Lysionotin attenuates bleomycin-induced pulmonary fibrosis by activating AMPK/Nrf2 pathway

Abstract

Idiopathic pulmonary fibrosis (IPF) is an interstitial fibrotic lung disease characterized by myofibroblast differentiation and collagen deposition. Excessive activation of fibroblasts in the lungs leads to severe alveolar dysfunction and tissue destruction seen by histological assessment. IPF presents a high mortality rate, limited therapeutic options, and an intense need to develop safe and effective therapeutic drugs. Lysionotin is a flavonoid isolated from herbal extracts with various biological effects such as anti-tuberculosis mycobacteria and anti-inflammatory. Nevertheless, its effect on pulmonary fibrosis is not known. This study aims to investigate the effect of Lysionotin on bleomycin (BLM)-induced pulmonary fibrosis and its mechanism. We used BLM to establish a mouse model of pulmonary fibrosis and injected Lysionotin intraperitoneally on days 15–28 to observe its effect on pulmonary fibrosis. The molecular mechanism of Lysionotin was investigated in vitro using transforming growth factor-β (TGF-β) induced myofibroblasts. Lysionotin attenuates TGF-β-induced myofibroblast differentiation and oxidative stress by promoting nuclear factor erythroid 2–related factor 2 (Nrf2) and its downstream expression of antioxidant genes NAD(P)H quinone dehydrogenase 1 (NQO-1) and heme oxygenase 1 (HO-1) by activating AMP-activated protein kinase (AMPK). Lysionotin exerts anti-pulmonary fibrosis effects by regulating myofibroblast differentiation and reducing oxidative stress through the AMPK/Nrf2 pathway, illustrating the potential significance of Lysionotin in protecting against BLM-induced pulmonary fibrosis.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-17045-7.

Introduction

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal lung disease. Excessive deposition of extracellular matrix proteins leads to fibrotic remodeling, alveolar destruction and loss of lung function^1,2. IPF is more common in men, its prevalence increases significantly with age, and the median survival after diagnosis is only 3–5 years³. However, pirfenidone and nintedanib, two drugs approved by the Food and Drug Administration for treating IPF, can only slow the progression of the disease but not cure it and have many side effects⁴. Therefore, developing safe and effective therapeutic drugs to treat pulmonary fibrosis is essential.

Oxidative stress refers to the physiological and pathological changes caused by the production of reactive oxygen species (ROS) and reactive nitrogen radicals under the stimulation of harmful factors in the internal and external environment⁵. Due to the unique location and function, the lung is more susceptible to oxidative damage than other organs. It has been found that oxidative stress plays a vital role in the pathogenesis of pulmonary fibrosis^6–8.

As the most potent pro-fibrotic cytokine, TGF-β mediates the occurrence of pulmonary fibrosis, for example, by activating oxidases on the cell membrane to promote hydrogen peroxide release, increasing ROS production through mitochondrial pathways, or activating NADPH oxidase 4 (NOX4) to produce ROS^9–11. Conversely, redox imbalance can create a vicious cycle of TGF-β and ROS¹². Therefore, finding effective ways to ameliorate oxidative stress in alleviating pulmonary fibrosis is significant.

Nrf2 is a key antioxidant target associated with inflammation and oxidative stress in many diseases^13,14. Meanwhile, Nrf2 is also an important therapeutic target for pulmonary fibrosis. Studies suggest that Nrf2 is suppressed in IPF or BLM-induced pulmonary fibrosis in mice, and the Nrf2 activator sulforaphane (SFN) is beneficial for resolving pulmonary fibrosis in these mice^15,16. As a crucial upstream kinase of Nrf2, AMPK has a critical role in regulating oxidative stress and fibrosis^17,18. Lysionotin is a natural flavonoid with various biological activities, including anti-inflammatory and free radical scavenging^19,20. Given the role of oxidative stress in pulmonary fibrosis, our study evaluated the potential therapeutic effects of Lysionotin and explored its possible mechanisms. We proved that Lysionotin exerts a direct anti-pulmonary fibrosis effect by activating the AMPK/Nrf2 signaling pathway for the first time.

Materials and methods

Animal experiments

C57BL/6 male mice (8–10 weeks old) were purchased from the Department of Zoology, Central South University. All mice were housed under specific pathogen-free conditions with free access to standard food and water. All procedures involving animals were conducted in accordance with the ethical guidelines for laboratory animal care and approved by the Laboratory Animal Welfare and Ethical Committee of Central South University (Approval No. CSU-2022-0095). Lysionotin was purchased from Selleck China, batch number S387701, with a purity of 99.89%.

