deletion of Smo. Kidneys were analyzed at 90 days. Comparison of the datasets were done using the Mann-Whitney test and presented as mean ± SEM. **P=0.0093; ***P=0.0001.
Methods
Mouse Husbandry
Dr. Peter Harris kindly provided the Pkd1tm1.1Pcha mutant line, called here Pkd1RC [9]. The Hh pathway mutant alleles we used included Gli1tm2Alj/J [16], Gli2tm6Alj/J ([34], Gli3tm1Alj/J [35] and Smotm2Amc/J [38, 39]. The Gli2 and Gli3 alleles were carried in a double mutant line generously shared by Dr. Samantha Brugmann. Tamoxifen-induced recombination was mediated using the strain B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J [24]. Breeding strategies to generate Hh-deficient mutants and controls are shown in Supplemental Figures 1–3. This study was approved by the Seattle Children’s Research Institute IACUC Committee and we adhere to the NIH Guide for the Care and Use of Laboratory Animals.
Tamoxifen administration
Tamoxifen solution was made up in corn oil at a concentration of 10 mg/ml. 50 ul was injected intraperitoneally at p13.5.
Kidney Processing
In preparation for micro-CT scanning, kidneys were fixed in 4% paraformaldehyde solution overnight at 4C. To provide contrast for micro-CT analysis, kidneys were stained with Phosphotungstic Acid Hematoxylin (PTAH, 2% Phosphotungstic acid, 0.1% Harris Hematoxylin). Kidneys were washed several times with PBS to remove residual PFA before immersion in PTAH solution until fully stained. Stained kidney samples were stored in 70% ethanol at 4 °C.
For preservation for genomic DNA acquisition, kidneys were flash frozen in liquid nitrogen and stored at −80 °C.
Micro-CT Image Acquisition and Analysis
Micro-CT imagining was performed on the Bruker SkyScan 1272 CMOS Edition, with scanning parameter of 55 kV and 179 μA at a voxel size of 17.63 μm with a 0.5 mm aluminum filter. Data reconstruction was done using the NRecon software. To calculate the cystic volume percentages of the kidneys, the image reconstructions were segmented using the threshold tool in the 3D slicer program with the Slicermorph plugin [25]. Two separate segments were created, one for the tissue volume, which excludes cystic space, and one for the total kidney volume. To create the tissue segmentation, a threshold value was chosen automatically using for each sample using the auto-threshold option following the IsoData algorithm. To create the segmentation for the total kidney, the previous segment was cloned, dilated, and shrunk, resulting in a fully filled segmentation with identical boundaries. The segment statistics module was then used to calculate the cystic volume ratio.
Quantitative PCR
Genomic DNA was isolated from the kidney of tamoxifen injected mice using the PureLink Genomic DNA Mini Kit. Nucleic acid concentration was quantified using the NanoDrop ND-1000 Spectrophotometer and diluted to 10 ng/μl. qPCR was performed to detect the recombined Smo, Gli2, or Gli3 allele on a CFX96 Real-Time PCR Detection System (Bio-Rad) using SYBR Green PCR Master Mix (Applied Biosystems) with the following primers:
DB898: GCGGTCTGGCAGTAAAAACTATC (ROSA f)
DB899: GTGAAACAGCATTGCTGTCACTT (ROSA r)
DB1073: TCCGGGGAGCTCGTTTAAAC (Smo rec f)
DB1074: CCATCACGTCGAACTCCTGG (Smo rec r)
DB1081: TGAAAAGCCGAATTCTGCAGA (Gli2 rec F)
DB1082: TCGTGGAAACTATGCATCATGT (Gli2 rec R)
DB1083: CGTGGGATCCTCTAGAGTCG (Gli3 rec F)
DB1084: AGTCCACACACATAGACCATCA (Gli3 rec R)
To calculate the percentage recombination in tamoxifen injected mice, the recombined Smo, Gli2, and Gli3 PCR product was normalized to the ROSA control product using the double delta Ct method Importantly, mice homozygous for the recombined Smo allele are not viable, so genomic DNA from a Smo null/wt (heterozygous) sample was used as the control, which is equivalent to 50% total recombination. Using this as a reference, the quantification of the recombined Smo alleles in the tamoxifen-injected mice were corrected by a factor of two. Individual samples were performed in triplicate. Cycling conditions were 95 C for 3 minutes followed by 40 cycles of 2 step PCR of 95 C for 10 seconds and 60 C for 30 seconds.
