ITAF₄₅ is a pervasive trans-acting factor for picornavirus Type II IRES elements

Significance

Picornaviruses constitute a diverse family of RNA viruses that can infect many different species. To initiate protein synthesis, these viruses antagonize host mRNA translation while utilizing a highly structured region known as an internal ribosome entry site (IRES) to directly recruit the translational machinery. To enhance the efficiency of IRES-mediated translation, viruses recruit a set of host proteins known as IRES trans-acting factors (ITAFs). Here, we show that ITAF₄₅, previously thought to function only in foot-and-mouth disease virus translation, is required for the efficient translation of viruses containing a Type II IRES. Our study demonstrates a broad requirement of ITAF₄₅ in specialized picornavirus translation and highlights the importance of characterizing host factors in their proper physiological context.

Abstract

Viruses have evolved elaborate mechanisms to hijack the host mRNA translation machinery to direct viral protein synthesis. Picornaviruses, whose RNA genome lacks a cap structure, inhibit cap-dependent mRNA translation, and utilize an internal ribosome entry site (IRES) in the RNA 5′ untranslated region to recruit the 40S ribosomal subunit. IRES activity is stimulated by a set of host proteins termed IRES trans-acting factors (ITAFs). The cellular protein ITAF₄₅ (also known as PA2G4 or EBP1) was documented as an essential ITAF for foot-and-mouth disease virus (FMDV), with no apparent role in cell-free systems for encephalomyocarditis virus (EMCV) and Theiler’s murine encephalomyelitis virus (TMEV), which are closely related viruses harboring similar IRES elements. Here, we demonstrate that ITAF₄₅ is a pervasive host factor for picornaviruses containing a Type II IRES. CRISPR/Cas9 knockout of ITAF₄₅ in several human cell lines conferred resistance to infection with FMDV, EMCV, TMEV, and equine rhinitis A virus (ERAV). We show that ITAF₄₅ enhances initiation of translation on Type II IRESs in cell line models. This is mediated by the C-terminal lysine-rich region of ITAF₄₅ known to enable binding to viral RNA. These findings challenge previous reports of a restricted role for ITAF₄₅ in FMDV infection, thus positioning ITAF₄₅ as a potential antiviral target for various animal viruses and emerging human cardioviruses.

The canonical mechanism of mRNA translation initiation in eukaryotic cells entails the recruitment of the small ribosomal subunit (40S) to the mRNA via the 5′-terminal cap structure (m⁷GpppN, where m represents a methyl group, and N is any nucleotide), followed by ribosome scanning of the 5′-untranslated region (UTR) and recognition of an initiation codon (1). Viruses do not encode translation components, therefore, they require the host translational machinery to sustain their life cycle (2). Poliovirus was the first virus described to cause a shut-off of host protein synthesis (3). The single-stranded positive-sense RNA of picornavirus genomes lack a cap structure (4, 5) and contain a long (400 to 1,200 nt) 5′-UTR harboring a highly structured element termed an internal ribosome entry site (IRES) (6, 7). The IRES recruits the 43S initiation complex, which consists of the small 40S ribosomal subunit in association with eukaryotic initiation factors (eIFs) (8). Picornavirus IRESs are classified into six types based on shared structural features, host factor requirements, and the initiation mechanism they employ (9, 10). Picornavirus Type I (Enterovirus/Rhinovirus) and Type II (Cardiovirus/Aphthovirus) groups differ most notably in that the latter recruits the 40S at, or close to, the initiation codon without the need for scanning (8). Picornaviral IRES-mediated translation initiation is facilitated by cellular IRES trans-acting factors (ITAFs), which bind the IRES to engender conformational remodeling which promotes 43S binding (11, 12). ITAF requirements for different viruses are diverse, due in part to differential cell and tissue expression, which render ITAFs important determinants of host and tissue tropism (13).