After a week of adaptive feeding, the mice were divided into two experimental cohorts: a treatment cohort and an inhibitor cohort, each designed to evaluate the effect of Lysionotin in a BLM-induced pulmonary fibrosis model. For the treatment cohort design (n = 110), ten mice were randomly assigned to the control group, receiving normal saline (50 µL, intratracheally, i.t.) on Day 1 and vehicle (intraperitoneally, i.p.) daily from Day 15 to Day 28., the remaining mice (n = 100) were administered BLM (3.3 U/kg, 50 µL, i.t.; Nippon Kayaku, Japan) on Day 1 to induce pulmonary fibrosis. On Day 15, successfully modeled mice were randomly divided into four treatment groups (n = 25 per group): Model group: received vehicle (i.p.) daily from Day 15 to Day 28.Low-dose Lysionotin group: received Lysionotin at 0.8 mg/kg (i.p.) daily from Day 15 to Day 28.Moderate-dose group: received Lysionotin at 4 mg/kg (i.p.) daily from Day 15 to Day 28.High-dose group: received Lysionotin at 20 mg/kg (i.p.) daily from Day 15 to Day 28. All mice were euthanized on Day 29, and lung tissues were harvested for analysis.

For the inhibitor cohort design (n = 110), similarly, ten mice were assigned to the control group, treated with normal saline (i.t.) on Day 1 and vehicle (i.p.) on Days 15–28.The remaining 100 mice were administered BLM (3.3 U/kg, i.t.) on Day 1. On Day 15, successfully modeled mice were randomly divided into four groups (n = 25 per group): Model group: received vehicle (i.p.) on Days 15–28.High-dose Lysionotin group: received Lysionotin at 20 mg/kg (i.p.) on Days 15–28.Lysionotin + ML385 group: received ML385 at 30 mg/kg (i.p.) 3 h prior to Lysionotin (20 mg/kg, i.p.) from Days 15–28.Lysionotin + Compound C (CC) group: received CC at 20 mg/kg (i.p.) 3 h prior to Lysionotin (20 mg/kg, i.p.) from Days 15–28. The vehicle solution used for intraperitoneal injection consisted of 40% polyethylene glycol 300 (PEG300), 5% dimethyl sulfoxide (DMSO), and 5% Tween 80 in sterile water (v/v/v), prepared fresh before use.

Anesthesia was induced via intraperitoneal injection of pentobarbital sodium (40 mg/kg, Sigma-Aldrich, USA). Euthanasia was performed using a higher dose of pentobarbital sodium (150 mg/kg). Death was confirmed by the absence of respiratory and cardiac activity, following institutional guidelines to ensure minimal distress.

Histological analysis of the lung tissue

Lung tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 μm thickness. Sections were stained with hematoxylin and eosin (HE) staining kit (Cat# G1120, Solarbio, Beijing, China) and Masson’s trichrome staining kit (Cat# G1340, Solarbio, Beijing, China) according to the manufacturer’s instructions.

Immunohistochemistry

Tissue sections were de-paraffinized in xylene and hydrated in ethanol. After microwave antigen extraction, sections were incubated with goat serum, followed by alpha-smooth muscle actin (α-SMA) monoclonal antibody (1:500, Cat# 19245T, CST, USA) or collagen I polyclonal antibody (1:500, Cat# 14695-1-AP, Proteintech, China) at 4 °C, overnights. Sections were incubated with goat anti-rabbit immunoglobulin G monoclonal antibody (1:5000, Cat# L3012, SAB, China) at room temperature for 1 h. After incubation with 0.05% diaminobenzidine, the sections were counterstained with hematoxylin and rinsed with PBS.

Hydroxyproline assay to assess lung tissue fibrosis

Hydroxyproline (HYP) was quantified in lung tissue using the HYP Assay Kit (Cat# A030-3-1, Nanjing Jiancheng Institute of Biotechnology, China) according to the manufacturer’s instructions²¹.

Malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, and glutathione (GSH) analysis of lung tissue homogenates

MDA, SOD, and GSH levels were measured MDA assay kits (Cat# A003-1-2, Nanjing Jiancheng Bioengineering Institute, Nanjing, China), SOD assay kits (Cat# A001-3-2, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and GSH assay kits (Cat# A006-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) respectively in lung tissues²².

Cell cultures

Mouse embryonic fibroblasts (NIH3T3 cells) were obtained from the National Key Laboratory of Genetics (Changsha, China) and cultured in Dulbecco’s modified Eagle medium (DMEM)-high glucose (Cat# 11965092, Gibco, USA) containing 10% bovine calf serum (BCS, Sigma, USA) and 1% penicillin–streptomycin solution (Cat# 15140148, Gibco, USA).

Human lung fibroblasts (HFL-1 cells) were purchased from Procell (Wuhan, China) and cultured with Ham’s F-12 K (Gibco, USA) containing 10% fetal bovine serum (Cat# F2442, FBS, Sigma, USA) and 1% penicillin–streptomycin solution.