Statistical Testing
Statistical significance was determined using the Mann-Whitney test. All data is presented as mean ± standard error of mean. A significance threshold of 0.05 was used.
Discussion
A significant advance in the characterization of the biology related to PKD was the recognition that a number of proteins implicated in cystic kidney disease in humans and mouse models appear to have a role in cilial function (Taulman et al. 2001; Hou et al. 2002; Yoder et al. 2002). These include genes causal for disorders such as Bardet-Biedl Syndrome (BBS) and Nephronophthisis (NPHP) (Hildebrandt et al. 2011). In most cases, cystic disease was associated with loss-of-function mutations.
Given this, an elegant study in which the disruption of cilia was found to suppress cyst growth in Pkd1 and Pkd2 conditional mutants was a surprise (Ma et al. 2013). The authors conclude from their experiments that there is a “polycystin-inhibited, cilial dependent proliferative cyst-promoting pathway”. This is of note, as inhibition of this presumptive pathway would be a potential therapeutic avenue for PKD.
Importantly, we had good evidence that Hh signaling should be evaluated as a candidate for this cilial-dependent, proliferative cyst-promoting pathway. This hypothesis is based on our studies of PKD in a very diferent context; specifically, as a consequence of the perinatal deletion of Ttc21b, the mammalian ortholog of IFT139. We originally discovered Ttc21b in a screen for ENU-induced mutations that affect organogenesis. Our studies revealed that a mutation in this cilial gene resulted in defective retrograde intraflagellar transport and over-active Hh signaling (Tran et al. 2008). The constitutive mutation had severe developmental defects, consistent with the known importance of Hh signaling in early development, which resulted in embryonic lethality.
Surprisingly, when Ttc21b is deleted in the perinatal period, the most robust phenotypic consequence was rapidly progressive PKD [8]. We further showed that genetic and pharmacologic inhibition of Hh signaling reduced cystic kidney disease in this model and in kidney explants carrying mutations of Nek8 or Pkd1. Our inference that Hh signaling mediates cystic disease was supported by examination of renal epithelium from human patients with ADPKD [26]. A role for Hh signaling in exacerbating cystic disease was shown in additional studies, although these did not utilize polycystin mutant models, [28, 36]
A prior study by Ma et al. tested Hh pathway inactivation in a Pkd1 conditional mouse model and reported no significant evidence of Hh signaling mediating renal cystogenesis [27]. Our approach differed by utilizing a Pkd1 hypomorphic model with constitutive disease, a larger sample size, and a micro-CT-based method to comprehensively assess cystic profiles.
We established that micro-CT imaging is a reliable tool for characterizing and analyzing cystic kidneys by comparing it to the conventional kidney weight-to-body weight (KW/BW) ratio when defining the 90-day developmental period of Pkd1RC/RC mice. Using this validated approach, we found that Gli1 inactivation led to a significant increase in cystic severity as measured by both KW/BW ratio and micro-CT analysis. Conversely, conditional deletion of Gli2 and Gli3 resulted in no significant change. qPCR assessment revealed a 3-fold higher recombination rate of Gli3 compared to Gli2, the prominent activator the Hh pathway. Additionally, deletion occurs stochastically, with variability spatially within the kidney and cellularly for both genes, which could confound the interpretation of the results.
To more conclusively assess whether the Hh pathway mediates the hypothesized CDCA signal, we tested the consequences of deleting Smo, a key mediator of canonical Hh signaling, on disease severity in Pkd1RC/RC mice. Even incomplete deletion of Smo did not ameliorate the cystic phenotype but instead exacerbated cystogenesis. Individually, there was not a strong correlation between percent recombination and cystic severity; however, this may be due to the natural individual phenotypic variability that occurs in cystic kidney disease manifestation that can be obscuring the relation.