Proliferation-associated 2G4 (PA2G4), also referred to as ErbB3-binding protein 1 (EBP1) and IRES trans-acting factor 45 (referred throughout as ITAF₄₅) is an evolutionarily conserved protein with multiple functions ranging from cell proliferation to embryonic development (14–17). Two major isoforms exist, p48 and p42, wherein p42 lacks 54 amino acids at the N-terminus due to alternative splicing (17). The p48 isoform is more abundant in most mammalian cells and is considered to have oncogenic properties in contrast to p42’s tumor-suppressive function (18). p48 was first reported as an ITAF in a reconstituted cell-free translation system in which 48S complex formation on the FMDV IRES required the mouse homolog of ITAF₄₅ (murine proliferation-associated protein (Mpp1) (19). While sequence identity among the Type II IRES family is about 50%, they share a conserved secondary structure (20). For translation initiation at IRESs to occur, the recruitment of the 40S ribosomal subunit, which is facilitated by eIFs and ITAFs, is required to produce the 48S initiation complex (21). Despite the similarities between Type II IRES elements, ITAF₄₅ was found to be dispensable for the assembly of 48S initiation complex formation on the EMCV and TMEV RNAs in cell-free assays (19). Subsequently, the requirement of FMDV IRES-driven translation for ITAF₄₅ using various in vitro assays was corroborated (22–25). siRNA-mediated depletion of ITAF₄₅ in HEK-293 cells dramatically reduced FMDV IRES translation without affecting that of EMCV (25). In sharp contrast, two recent independent CRISPR screens identified ITAF₄₅ as a potential EMCV host factor, but in neither case was it validated (26, 27). Consequently, we sought to revisit the role of ITAF₄₅ in RNA translation for EMCV and other Type II IRES-containing picornaviruses.

To address the discrepancy, we generated ITAF₄₅ knockout (KO) cells using CRISPR-Cas9. We demonstrate that ITAF₄₅ is a host factor for EMCV infection of human cells, thus playing a critical role in stimulating IRES-driven translation. This requires the C-terminal lysine-rich region which binds viral RNA (25). Importantly, we demonstrate that ITAF₄₅ is also required for infection of FMDV, TMEV, and ERAV, demonstrating that ITAF₄₅ serves as a prevalent host factor for picornaviruses containing a Type II IRES. This work positions ITAF₄₅ as an important host factor that could serve as a therapeutic target for emerging human cardioviruses.

Results

Two recently published CRISPR screens identified ITAF₄₅ to be a potential EMCV host dependency factor (26, 28). To demonstrate a role of ITAF₄₅ in EMCV infection, we generated ITAF₄₅ knockout (ITAF₄₅^KO) H1-HeLa cells (SI Appendix, Fig. S1 and Fig. 1A), which were infected with viruses harboring different types of IRES elements (or lacking an IRES) (Fig. 1B). These included species of the Enterovirus genus, EMCV (Cardiovirus), and the negative sense RNA vesicular stomatitis virus (Rhabdovirus) (Fig. 1B). Cells were infected at high multiplicity of infection (MOI) and monitored until full cytopathic effect (CPE) was observed in the control cells. As expected, ITAF₄₅ depletion had no effect on enterovirus or rhabdovirus infection as shown by crystal violet staining of viable cells (Fig. 1B). Remarkably, depletion of ITAF₄₅ conferred full resistance to EMCV infection (Fig. 1B). The phenotype was specific to ITAF₄₅ as restoring expression of full-length ITAF₄₅ (with a C-terminal MYC-DDK tag) in the KO cells resensitized them to infection (Fig. 1B). Furthermore, infection of ITAF₄₅^KO cells with EMCV showed a ~300-fold reduction in viral RNA production following one cycle of infection (Fig. 2A). Virus yield assays using the supernatant of EMCV-infected control and ITAF₄₅^KO cells following 24 h of infection showed a ~10,000-fold reduction in the titer of infectious virus that was rescued by restored expression of ITAF₄₅ in the KO cells (Fig. 2B). To determine whether the phenotype was reproduced in other cell lines, we generated ITAF₄₅^KO eHAP1 (haploid human cell line derived from the chronic myelogenous leukemia (CML) cell line KBM-7 (SI Appendix, Fig. S2A). Upon infection of eHAP1 ITAF₄₅^KO cells at high MOI, the cells exhibited resistance to EMCV replication which was rescued upon restoration of ITAF₄₅ expression using ITAF₄₅-MYC-DDK (SI Appendix, Fig. S2B). Therefore, ITAF₄₅ is a required host factor for EMCV infection in several human cell lines.

Fig. 1.

ITAF₄₅ is a key host factor for EMCV infection. (A) Immunoblot of control, ITAF₄₅^KO, and ITAF₄₅^KO + MYC-DDK-tagged ITAF₄₅ H1-HeLa cells. (B) Crystal violet staining of viable cells infected with indicated virus with “mock” representing uninfected cells. (Also B): Categorization and taxonomy of viruses used and the type of IRES they contain in their 5′-UTR.