Primary rat embryonic fibroblasts were isolated from [Sprague-Dawley] rat embryos. Briefly, lung tissues were minced and digested with collagenase I (1 mg/mL) at 37 °C for 60 min, then filtered through 70-µm cell strainers. Red blood cells were lysed using ACK Lysis Buffer (Cat# R1010, Solarbio, China) in an ice bath for 5 minutes. The resulting cell suspension was filtered through a 40-µm strainer, resuspended in DMEM containing 20% fetal bovine serum and 1% penicillin–streptomycin. All cells were cultured in standard tissue culture-treated plastic plates (not pre-coated) under submerged conditions at 37 °C in a humidified incubator with 5% CO₂.Briefly, 3 × 10⁵ cells were seeded per well in 6-well plates. The next day, cells were starved (2% serum) for 12 h and then treated with different compounds. Fibroblasts were induced to transform into myofibroblasts using TGF-β (10 ng/mL, Cat# 100 − 21, Peprotech, USA) stimulation for 24 h.

Cell viability analysis

The cell viability was determined according to the manufacturer’s instructions for Cell Counting Kit-8 Kit (Cat# BL1055B, Biosharp, China). Cells were seeded in a 96-well plate and treated with different concentrations of Lysionotin (0 µM, 1µM, 3 µM, 10 µM, 30 µM, 100 µM). A 10 µL of working reagent was added to each well, and the wells were incubated at 37 °C. Absorbance was measured at 450 nm.

Immunofluorescence of cell and lung tissue sections

Lung tissues and cells were fixed in 4% paraformaldehyde for 24 h, permeabilized using 0.5% (v/v) Triton X-100, incubated with goat serum blocking solution (Cat# SAP-9100, ZSGB Biologicals, China) and then incubated overnight with Nrf2 Polyclonal antibody (1:50, Cat# 16396-1-AP, Proteintech, China), and p-AMPK polyclonal antibody (1:100, Cat# 50081 S, CST, USA) at 4 °C. After washing with TBS buffer containing 0.1% (v/v) Tween 20 (TBST), the samples were incubated with fluorescent secondary antibody (1:100, Cat# SA00013-2, Proteintech, China) diluted in PBS containing 0.1% (v/v) Tween 20 for 1 h at room temperature, stained with DAPI, and observed under fluorescence microscope (Zeiss Apotome).

RNA extraction and quantitative real-time PCR of cell and lung tissue sections

Total RNA extraction was performed using Trizol (Cat# 15596026CN, Thermo Fisher Scientific, USA), and cDNA synthesis was carried out using the Reverse Transcription Kit (Cat# K1691, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Quantitative real-time PCR (Q-PCR) was performed using SYBR GREEN (Cat# A6001, Promega, USA) and Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference gene. The PCR conditions were as follows: 95 °C for 2 min, then 40 cycles of 95 °C for 3 s and 60 °C for 30 s, plus a melting curve of 60–95 °C. Primer sequences are shown in (Table 1).

Table 1.

Primer sequences for Q-PCR.

Gene			Forward primer	Reverse primer
Mouse-GAPDH			CCTGCGACTTCAACAGCAAC	TGGGATAGGGCCTCTCTTGC
Mouse-α-SMA			GCGTGGCTATTCCTTCGTGACTAC	CGTCAGGCAGTTCGTAGCTCTTC
Mouse-collagen I			GAGCGGAGAGTACTGGATCG	GCTTCTTTTCCTTGGGGTTC
Human-GAPDH			TCGTGCTGGACTCTGGAGATGG	CCACGCTCAGTCAGGATCTTCATG
Human-α-SMA			CTCTGGACGCACAACTGGCATC	GGCATGGGGCAAGGCATAGC
Human-collagen I			GCAAGAGTGGTGATCGTGGTGAG	TCGCCCTGTTCGCCTGTCTC
Rat-GAPDH			ACCACAGTCCATGCCATCAC	CCCGCCGACTCCATTCCAATG
Rat-α-SMA			GCCACTGCTGCTTCCTCTTCTTC	CCCGCCGACTCCATTCCAATG
Rat-collagen I			TGTTGGTCCTGCTGGCAAGAATG	GTGGTTTGTGAGTGTGAGGGTCTG
Mouse-HO-1			ACCGCCTTCCTGCTCAACATTG	CTCTGACGAAGTGACGCCATCTG
Mouse-NQO-1			GCGAGAAGAGCCCTGATTGTACTG	AGCCTCTACAGCAGCCTCCTTC