The finding that genome-wide attenuation of Hh signaling increases PKD severity could be explained by a combination of mechanisms. Increased cell proliferation and a pro-inflammatory microenvironment are well-documented drivers of cystogenesis in PKD [30, 31]. A study by Peng et al. demonstrates Hedgehog’s role in regulating mesenchymal cell quiescence, showing that epithelial-specific loss of Sonic Hedgehog (Shh) and mesenchymal-specific deletion of Smo in the adult lung can lead to mesenchymal cell proliferation and expansion around the airway epithelium and in alveolar interstitial regions [29]. Moreover, studies have demonstrated increased T cell infiltration into cystic lesions in Pkd1RC/RC mice, with disease severity correlating with the extent of inflammation [31]. Impaired Hh signaling in CD4+ T cells has been shown to enhance inflammatory cytokine production, exacerbating neuroinflammatory conditions like multiple sclerosis and experimental autoimmune encephalomyelitis [32]. This disruption in immune response modulation by Hh inactivation may lead to unchecked activity that confers increased inflammation and tissue damage, worsening cystic progression. Taken together, these findings suggest the possibility that disruption of Hh signaling may lead to dysregulated mesenchymal cell activity and heightened inflammatory responses, contributing to the increased cystic severity observed in Pkd1 hypomorphic mice with genome wide attenuated Hh signaling.
In summary, our findings support previous results that suggest that Hh signaling is unlikely to contribute to the hypothesized CDCA signal [27]. However, the results implicate its potential role in maintaining renal epithelial and parenchyma integrity and highlight its involvement in PKD pathogenesis. Our study is the first to demonstrate a harmful outcome from Hh inactivation in cystic kidney disease. Previous reports have purported a protective effect from Hh attenuation [8, 26, 28, 36] in various cystic kidney models, while one study [27] found no effect. As the role of Hh signaling in cystogenesis remains ambiguous, further study is warranted to elucidate its contribution to renal cystic disease.
Supplementary Material
Bibliography
- 1).Horie S, Mochizuki T, Muto S, Hanaoka K, Fukushima Y, Narita I, Nutahara K, Tsuchiya K, Tsuruya K, Kamura K, Nishio S, Suwabe T, Ubara Y, Ishimura E, Nakanishi K, Furukawa K, Kimura K, Matsuo S. Evidence-based clinical practice guidelines for polycystic kidney disease 2014. Clin Exp Nephrol. 2016. Aug;20(4):493–509. doi: 10.1007/s10157-015-1219-7. Erratum in: Clin Exp Nephrol. 2016 Aug;20(4):510. doi: 10.1007/s10157–016-1285–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2).Cornec-Le Gall E, Audrézet MP, Chen JM, Hourmant M, Morin MP, Perrichot R, Charasse C, Whebe B, Renaudineau E, Jousset P, Guillodo MP, Grall-Jezequel A, Saliou P, Férec C, Le Meur Y. Type of PKD1 mutation influences renal outcome in ADPKD. J Am Soc Nephrol. 2013. May;24(6):1006–13. doi: 10.1681/ASN.2012070650. Epub 2013 Feb 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3).Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJ, Ingber DE, Zhou J. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat Genet. 2003. Feb;33(2):129–37. doi: 10.1038/ng1076. Epub 2003 Jan 6. [DOI] [PubMed] [Google Scholar]