Fig. 2.

Depletion of ITAF₄₅ restricts EMCV infection. (A) RT-qPCR quantification of EMCV RNA in control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ infected with EMCV (Mengo strain) at a multiplicity of infection (MOI) of 10 for 7 h. (B). Plaque assay quantification of infectious EMCV produced from control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells infected with EMCV (Mengo strain) at an MOI of 10 for 24 h. Datasets represent means ± s.d. (n = 3 independent biological replicates). All P values were determined by ordinary one-way ANOVA using GraphPad Prism (GraphPad Software) with Dunnett’s correction. ***P < 0.0002 and ****P < 0.0001.

Next, we sought to exclude the possibility that ITAF₄₅ was involved in viral entry, independent of IRES-mediated translation. To this end, we transfected EMCV RNA transcripts containing a Gaussia luciferase reporter (EMCV-GLuc) downstream of the EMCV RNA IRES into control and ITAF₄₅^KO cells using liposomes, thus bypassing the virus entry mechanism. At 7 h posttransfection, we observed a ~20-fold reduction in Gaussia luciferase activity in the ITAF₄₅^KO as compared to control cells (Fig. 3A), establishing that ITAF₄₅ is acting downstream of viral entry. We next investigated whether ITAF₄₅ was required for viral translation by first transfecting control or ITAF₄₅^KO cells with a capped and polyadenylated bicistronic reporter mRNA containing the EMCV IRES between firefly and Renilla luciferase cistrons (Fig. 3B). Cells were lysed 6 h posttransfection at which we observed a 4-fold reduction in IRES-mediated Renilla luciferase translation in ITAF₄₅^KO cells, but no change in cap-dependent translation (Fig. 3B). To bolster these results, we next performed a synchronized infection assay on control and ITAF₄₅^KO cells. We rescued an infectious virus population by transfecting the EMCV-GLuc RNA into BHK-21 cells. Using cycloheximide (CHX), a potent translation inhibitor, and EMCV-GLuc virus, this assay was employed to elucidate whether depletion of ITAF₄₅ affects the viral translation stage (<3 h postinfection) or at later stages such as viral replication (Fig. 3C). The exponential increase in luciferase activity observed in infected control cells was abolished by CHX (Fig. 3C). Strikingly, the luciferase signal observed in ITAF₄₅^KO cells without CHX was equal to control cells treated with CHX (Fig. 3C). These experiments demonstrate that ITAF₄₅ enhances EMCV IRES-mediated translation in human cell lines and is required to support virus infection.

Fig. 3.

ITAF₄₅ stimulates the translation of EMCV RNA in human cell lines. (A) Top: Schematic of the full-length EMCV (Mengo strain) genome containing Gaussia luciferase downstream of the 5′-UTR followed by a 3C^pro cleavage site (EMCV-GLuc). Bottom: EMCV-GLuc expression levels in control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells transfected with 1 µg of EMCV-GLuc RNA. (B) Top: Schematic of the capped and polyadenylated EMCV IRES bicistronic reporter mRNA used in which the EMCV IRES is between a firefly luciferase cistron (cap-dependent translation) and a Renilla luciferase cistron (IRES-mediated translation). Bottom: firefly and Renilla luciferase expression levels in relative light units (RLU) in control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells transfected with 400 ng of EMCV bicistronic reporter mRNA. Cells were harvested at 6 h posttransfection. Background signals from nontransfected cells were subtracted from the measurements. (C) Control and ITAF₄₅^KO cells infected with EMCV-GLuc virus at an MOI of 20 in the presence of 0.1% DMSO or 125 µM cycloheximide (CHX). Datasets represent means ± s.d (n = 3 independent biological). All P values were determined by two-way ANOVA using GraphPad Prism (GraphPad Software) with Dunnett’s correction. ***P < 0.0002 and ****P < 0.0001.