Protein extraction and Western blotting

Total protein lysates were prepared using radioimmune precipitation assaylysis buffer (Cat# R0020, Solarbio, China) according to the manufacturer’s instructions, and the concentration of protein was tested using bicinchoninic acid. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by blotting on polyvinylidene fluoride membranes (Cat# 1620177, Bio-Rad, USA) using Trans-Blot SD semi-dry transfer cell (Bio-Rad Laboratories). 5% (w/v) skim milk with TBST for blocking. The membranes were incubated with GAPDH monoclonal antibody (1:5000, Cat# 81115-1-RR, SAB, China), α-SMA monoclonal antibody (1:1000, Cat# 19245T, CST, USA), collagen I polyclonal antibody (1:1000, Cat# 14695-1-AP, Proteintech, China), p-AMPK monoclonal antibody (1:1000, Cat# 50081 S, CST, USA), AMPK monoclonal antibody (1:1000, Cat# 5832T, CST, USA), HO-1 monoclonal antibody (1:2000, Cat# ab189491, Abcam, UK), NQO-1 monoclonal antibody(1:10000, Cat# ab80588, Abcam, UK) and Nrf2 monoclonal antibody (1:2000, Cat# 16396-1-AP, Proteintech, China) at 4℃ overnight. Membranes were washed three times with TBST and incubated with goat anti-rabbit immunoglobulin G monoclonal antibody (1:5000, Cat# L3012, SAB, China) or goat anti-mouse immunoglobulin G monoclonal antibody (1:5000, Cat# L3032, SAB, China) at room temperature for 2 h. The bands were visualized using Luminata™ Crescendo chemiluminescence horseradish peroxidase substrate (Millipore, USA) and scanned using Gene Gnome XRQ imager (Syngene, UK).

Cellular ROS detection

NIH3T3 cells were first washed with pre-warmed PBS to remove serum-containing medium, then incubated with 50 µM H₂DCFDA (Cat# C400, Invitrogen™, USA) diluted in serum-free DMEM for 30 min at 37 °C in the dark. After incubation, cells were washed three times with pre-cooled PBS. For qualitative assessment, fluorescence images were acquired using a Nikon Ti-s fluorescence microscope (Tokyo, Japan) using the FITC filter set (excitation/emission ≈ 495/529 nm).

For quantitative analysis, cells were harvested using trypsinization, centrifuged at 300 × g for 5 min at 4 °C, and resuspended in cold PBS. The fluorescence intensity of the oxidized DCF (reflecting ROS levels) was measured by flow cytometry using a BD LSRFortessa (BD Biosciences, Franklin Lakes, NJ, USA). Data were collected from at least 10,000 events per sample, using excitation at 488 nm and emission collected at 530 ± 15 nm. Fluorescence signals were analyzed using FlowJo software (Tree Star Inc., Ashland, USA). The mean fluorescence intensity was used to quantify intracellular ROS production.

SiRNA transfection

Cells were seeded on six-well plates. When cells reached 60–80% confluence, they were transfected with siRNA (control siRNA or AMPK siRNA or Nrf2 siRNA, Cat# sc-37007, sc-29674, Cat# sc-37049, Santa Cruz, USA) using Lipofectamine 3000(Cat# L3000150, Invitrogen, USA) according to the manufacturer’s instructions. After incubation, fresh DMEM containing 20% BCS was added, and cells were cultured for 24 h. Then cells were treated with Lysionotin with or without TGF-β (10 ng/mL) for 24 h. After 24 h, cells were harvested for protein or RNA extraction.

Statistical analysis

Statistical analyses and graph assembly were carried out using GraphPad Prism 9.0 (GraphPad Prism Software). All data were described as the means ± SD. One-way analysis of variance and Tukey’s multiple comparisons test were used to compare the groups. Statistical significance was set at P < 0.05.

Results

Protect effects of Lysionotin on BLM-induced pulmonary fibrosis in mice

To explore whether Lysionotin could alleviate BLM-induced lung fibrosis in mice, we conducted a series of in vivo experiments as outlined in (Fig. 1A). Mice administered BLM intratracheally on Day 0 to induce pulmonary fibrosis. Starting on Day 14, different doses of Lysionotin (0.8, 4, or 20 mg/kg) were intraperitoneally administered for 14 consecutive days, and lung fibrosis was assessed on Day 28. The chemical structure of Lysionotin is illustrated in (Fig. 1B). HE and Masson’s trichrome staining were applied to appraise the pathological changes of lung tissues. The results indicated that the control group mice had intact lung tissue structure, well-defined intrapulmonary structures, standard alveolar septa, and fewer blue-stained areas. In comparison with the control group, the bleomycin group had apparent destruction of alveolar structure, thickening of alveolar septa, extensive inflammatory cell infiltration and fibroblast proliferation, and the blue-stained area was apparent comparing with the bleomycin group where the fibrosis degree of mice had some improvement in the Lysionotin (20 mg/kg) group (Fig. 1C). Meanwhile, Lysionotin reduced the mortality of mice in a dose-dependent manner (Fig. 1D). The levels of HYP in the BLM group were significantly increased compared with those in the control group; the levels of HYP in the high-dose Lysionotin group were markedly declined, and the differences were statistically significant (Fig. 1E). Additionally, the levels of collagen I and α-SMA in lung tissues were detected by immunohistochemistry, western blotting and Q-PCR, respectively. The positive staining, protein abundance, and mRNA levels of both markers were significantly increased in the BLM group, whereas these levels were notably decreased following high-dose Lysionotin treatment, consistent with the histological findings (Fig. 1C, I,J, K,L). Altogether, these results showed that Lysionotin treatment mitigated BLM-induced pulmonary fibrosis.

Fig. 1.