- 4).Ma M, Tian X, Igarashi P, Pazour GJ, Somlo S. Loss of cilia suppresses cyst growth in genetic models of autosomal dominant polycystic kidney disease. Nat Genet. 2013. Sep;45(9):1004–12. doi: 10.1038/ng.2715. Epub 2013 Jul 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5).Ishikawa H, Marshall WF. Intraflagellar Transport and Ciliary Dynamics. Cold Spring Harb Perspect Biol. 2017. Mar 1;9(3):a021998. doi: 10.1101/cshperspect.a021998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6).Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, Witman GB, Cole DG. Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene tg737, are required for assembly of cilia and flagella. J Cell Biol. 2000. Oct 30;151(3):709–18. doi: 10.1083/jcb.151.3.709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7).Tran PV, Haycraft CJ, Besschetnova TY, Turbe-Doan A, Stottmann RW, Herron BJ, Chesebro AL, Qiu H, Scherz PJ, Shah JV, Yoder BK, Beier DR. THM1 negatively modulates mouse sonic hedgehog signal transduction and affects retrograde intraflagellar transport in cilia. Nat Genet. 2008. Apr;40(4):403–410. doi: 10.1038/ng.105. Epub 2008 Mar 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8).Tran PV, Talbott GC, Turbe-Doan A, Jacobs DT, Schonfeld MP, Silva LM, Chatterjee A, Prysak M, Allard BA, Beier DR. Downregulating hedgehog signaling reduces renal cystogenic potential of mouse models. J Am Soc Nephrol. 2014. Oct;25(10):2201–12. doi: 10.1681/ASN.2013070735. Epub 2014 Apr 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9).Hopp K, Ward CJ, Hommerding CJ, Nasr SH, Tuan HF, Gainullin VG, Rossetti S, Torres VE, Harris PC. Functional polycystin-1 dosage governs autosomal dominant polycystic kidney disease severity. J Clin Invest. 2012. Nov;122(11):4257–73. doi: 10.1172/JCI64313. Epub 2012 Oct 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10).Piontek K, Menezes LF, Garcia-Gonzalez MA, Huso DL, Germino GG. A critical developmental switch defines the kinetics of kidney cyst formation after loss of Pkd1. Nat Med. 2007. Dec;13(12):1490–5. doi: 10.1038/nm1675. Epub 2007 Oct 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11).Pazour GJ, Quarmby L, Smith AO, Desai PB, Schmidts M. Cilia in cystic kidney and other diseases. Cell Signal. 2020. May;69:109519. doi: 10.1016/j.cellsig.2019.109519. Epub 2019 Dec 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12).Ta CM, Vien TN, Ng LCT, DeCaen PG. Structure and function of polycystin channels in primary cilia. Cell Signal. 2020. Aug;72:109626. doi: 10.1016/j.cellsig.2020.109626. Epub 2020 Apr 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13).Ma M, Gallagher AR, Somlo S. Ciliary Mechanisms of Cyst Formation in Polycystic Kidney Disease. Cold Spring Harb Perspect Biol. 2017. Nov 1;9(11):a028209. doi: 10.1101/cshperspect.a028209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14).Otto EA, Schermer B, Obara T, O’Toole JF, Hiller KS, Mueller AM, Ruf RG, Hoefele J, Beekmann F, Landau D, Foreman JW, Goodship JA, Strachan T, Kispert A, Wolf MT, Gagnadoux MF, Nivet H, Antignac C, Walz G, Drummond IA, Benzing T, Hildebrandt F. Mutations in INVS encoding inversin cause nephronophthisis type 2, linking renal cystic disease to the function of primary cilia and left-right axis determination. Nat Genet. 2003. Aug;34(4):413–20. doi: 10.1038/ng1217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15).Wolf MT, Hildebrandt F. Nephronophthisis. Pediatr Nephrol. 2011. Feb;26(2):181–94. doi: 10.1007/s00467-010-1585-z. Epub 2010 Jul 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16).Brian Bai C, Wojtek Auerbach, Joon S. Lee, Daniel Stephen, Alexandra L. Joyner; Gli2, but not Gli1, is required for initial Shh signaling and ectopic activation of the Shh pathway. Development 15 October 2002; 129 (20): 4753–4761. doi: 10.1242/dev.129.20.4753 [DOI] [PubMed] [Google Scholar]