The data show that ITAF₄₅ acts as a critical ITAF for EMCV, in addition to its previously reported role in FMDV infection. To date, the role of ITAF₄₅ for FMDV RNA translation was studied either in cell-free translation reconstitution assays or using transfection of plasmids for reporter mRNAs bearing the FMDV IRES. Thus, we sought to confirm that ITAF₄₅ is also required for viral translation in FMDV-infected cells. eHAP1 control and ITAF₄₅^KO cells were infected with FMDV (O1 Kaufbeuren strain) at high MOI and imaged every hour to assess CPE development (Fig. 4A). At 12 to 15 h postinfection, control cell confluency was significantly reduced with most cells displaying marked CPE, while ITAF₄₅^KO cells remained unaffected, clearly establishing that full-length FMDV requires ITAF₄₅ during infection in a cell line model (Fig. 4A). Furthermore, when transfected with a GFP-containing FMDV replicon in which the capsid coding region was replaced with a GFP reporter, the GFP signal observed in control cells was lost in ITAF₄₅^KO cells. The signal did not surpass the levels observed in infected control cells that were cotreated with guanidine hydrochloride (viral replication inhibitor) (Fig. 4B). In addition to FMDV, we explored the role of ITAF₄₅ in TMEV (GDVII strain) replication and ERAV titration (Fig. 4 C and D). As with FMDV and EMCV, ITAF₄₅^KO cells failed to support TMEV infection in human cell lines as measured by RT-qPCR, while a 4-log reduction in virus yield was observed during an ERAV infection. These results demonstrate a broad role for ITAF₄₅ for Type II IRES-containing viruses of the cardio- and aphthovirus families.

Fig. 4.

ITAF₄₅ is required for viruses containing a Type II IRES. (A) Left: eHAP1 control and ITAF₄₅^KO cells were infected with FMDV (O1 Kaufbeuren) and cultured in an Incucyte to monitor the rate of cytopathic effect (CPE) development via measurement of cell confluency. The average confluency of three biological replicates was plotted against time using GraphPad Prism (GraphPad Software). Right: Representative image of cell monolayers at 12 h postinfection. (B) Replication of FMDV in eHAP1 control and ITAF₄₅^KO cells was assessed via transfection of 90 ng of an FMDV subgenomic replicon wherein the capsid protein coding regions were replaced with a GFP reporter. Replication was assessed using the Incucyte S3 2019B ver2 software to quantify the total integrated green intensity per well using a cutoff value of 0.5. (C) eHAP1 control and ITAF₄₅^KO cells were infected with TMEV (GDVII strain) at an MOI of 50 and lysed at 24 h postinfection to quantify viral RNA using RT-qPCR. (D) Top: eHAP1 control and ITAF₄₅^KO cells were used to titrate ERAV stock where the end-point titers were calculated using the Spearman–Kärber method. Bottom: Crystal violet staining of cells inoculated with indicated virus. TMEV and ERAV dataset represent means ± s.d (n = 3 independent biological replicates). P values were determined by a paired T-test using GraphPad Prism (GraphPad Software) ***P < 0.0002 and *P < 0.0332.

The C-terminal lysine-rich region of ITAF₄₅ is required for its nucleic acid-binding properties, including to the EMCV and FMDV IRESs (25). To investigate whether the C-terminal lysine-rich region is required for IRES-driven translation in cells, we constructed ITAF₄₅^KO cell lines that stably express a MYC-DDK FLAG-tagged truncated ITAF₄₅ (amino acids 1-360) lacking the lysine-rich region or a full-length ITAF₄₅ containing a modified lysine-rich region (³⁶⁵KKKKKKKSKT³⁷⁶ changed to ³⁶⁵AAAAAAASAT³⁷⁶) (Fig. 5A). Expression of either mutant protein, in contrast to the full-length WT ITAF₄₅, in ITAF₄₅^KO cells failed to rescue virus replication, indicating that the C-terminal lysine-rich region of ITAF₄₅ is required for EMCV infection (Fig. 5B).

Fig. 5.

The C-terminal lysine-rich region of ITAF₄₅ is required for efficient EMCV infection. (A) Left: Schematic of ITAF₄₅ constructs stably expressed in H1-HeLa ITAF₄₅^KO cells containing C-terminal MYC-DDK tags. Right: Immunoblot of H1-HeLa control, ITAF₄₅^KO, and ITAF₄₅^KO + MYC-DDK-tagged construct cell lines. (B) Crystal violet staining of viable cells infected with EMCV (Mengo strain) at an MOI of 10 for 24 h with “mock” representing uninfected cells.