Protective effects of Lysionotin on BLM-induced pulmonary fibrosis in mice. (A) On days 15 to 28, after intratracheal instillation of BLM on Day 0, Lysionotin was administered intraperitoneally at high (20 mg/kg), moderate (4 mg/kg), and low (0.8 mg/kg) doses to evaluate its therapeutic effects on pulmonary fibrosis. (B) Structure of Lysionotin. (C) HE and Masson’s trichrome staining were used to evaluate the lung morphology and ECM deposition; Immunohistochemistry was used to detect the positive expression of α-SMA and collagen I in the lung tissue. (D) The probability of animal survival was recorded. (E) The total hydroxyproline content of the lung tissue was determined. (F–H) The MDA content, GSH levels and SOD activity were measured following the manufacturer’s protocol. (I–N) Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of α-SMA, collagen I, HO-1 and NQO1. The following notations are used: CON for the control group; BLM for the BLM group; Lyn is the abbreviation of Lysionotin. Data are expressed as mean ± SD, n = 8, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Protect effects of Lysionotin on oxidative stress in BLM-induced pulmonary fibrosis mice

As oxidative damage is instrumental in BLM-induced lung fibrosis, we assayed whether Lysionotin treatment suppressed BLM-induced oxidative stress. In the lung tissue of BLM mice, MDA formation was noticeably enhanced, and Lysionotin treatment inhibited these changes (Fig. 1F). SOD and GSH are imperative to prevent oxidative stress. Lysionotin also appreciably attenuated BLM-induced depletion of SOD and GSH (Fig. 1G,H). We found that the reduction in HO-1 and NQO-1 mRNA and protein levels after BLM exposure was rescued by 20 mg/kg Lysionotin (Fig. 1I–K,M,N). The above results suggest Lysionotin treatment attenuates BLM-induced oxidative stress in BLM-induced pulmonary fibrosis.

Lysionotin inhibits TGF-β-induced myofibroblast differentiation

Myofibroblast differentiation is a key step in the progression of fibrosis, with TGF-β being the most important mediator of this process. We evaluated the effect of Lysionotin on TGF-β-induced myofibroblast differentiation. We first tested various concentrations of Lysionotin (0 µM, 1 µM, 3 µM, 10 µM, 30 µM, and 100 µM) to assess its impact on cell viability (Fig. 2A, F, K). We used non-toxic doses for subsequent experiments. TGF-β-mediated myofibroblast differentiation in NIH3T3 cells, primary rat embryonic fibroblasts, and HLF-1 cells showed increased levels of collagen I and α-SMA mRNA and protein expression. Lysionotin significantly inhibited myofibroblast differentiation at a concentration of 30 µM, and the difference was statistically significant. Q-PCR results also showed that Lysionotin inhibited myofibroblast differentiation (Fig. 2B–E, G–J, L–O). These results indicate that Lysionotin inhibits TGF-β-mediated myofibroblast differentiation.

Fig. 2.

Lysionotin inhibits TGF-β-induced myofibroblast differentiation in 3 different cell types. The NIH3T3 cells, HFL-1 cells, and primary rat lung fibroblasts were incubated with different doses of Lysionotin and TGF-β (10 ng/mL) for 24 h. (A) The effects of the different concentrations of Lysionotin (0, 1, 3, 10, 30, and 100 µM) on cell viability were evaluated in NIH3T3 cells. (B–E) Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of α-SMA and collagen I in NIH3T3 cells. (F–J) Cell viability and expression of α-SMA and collagen I (protein and mRNA) in HFL-1 cells. (K–O) Cell viability and expression of α-SMA and collagen I (protein and mRNA) in primary rat lung fibroblasts. The following notation is used: Lyn is the abbreviation of Lysionotin. Data are expressed as mean ± SD, n = 3, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Lysionotin inhibits TGF-β-induced oxidative stress and fibrosis progression through Nrf2

Redox pathways have been documented to be associated with the regulation of TGF-β signaling^9,10. Lysionotin treatment was examined by immunofluorescence and flow cytometry to detect whether it could repress TGF-β-induced ROS production. We found that TGF-β distinctly induced ROS generation, while Lysionotin treatment inhibited ROS generation (Fig. 3A–C). Numerous studies have revealed that Nrf2 performs a vital role in clearance of ROS and myofibroblast differentiation^15,23. To elucidate the role of Nrf2 in Lysionotin-mediated regulation of myofibroblast differentiation, we examined its subcellular localization and downstream target expression. Lysionotin was found to promote Nrf2 nuclear translocation, accompanied by enhanced expression of downstream antioxidant enzymes HO-1 and NQO-1 (Fig.3D–G). By administering Nrf2 blocker ML385 and Nrf2 siRNA, the inhibition of TGF-β-induced myofibroblast differentiation by Lysionotin is partially attenuated (Fig. 3H–M). In summary, Nrf2 mediates the antioxidant effects of Lysionotin and its inhibition of myofibroblast differentiation.

Fig. 3.