- 17).Carballo GB, Honorato JR, de Lopes GP et al. A highlight on Sonic hedgehog pathway. Cell Commun Signal 16, 11 (2018). 10.1186/s12964-018-0220-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18).Kim J, Kato M, Beachy PA. Gli2 trafficking links Hedgehog-dependent activation of Smoothened in the primary cilium to transcriptional activation in the nucleus. Proc Natl Acad Sci U S A. 2009. Dec 22;106(51):21666–71. doi: 10.1073/pnas.0912180106. Epub 2009 Dec 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19).Park HL, Bai C, Platt KA, Matise MP, Beeghly A, C. c. Hui M. Nakashima AL. Joyner; Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Development 15 April 2000; 127 (8): 1593–1605. doi: 10.1242/dev.127.8.1593 [DOI] [PubMed] [Google Scholar]
- 20).Sasaki Hiroshi, Nishizaki Yuriko, Hui Chi-chung, Nakafuku Masato, Hisato Kondoh; Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development 1 September 1999; 126 (17): 3915–3924. doi: 10.1242/dev.126.17.3915 [DOI] [PubMed] [Google Scholar]
- 21).Ikram MS, Neill GW, Regl G, Eichberger T, Frischauf AM, Aberger F, Quinn A, Philpott M. GLI2 is expressed in normal human epidermis and BCC and induces GLI1 expression by binding to its promoter. J Invest Dermatol. 2004. Jun;122(6):1503–9. doi: 10.1111/jese.0022-202X.2004.22612.x. [DOI] [PubMed] [Google Scholar]
- 22).Dai Ping, Akimaru Hiroshi, Tanaka Yasunori, Maekawa Toshio, Nakafuku Masato, Ishii Shunsuke, Sonic Hedgehog-induced Activation of the Gli1Promoter Is Mediated by GLI3*, Journal of Biological Chemistry, Volume 274, Issue 12, 1999, Pages 8143–8152, ISSN 0021–9258, 10.1074/jbc.274.12.8143. [DOI] [PubMed] [Google Scholar]
- 23).Falduto GH, Pfeifer A, Zhang Q, Yin Y, Metcalfe DD, Olivera A. A Critical Function for the Transcription Factors GLI1 and GLI2 in the Proliferation and Survival of Human Mast Cells. Front Immunol. 2022. Feb 16;13:841045. doi: 10.3389/fimmu.2022.841045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24).Ventura A, Kirsch DG, McLaughlin ME, Tuveson DA, Grimm J, Lintault L, Newman J, Reczek EE, Weissleder R, Jacks T. Restoration of p53 function leads to tumour regression in vivo. Nature. 2007. Feb 8;445(7128):661–5. doi: 10.1038/nature05541. Epub 2007 Jan 24. [DOI] [PubMed] [Google Scholar]
- 25).Rolfe S, Pieper S, Porto A, Diamond K, Winchester J, Shan S, Kirveslahti H, Boyer D, Summers A, & Maga AM (2021). SlicerMorph: An open and extensible platform to retrieve, visualize and analyse 3D morphology. Methods in Ecology and Evolution, 12, 1816–1825. 10.1111/2041-210X.13669 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26).Silva LM, Jacobs DT, Allard BA, Fields TA, Sharma M, Wallace DP, Tran PV. Inhibition of Hedgehog signaling suppresses proliferation and microcyst formation of human Autosomal Dominant Polycystic Kidney Disease cells. Sci Rep. 2018. Mar 21;8(1):4985. doi: 10.1038/s41598-018-23341-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27).Ma M, Legué E, Tian X, Somlo S, Liem KF Jr. Cell-Autonomous Hedgehog Signaling Is Not Required for Cyst Formation in Autosomal Dominant Polycystic Kidney Disease. J Am Soc Nephrol. 2019. Nov;30(11):2103–2111. doi: 10.1681/ASN.2018121274. Epub 2019 Aug 26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28).Hsieh CL, Jerman SJ, Sun Z. Non-cell-autonomous activation of hedgehog signaling contributes to disease progression in a mouse model of renal cystic ciliopathy. Hum Mol Genet. 2022. Dec 16;31(24):4228–4240. doi: 10.1093/hmg/ddac175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29).Peng T, Frank DB, Kadzik RS, Morley MP, Rathi KS, Wang T, Zhou S, Cheng L, Lu MM, Morrisey EE. Hedgehog actively maintains adult lung quiescence and regulates repair and regeneration. Nature. 