Discussion

Here, we demonstrate that ITAF₄₅ is as an important host factor for Type II IRES-containing picornaviruses. We show that upon CRISPR/Cas9-mediated loss of ITAF₄₅ expression in two human cell lines, infection with EMCV is severely restricted. Restored expression of the full-length p48 isoform of ITAF₄₅ reverted this phenotype, while expression of modified ITAF₄₅ with a disrupted C-terminal lysine-rich region did not. This is consistent with previous data that identified the C-terminal lysine-rich region comprising the essential motif which imparts the nucleic acid binding activity of ITAF₄₅ (25). The p42 isoform was weakly expressed in the parental H1-HeLa and eHAP1 cells, consistent with reports that the p42 isoform is not detectable in cancer cell lines due to its ubiquitin-mediated degradation via BRE1 (29, 30).

Using an in vitro bicistronic reporter and synchronized infection in cells, we demonstrated that ITAF₄₅ strongly stimulates the IRES-mediated translation of the EMCV genomic RNA. Furthermore, using full-length FMDV, TMEV, and ERAV, we showed that ITAF₄₅ is also necessary for efficient replication of each virus in cell line models. These results are in stark contrast to the earlier conclusion that ITAF₄₅ functions exclusively in FMDV RNA translation. In previous reports, a footprinting assay using the FMDV IRES showed that ITAF₄₅ binds to the base of domain I, protecting nucleotide G₃₅₁ from enzymatic cleavage (19). This nucleotide is found 14 nucleotides upstream of a partially conserved sequence beginning with CUG at the base of domain I of the EMCV (31) and TMEV (32) IRESes and domain Ib of the ERAV IRES (33) (SI Appendix, Fig. S3). In addition, electrophoretic mobility shift assays demonstrated that ITAF₄₅ bound to RNA transcripts corresponding to either domain J, domain K, or domains JKL (25). Further exploration into the precise binding sites of ITAF₄₅ across different Type II IRES-containing viruses using techniques such as CLIP-seq should delineate the recognition motif(s) required for efficient IRES translation. In addition, while ITAF₄₅ was shown to crosslink to the EMCV and TMEV IRES following UV irradiation (19), and could bind the EMCV IRES in vitro (25), initiation on either IRES was independent of ITAF₄₅. A potential explanation for this discrepancy is the different in vitro constructs used. For example, it was reported that within an in vitro context, one extra A nucleotide in the EMCV IRES A-rich bulge conferred translational dependence on PTB (polypyrimidine tract binding protein, another well-characterized ITAF) which is otherwise not required by the WT IRES (34). This, however, was shown to be highly variable depending on the sequence of the IRES itself and the type of reporter downstream of the IRES (viral or heterologous cistron) (34). In our studies, we utilized a reporter mRNA with the wild-type EMCV IRES driving translation of nonviral cistrons as described by Bochkov and Palmenberg (35), and corroborated those results using infectious virus containing the WT IRES sequence in cell line models.

We showed using a bicistronic reporter mRNA containing the EMCV IRES inserted between heterologous reporters (luciferase cistrons) (35) that IRES-dependent translation was 4-fold impaired in ITAF₄₅^KO cells. It is noteworthy that the only prior cell-based assay investigating ITAF₄₅’s role in EMCV infection (using an EMCV IRES construct transfected into HEK-293 cells with siRNA-mediated ITAF₄₅ depletion) found no impact on EMCV translation (25). While there was no difference in the IRES-dependent cistron used between our experiments, the reported RNA transfection was performed for 24 h (using a nonreplicating mRNA) in contrast to our experiment with an endpoint of 6 h posttransfection. In addition, since siRNA confers a transient and partial knockdown of protein levels, it is conceivable that this was not sufficient to confer a phenotype similar to the CRISPR/Cas9 complete knockout. Our work further highlights the critical importance of the control of RNA translation in the viral life cycle. As shown with the IRES reporter assays, relatively modest repression of EMCV IRES translation in ITAF₄₅^KO cells causes a drastic reduction in viral replication, probably due to the importance of multiple cycles of translation that occur immediately following infection.

Among its diverse cellular roles, several groups have reported ITAF₄₅ to be a high occupancy factor on the 60S ribosomal tunnel exit (36–38). Its role in regulating general translation has yet to be fully elucidated, but recent work has demonstrated that ITAF₄₅ can regulate the synthesis of cell adhesion molecules (CAMs) in neural stem cells with continued binding on actively translating ribosomes (38). Whether this feature of ITAF₄₅ is involved in stimulating selective viral RNA translation is unclear, as the principal mechanism of ITAF-mediated translation initiation is to coordinate 40S subunit binding to the RNA, before 60S subunit joining (39).