Lysionotin inhibits TGF-β-induced oxidative stress and fibrosis progression through Nrf2 in NIH3T3 cells. NIH3T3 cells were incubated with three different concentrations of Lysionotin (3, 10, and 30 µM) and TGF-β (10 ng/mL) for 24 h. (A–C) The content of ROS was observed under fluorescence microscope and detected by flow cytometry. (D) Nrf2 nuclear translocation was observed under fluorescence microscope. (E–G) Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of HO-1 and NQO-1. (H–J) NIH3T3 cells were pre-incubated with ML385 (5 µM) for 1 h before the addition of Lysionotin and TGF-β. Western blotting and Q-PCR were used to analyze the protein and mRNA expression levels of α-SMA and collagen I. (K–M) After transfection with Nrf2-targeted siRNA or control siRNA, Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of α-SMA and collagen I. The following notation is used: Lyn is the abbreviation of Lysionotin. Data are expressed as mean ± SD, n = 3, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

AMPK mediates the anti-fibrotic effects of Lysionotin in vivo and in vitro

Nrf2 can be activated by a diverse range of upstream signals, and AMPK is an important kinase that can promote Nrf2 activation¹⁷. We found that Lysionotin was able to activate AMPK in BLM-induced pulmonary fibrosis in mice (Fig. 4A). Next, to delineate the effect of AMPK activation in Lysionotin regulation of myofibroblast differentiation, we pretreated NIH3T3 with Lysionotin and found that Lysionotin could phosphorylate AMPK in a concentration and time-dependent manner (Fig. 4B–E). And after using AMPK inhibitor CC and AMPK siRNA, the expression of HO-1 and NQO-1 significantly diminished and the expression of collagen I and α-SMA increased (Fig. 4F–K) These results showed that AMPK mediates the protective effects of Lysionotin.

Fig. 4.

AMPK mediates the anti-fibrotic effects of Lysionotin. (A) On days 15 to 28, after intratracheal instillation of BLM, intraperitoneal injections of Lysionotin were administered at high (20 mg/kg), moderate (4 mg/kg), and low (0.8 mg/kg) doses to evaluate its therapeutic effects on pulmonary fibrosis. Immunofluorescence was used to detect AMPK phosphorylation, n = 8. (B,C) NIH3T3 cells were incubated with different doses of Lysionotin (3, 10, 30 µM) for 6 h. Western blotting was used to detect the protein expression of p-AMPK. (D,E) NIH3T3 cells were incubated with Lysionotin (30 µM) for 0, 1, 3, 6 h. Western blotting was used to detect the protein expression of p-AMPK. (F–H) NIH3T3 cells were pre-treated with compound C (40 µM) for 1 h before the addition of Lysionotin (30 µM) and TGF-β (10 ng/mL). Western blotting and Q-PCR were used to detect the protein and mRNA level of α-SMA and collagen I, HO-1 and NQO-1. (I–K) After transfection with AMPK-targeted siRNA or control siRNA, Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of α-SMA and collagen I, HO-1 and NQO-1. The following notations are used: CON for the control group; BLM for the BLM group; CC for the CC group; Lyn is the abbreviation of Lysionotin. Data are expressed as mean ± SD, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Lysionotin ameliorates BLM-induced pulmonary fibrosis via AMPK/Nrf2 pathway in mice

To analyse the molecular mechanism underlying Lysionotin’s anti-fibrotic effects, we employed two specific inhibitors: ML385 and CC. ML385 is a selective inhibitor of Nrf2 that blocks its transcriptional activity by binding to its Neh1 DNA-binding domain, thereby preventing its interaction with antioxidant response elements in the promoter regions of cytoprotective genes such as HO-1 and NQO-1. Inhibiting Nrf2 allows us to evaluate whether Lysionotin’s protective effects depend on Nrf2-mediated antioxidant signaling. CC, a well-characterized AMPK inhibitor, acts by suppressing AMPK phosphorylation and its downstream signaling cascades. This inhibitor helps determine whether AMPK activation is required for the anti-fibrotic action of Lysionotin, potentially through regulation of oxidative stress. Intraperitoneal injection of Lysionotin was started on Day 15 after BLM modeling, and ML385 and CC were administered intraperitoneally 3 h before Lysionotin injection. HE and Masson’s trichrome staining indicated that ML385 and CC blocked BLM-induced alveolar wall thickening and extracellular matrix deposition in mice (Fig. 5A). Meanwhile, CC and ML385 reversed the protective effect of Lysionotin against mouse mortality (Fig. 5B). The levels of HYP, α-SMA, and collagen I were significantly decreased in the Lysionotin-treated group compared to the BLM model group. However, these levels were significantly elevated in the ML385- or CC-treated groups, indicating that inhibition of Nrf2 or AMPK partially reversed the protective effects of Lysionotin (Fig. 5D, H–J). AMPK activation is inhibited by ML385 and CC (Fig. 5C). Similarly, the inhibitory effect of Lysionotin on BLM-induced oxidative stress in mice is impaired by ML385 and CC (Fig. 5E–J). Therefore, we concluded that Lysionotin ameliorates the BLM-induced pulmonary fibrosis in mice through the AMPK/Nrf2 pathway.