2015. Oct 22;526(7574):578–82. doi: 10.1038/nature14984. Epub 2015 Oct 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30).Torres VE, Harris PC. Autosomal dominant polycystic kidney disease: the last 3 years. Kidney Int. 2009. Jul;76(2):149–68. doi: 10.1038/ki.2009.128. Epub 2009 May 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31).Kleczko EK, Marsh KH, Tyler LC, Furgeson SB, Bullock BL, Altmann CJ, Miyazaki M, Gitomer BY, Harris PC, Weiser-Evans MCM, Chonchol MB, Clambey ET, Nemenof RA, Hopp K. CD8+ T cells modulate autosomal dominant polycystic kidney disease progression. Kidney Int. 2018. Dec;94(6):1127–1140. doi: 10.1016/j.kint.2018.06.025. Epub 2018 Sep 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32).Benallegue N, Kebir H, Kapoor R, Crockett A, Li C, Cheslow L, Abdel-Hakeem MS, Gesualdi J, Miller MC, Wherry EJ, Church ME, Blanco MA, Alvarez JI. The hedgehog pathway suppresses neuropathogenesis in CD4 T cell-driven inflammation. Brain. 2021. Jul 28;144(6):1670–1683. doi: 10.1093/brain/awab083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33).Liu S, Lu W, Obara T, Kuida S, Lehoczky J, Dewar K, Drummond IA, Beier DR. A defect in a novel Nek-family kinase causes cystic kidney disease in the mouse and in zebrafish. Development. 2002. Dec;129(24):5839–46. doi: 10.1242/dev.00173. [DOI] [PubMed] [Google Scholar]
- 34).Corrales JD, Blaess S, Mahoney EM, Joyner AL. The level of sonic hedgehog signaling regulates the complexity of cerebellar foliation. Development. 2006. May;133(9):1811–21. doi: 10.1242/dev.02351. Epub 2006 Mar 29. [DOI] [PubMed] [Google Scholar]
- 35).Blaess S, Stephen D, Joyner AL. Gli3 coordinates three-dimensional patterning and growth of the tectum and cerebellum by integrating Shh and Fgf8 signaling. Development. 2008. Jun;135(12):2093–103. doi: 10.1242/dev.015990. Epub 2008 May 14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36).Sato Yasunori, Yamamura Minako, Sasaki Motoko, Harada Kenichi, Blockade of Hedgehog Signaling Attenuates Biliary Cystogenesis in the Polycystic Kidney (PCK) Rat, The American Journal of Pathology, Volume 188, Issue 10, 2018, Pages 2251–2263, ISSN 0002–9440, 10.1016/j.ajpath.2018.06.014. [DOI] [PubMed] [Google Scholar]
- 37).Sohara E, Luo Y, Zhang J, Manning DK, Beier DR, Zhou J. Nek8 regulates the expression and localization of polycystin-1 and polycystin-2. J Am Soc Nephrol. 2008. Mar;19(3):469–76. doi: 10.1681/ASN.2006090985. Epub 2008 Jan 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38).Long F, Zhang XM, Karp S, Yang Y, McMahon AP. Genetic manipulation of hedgehog signaling in the endochondral skeleton reveals a direct role in the regulation of chondrocyte proliferation. Development. 2001. Dec;128(24):5099–108. doi: 10.1242/dev.128.24.5099. [DOI] [PubMed] [Google Scholar]
- 39).Houghtaling S, Gombart SK, Ho TH, Huang G, Beier DR. A conditional smoothened (smo) allele on an inbred C57BL/6J genetic background has a hypomorphic smo mutant phenotype. Dev Biol. 2025. Feb;518:71–76. doi: 10.1016/j.ydbio.2024.11.010. Epub 2024 Nov 26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40).Arroyo J, Escobar-Zarate D, Wells HH, Constans MM, Thao K, Smith JM, Sieben CJ, Martell MR, Kline TL, Irazabal MV, Torres VE, Hopp K, Harris PC. The genetic background significantly impacts the severity of kidney cystic disease in the Pkd1RC/RC mouse model of autosomal dominant polycystic kidney disease. Kidney Int. 2021. Jun;99(6):1392–1407. doi: 10.1016/j.kint.2021.01.028. Epub 2021 Mar 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