We documented the requirement of ITAF₄₅ for FMDV, EMCV, TMEV, and ERAV infection in cell lines. These findings corroborate previous in vitro experiments using artificial FMDV reporters and importantly, dispel the previously mischaracterized absence of a role for ITAF₄₅ in EMCV and TMEV RNA translation. EMCV and FMDV pose a major risk to agricultural and livestock industries by infecting a diverse array of species (40–43). Very few cases of symptomatic EMCV infections in humans have been reported, although serological studies have shown that particularly in developing countries and among populations exposed to livestock, EMCV is a widely circulating virus (44–47). Importantly, the emergence of novel human Cardioviruses such as Saffold virus has elicited great interest in understanding the life cycles of these viruses to prepare for possible future outbreaks (48–52). This work documents a possible therapeutic target to combat picornaviruses harboring Type II IRES elements.

Materials and Methods

Cells and Reagents.

HEK293T, eHAP1, BHK-21, and H1-HeLa cells were obtained from the American Type Culture Collection (ATCC). HEK293T, BHK-21, and H1-HeLa cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. eHAP1 cells were maintained in Iscove’s modified Dulbecco’s medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin.

Viruses and Infectious Clones.

The encephalomyocarditis virus (EMCV Mengo strain) infectious clone pM16.1 was obtained from Ann Palmenberg (53). Infectious clones of human rhinovirus (HRV)-A16 and HRV-B14 were provided by Yuri Bochkov and originally described by Wenshang Wang and Dieter Blaas, respectively (54, 55). The infectious clone of poliovirus 1 (PV1 Mahoney strain) was obtained from Eckard Wimmer. Infectious clones for coxsackievirus B3 (CVB3 Nancy strain), CVA24v, enterovirus D68 (EV-D68 Fermon strain), and EMCV-GLuc were described previously (27, 56–58). Vesicular stomatitis virus (VSV Indiana strain) was obtained from ATCC (VR-1421). EMCV, EMCV-GLuc, and foot-and-mouth disease virus (FMDV O1 Kaufbeuren strain) infectious clones were rescued and titrated on BHK-21 cells. Equine rhinitis A virus (ERAV NM11/67) was obtained from David Rowlands (University of Leeds, Leeds, United Kingdom). CVB3 and PV1 infectious clones were rescued and titrated on H1-HeLa cells. EV-D68 infectious clone was rescued and titrated on RD cells. HRV infectious clones were rescued and titrated on H1-HeLa cells. Infectious clones (EMCV and EMCV-GLuc) were rescued as viruses by first linearizing the plasmids with BamHI restriction enzyme (Thermo Fisher Scientific). CVB3, CVA24v, and EV-D68 were linearized with SalI (Thermo Fisher Scientific), PV1, and HRV-B14 were linearized with MluI (Thermo Fisher Scientific), and HRV-A16 was linearized with SacI (Thermo Fisher Scientific). The linearized plasmids were in vitro transcribed using HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using an RNA Clean and Concentrator Kit (Zymo Research). 5 μg of derived RNA was transfected into the cell lines mentioned above using Lipofectamine-2000 (Thermo Fisher Scientific). Between 24 to 72 h posttransfection (when cytopathic effect was >90%), rescued virus was harvested from the supernatant and cell lysates following three freeze-thaw cycles and high-speed centrifugation. The resulting passage 0 virus was added to the appropriate cell lines and harvested in the same manner followed by titration on the appropriate cell lines using plaque assays as described by Rueckert (59). Passage 1 viral stocks were used for all experiments unless otherwise stated. FMDV experiments were performed within the high containment labs at The Pirbright Institute and ERAV experiments were performed by the Kuppeveld Lab.

Generation of Cell Lines.