Fig. 5.

Lysionotin ameliorates BLM-induced pulmonary fibrosis via AMPK/Nrf2 pathway in mice. On days 15 to 28, an intraperitoneal injection of 30 mg/kg of ML385 and 20 mg/kg of CC were administered 3 h before the intraperitoneal injection of high-dose Lysionotin (20 mg/kg). (A) HE and Masson’s trichrome staining were used to evaluate the lung morphology and ECM deposition. (B) The probability of animal survival was recorded. (C) Immunofluorescence was used to detect AMPK phosphorylation. (D) The total hydroxyproline content of the lung tissue was determined. (E–G) The MDA and GSH levels and the activity of SOD were measured. (H–J) Western blotting and Q-PCR were used to detect the protein and mRNA expression levels of α-SMA, collagen I, HO-1 and NQO1. The following notations are used: CON for the control group; BLM for the BLM group; BLM + Lyn for the BLM + 20 mg/kg Lysionotin group; BLM + Lyn + ML385 for the BLM + 20 mg/kg Lysionotin group + 30 mg/kg ML385; and BLM + Lyn + CC for the BLM + 20 mg/kg Lysionotin group + 20 mg/kg CC; Lyn is the abbreviation of Lysionotin. Data are expressed as mean ± SD, n = 8, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Discussion

For the first time, our study demonstrated that Lysionotin alleviates BLM-induced pulmonary fibrosis in mice and provides evidence that Lysionotin inhibits TGF-β-induced differentiation of fibroblasts to myofibroblasts in vitro, the effects of which may be mediated through AMPK/Nrf2 (Fig. 6).

Fig. 6.

Schematic of a model of the anti-pulmonary fibrosis effect of Lysionotin. Lysionotin enhances the phosphorylation of AMPK, promotes the nuclear translocation of Nrf2, and increases the expression of the downstream antioxidant genes HO-1 and NQO1, thus scavenging excessive ROS in the cells. Thus, the TGF-β signaling is inhibited, and the expression of pro-fibrotic genes α-SMA and collagen type I is decreased.

Intratracheal instillation of BLM to establish a mouse model of pulmonary fibrosis is one of the most used methods to study the pathogenesis of pulmonary fibrosis. In the first week after intratracheal instillation of BLM, mice were in the acute lung injury and inflammation phase, with extensive lung tissue damage and a series of inflammatory reactions. The inflammation gradually subsided during the second week, while the inflammatory response remained the main pathological feature of this period. In the third week, mice entered the fibrotic phase, with an increase in myofibroblasts and a peak in collagen and other ECM deposits at 28 days^24,25. Although many anti-inflammatory compounds can effectively inhibit BLM-induced pulmonary fibrosis in mice, they might be due to an indirect anti-fibrotic effect by inhibiting the inflammatory response and not a direct anti-fibrotic effect. A previous study has shown that Lysionotin can protect mice against pneumonia caused by Staphylococcus aureus and is a potential treatment for Staphylococcus aureus pneumonia²⁰. To investigate the effect of Lysionotin on pulmonary fibrosis, we injected different concentrations of Lysionotin intraperitoneally from days 15–28 to observe whether Lysionotin has a direct anti-pulmonary fibrosis effect, and the results showed that Lysionotin could directly inhibit pulmonary fibrosis.

The formation and progression of pulmonary fibrosis is often attributed to oxidative stress or antioxidant imbalance²⁶. Various antioxidants have been shown to have potential in preventing or treating fibrosis^27–30. Our study found that Lysionotin reduced MDA levels and increased GSH levels and SOD activity in mice with pulmonary fibrosis. In vitro studies also showed that Lysionotin can reduce TGF-β-induced ROS content, indicating that the anti-pulmonary fibrosis effect of Lysionotin may be related to its antioxidant effect. Nrf2 is a critical factor in the cellular response to antioxidant stress, which transcriptionally activates antioxidant proteins and cytoprotective genes by binding to antioxidant response element motifs to scavenge excessive intracellular ROS and mitigate oxidative damage³¹. Numerous studies have confirmed the therapeutic potential of targeted activation of Nrf2 in pulmonary fibrosis^32,33. In addition, the Nrf2 activator SFN has been used in phase II clinical trials to treat chronic obstructive pulmonary disease³⁴. We found that Lysionotin activates Nrf2 and promotes the expression of HO-1 and NQO1 in NIH3T3 cells. With the Nrf2 inhibitor ML385 administration and small molecule RNA silencing Nrf2, the results showed that the inhibition of myofibroblast transformation by Lysionotin was reversed. Therefore, we propose that Nrf2 mediates the antioxidant and anti-fibrotic effects of Lysionotin. Some studies have shown that TGF-β can cause Nrf2 activation by promoting ROS production³⁵. In contrast, our results showed that TGF-β inhibited the expression of antioxidant proteins HO-1 and NQO-1. We speculate that this is attributed to the activation of the Smad transcription factor by TGF-β. Then Smad binding element downregulated HO-1 and NQO-1 by directly inhibiting ARE sequence. However, this is a suspicion that needs to be further tested.