To generate ITAF₄₅ knockout cell lines (ITAF₄₅^KO), H1-HeLa and eHAP1 cells expressing spCas9 were generated. HEK293T cells were first transfected with Lenti‐Cas9‐2A‐Blast (Addgene #73310) along with psPAX2 (Addgene #12260), pMD2.G (Addgene #12259), and Lipofectamine-2000 (Thermo Fischer Scientific) to generate lentivirus. H1-HeLa and eHAP1 cells were then transduced with Cas9-2A-Blast lentivirus followed by blasticidin selection. The selected cells were single cell sorted using flow cytometry to obtain clonal populations with sufficient Cas9 expression. Then, two independent guide RNAs targeting different exons of ITAF₄₅ (ACAGGAGCAAACTATCGCTG and GGGTTGGCACCTACTTCTGC) or nontargeting sequences (ACGGAGGCTAAGCGTCGCAA and CGCTTCCGCGGCCCGTTCAA) were cloned into a lentiviral expression plasmid as described in Addgene #154194. The resulting plasmid was then transfected into HEK293T cells to generate lentivirus. Clonal populations of H1-HeLa-Cas9 and eHAP1-Cas9 cells were transduced with the control or ITAF₄₅^KO lentivirus, selected with puromycin, and sorted using flow cytometry to obtain clonal populations. Knockouts were validated using Western blotting and/or Sanger sequencing. To restore expression of ITAF₄₅ in the ITAF₄₅^KO cell lines, synthetic oligos corresponding to the cDNA of the C-terminal MYC-DDK-tagged ITAF₄₅ or the C-terminal mutant constructs described above were obtained from Integrated DNA Technologies and cloned into a lentiviral construct (Addgene #104995). The lentiviral transfection and transduction procedures were carried out in the same manner as above.

Virus Screening and Crystal Violet Staining.

Control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells were seeded onto 12-well plates. The following day, cells were incubated with CVA24v, CVB3, RV-B14, RV-A16, PV-1, EV-D68, VSV, and EMCV at an MOI of 10 in culture medium for 30 min at 37 °C (CVB3, PV-1, VSV, and EMCV) or for 1 h at 33 °C (CVA24v, RV-B14, RV-A16, and EV-D68). Following virus adsorption, cells were washed three times with PBS and replenished with fresh media. Cells were incubated for 24 to 48 h and then fixed and stained using 0.5% crystal violet in methanol.

FMDV Experiments.

For FMDV infections to assess CPE development, eHAP1 control and ITAF₄₅^KO cells were seeded in 96-well plates. Wells were washed once with Virus Growth Media (VGM: normal cell culture medium with reduced (1%) serum) and infected with FMDV (O1 Kaufbeuren) in a volume of 50 μL. After 1 h at 37 °C, the virus inoculum was replaced with 150 μL of VGM. The infection was continued at 37 °C and cells in each well were imaged at 1 h intervals (10 x objective, 4 images per well) for 30 h using the Incucyte S3 live cell analysis system (Essen Biosciences). Cell confluency was calculated from the images using the Incucyte S3 2019B ver2 software with default software settings (Sartorius). To assess the rate of CPE development, the average confluency of three replicate wells was plotted against time. Replication of FMDV in eHAP1 cells was assessed using a previously described subgenomic replicon in which the capsid protein coding region was replaced with a fluorescent reporter sequence (ptilosarcus GFP; ptGFP). The replicon plasmid was linearized using AscI (New England Biolabs) and purified using the GFX Illustra DNA and Gel Band Purification Kit (Cytiva). Then, 1 μg of linearized DNA was transcribed in vitro using a Megascript T7 Kit (Thermo) as per the manufacturer’s instructions, and RNA transcripts were purified from the reaction using the Megaclear Transcription Clean Up Kit (Thermo). eHAP1 control and ITAF₄₅^KO cells were grown to 90% confluency in 96-well tissue culture plates and washed once with VGM followed by transfection with 90 ng of replicon RNA per well using a TransIT-mRNA Transfection Kit (Mirus). VGM alone or VGM containing 3 mM guanidine hydrochloride (GuHCl) was then added along with the transfection mixture to each well. The plates were incubated at 37 °C and the wells imaged every 0.5 h using an Incucyte S3 live cell analysis system to assess fluorescent protein expression (10x objective, 4 images per well). The images were analyzed using the associated Incucyte S3 2019B ver2 software to quantify the total integrated green intensity per well using a cutoff value of 0.5. The total integrated intensity is the sum of all green fluorescence intensity values within the green objects in the image, multiplied by the pixel area. To assess replication, the average total integrated intensity of four replicate wells was plotted against time.

RT-qPCR for Quantification of Viral RNA.

Control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells were seeded onto 6-well plates in triplicate. The following day, cells were infected with EMCV at an MOI of 10 in culture medium for 30 min at 37 °C. Following the 30-min virus adsorption, cells were washed three times with PBS and replenished with fresh media. At 7 h postinfection, cells were washed with PBS and harvested in TRIzol (Invitrogen). RNA was extracted using Direct-zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol. Reverse transcription, with 1 μg of RNA was performed using the SuperScript III Reverse-Transcriptase Kit (Invitrogen, Cat#18080044) and Oligo(dT)_12-18 (Invitrogen, Cat#18418012) according to the manufacturer’s protocol. Quantitative PCR was performed using SYBR Green (Invitrogen, Cat#4309155) and CFX Connect Real-Time PCR Detection System (Bio-Rad) equipment. The following primers were used (5′ to 3′ orientation): EMCV For: CCACAGAGGATTGGAAGCCA; EMCV Rev: GCACGCAAAACTGCCTGATA, GAPDH For: TGGGTGTGAACCATGAGAAG; GAPDH Rev: ATGGACTGTGGTCATGAGTC; TMEV For: AGCCCATCCACGATGAGCTT; TMEV Rev: CTGAAAAACCGACTGCACAGG

EMCV IRES Bicistronic Reporter Assay.

The EMCV IRES bicistronic reporter plasmid was a gift from Ann Palmenberg (35). The plasmid was linearized with BamHI (Thermo Fischer Scientific) and in vitro transcribed using HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) with Anti-Reverse Cap Analog (ARCA) (New England Biolabs #S1411) followed by purification using the RNA Clean and Concentrator Kit (Zymo Research). The purified capped mRNA product was polyadenylated using E. coli Poly(A) Polymerase (New England Biolabs # M0276) followed by purification using the RNA Clean and Concentrator Kit (Zymo Research). Control, ITAF₄₅^KO, and ITAF₄₅^KO + ITAF₄₅ cells were seeded into 24-well plates in triplicate. The following day, cells were transfected with 400 ng of capped and polyadenylated reporter mRNA using Liptofectamine-2000 (Thermo Fischer Scientific). At 6 h posttransfection, cells were harvested using the Dual-Glo® Luciferase Assay System (Promega) according to the manufacturer’s protocol. The Renilla (IRES) and firefly (Cap) luciferase activity levels were measured using the dual-glo setting of the Glomax 20/20 Luminometer (Promega). Measurements were normalized against background levels from nontransfected cells.

Viral RNA Transfection.

Control and ITAF₄₅^KO cells were seeded into 24-well plates in triplicate. The following day, 1 μg of in vitro transcribed EMCV-GLuc RNA was transfected into cells using Lipofectamine-2000 (Thermo Fischer Scientific). At 7 h posttransfection, cells were harvested using the Renilla Luciferase Assay system (Promega) according to the manufacturer’s protocol and measured using the luc-0-inj setting of the Glomax 20/20 Luminometer (Promega). Nontransfected control and ITAF₄₅^KO cells were used as controls.

Synchronized Infection Assay with EMCV-GLuc.

Control and ITAF₄₅^KO cells were seeded into 24-well plates in triplicate. The following day, the cells were first chilled on ice for 30 min, after which the cells were incubated with 125 μM cycloheximide (BioShop) or 0.1% DMSO for 1 h on ice with or without EMCV-GLuc (MOI = 20). After 1 h incubation to allow the virus to attach to the cells, the plates were incubated for 10 min at 37 °C to permit virus entry. The cells were then washed three times with PBS and replenished with media containing the aforementioned compounds. At the indicated time points, cells were harvested using the Renilla Luciferase Assay system (Promega) according to the manufacturer’s protocol and measured using the luc-0-inj setting of the Glomax 20/20 Luminometer (Promega).

SDS-PAGE and Western Blotting.

Unless otherwise stated, cells were lysed using RIPA buffer (50 mM Tris-HCl pH 7.4; 1% NP-40; 0.1% SDS; 150 mM NaCl; 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche). Protein lysates were incubated at 4 °C with constant rotation for 30 min followed by centrifugation at 14,000 rpm for 15 min at 4 °C. The supernatants were collected for protein quantification using Bradford reagent (BioRad). Protein lysates were denatured in 5X loading buffer (250 mM Tris-HCl pH 6.8; 8% SDS; 0.2% w/v bromophenol blue; 40% v/v glycerol; 20% v/v β-mercaptoethanol), boiled, and subjected to 10% polyacrylamide-SDS gel electrophoresis followed by transfer onto a nitrocellulose membrane. Membranes were blocked with 5% skim milk solution in TBST. ITAF₄₅ antibody was obtained from Novus Biologials, and eEF2 antibody was obtained from Cell Signaling Technology.

Supplementary Material

Appendix 01 (PDF)

Data, Materials, and Software Availability

All study data are included in the article and/or SI Appendix.