Nrf2 can be activated by various upstream signals, among which AMPK is an important kinase that can facilitate Nrf2 activation¹⁷. Studies found that mediating the AMPK/Nrf2 signaling pathway could ameliorate carbon tetrachloride-induced kidney inflammation and fibrosis in mice, and cordycepin prevented radiation ulcers by inhibiting cellular senescence in rodents through Nrf2 and AMPK^36,37. After inhibiting AMPK with CC and silencing AMPK with small molecule RNA, the results showed that the activation of Nrf2 and myofibroblast transformation by Lysionotin were inhibited. Therefore, we presume the activation of Nrf2 by Lysionotin may be mediated by AMPK. Our further study revealed that Lysionotin could promote AMPK phosphorylation in a time and concentration-dependent manner. AMPK is an important control center of cellular energy homeostasis, and its enzymatic activity is susceptible to cellular energy load³⁸. Under low energy conditions, binding of AMP to the γ-subunit alters the conformation in favor of phosphorylation of Thr172 of the α-subunit, leading to a substantial increase in the enzymatic activity of AMPK³⁹. Activation of Calcium-Dependent Protein Kinase Kinase 2 (CaMKK2) mediated by stimuli such as elevated intracellular calcium levels is also a major cause of AMPK activation. It was found CAMKK2 could play a protective role in ferroptosis by activating the AMPK/Nrf2 pathway⁴⁰. Autophagy mediated by disruption of the Liver Kinase B1 (LKB1)-AMPK- Unc-51 Like Autophagy Activating Kinase 1 (ULK1) axis could exacerbate BLM-induced pulmonary fibrosis⁴¹. However, our experiments only suggest that Lysionotin can activate AMPK, and further research is needed to explore the mechanism of its activation.

In recent years, natural products have been widely recognized for their anti-inflammatory, antioxidant, immunomodulatory and metabolic functions in the prevention and treatment of tumors, metabolic diseases and respiratory disorders⁴². Many preclinical studies have shown that many natural products of plant origin can have preventive or therapeutic effects on pulmonary fibrosis through various mechanisms, such as reducing oxidative damage, ameliorating inflammation, inhibiting fibroblast proliferation and activation, and improving metabolic disorders^43–45. Salvia miltiorrhiza ethyl acetate extracts ameliorate pulmonary fibrosis by targeting Nrf2-NOX4 to inhibit the production of reactive oxygen species⁴⁶. Icariin alleviated BLM-induced pulmonary fibrosis by targeting Hippo/YAP pathway⁴⁷. Lysionotin is herb of the Lithospermum (Lysionotus) in the family Picrorhizaceae with complex chemical composition and pharmacological effects such as antibacterial, anti-inflammatory and hepatoprotective. As one of the active ingredients extracted from Lithospermum, Lysionotin also has significant biological effects such as anti-inflammatory and free radical scavenging^19,20. Our study demonstrated firstly that Lysionotin could regulate oxidative stress levels through AMPK/Nrf2 signaling pathway and then inhibit BLM-induced pulmonary fibrosis of mice, with certain theoretical and clinical application value.

Conclusion

Our data revealed for the first time the therapeutic effect of Lysionotin on BLM-induced pulmonary fibrosis in mice. Lysionotin promotes Nrf2 nuclear translocation and its downstream expression of antioxidant genes NQO-1 and HO-1 by phosphorylated activation of AMPK, thereby decreasing the intracellular ROS content and inhibiting TGF-β-induced myofibroblast differentiation. These results suggest that Lysionotin may be a potential candidate for the treatment of pulmonary fibrosis.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

IPF

Idiopathic pulmonary fibrosis

TGF-β

Transforming growth factor-β

Nrf2

Nuclear factor erythroid 2–related factor 2

SFN

Sulforaphane

AMPK

AMP-activated protein kinase

BCS

Bovine calf serum

NQO-1

NAD(P)H quinone dehydrogenase 1

HO-1

Heme oxygenase 1

CaMKK2

Calcium-dependent protein kinase kinase 2

NOX4

NADPH oxidase 4

MDA

Malondialdehyde

SOD

Superoxide dismutase

GSH

Glutathione

i.t.

Intratracheal instillation

i.p.

Intraperitoneal injection

α-SMA

α-smooth muscle actin

ROS

Reactive oxygen species

Author contributions

Conceptualization, W.X, W.L. and S.T.; Data curation, W.X.; Formal analysis, L.L., D.X. and R.Q.; Funding acquisition, S.T. and W.L.; Investigation, Y.L.; Methodology, W.X. and M.L.; Project administration, X.Z. and Y.L.; Writing original draft, X.Z.; Writing review & editing, W.X. and W.L. All authors have read and agreed to the published version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Fund for the State Key Laboratory of Hunan Province, China (grant number: 2017TP1004); the open Sharing Fund for the Large-scale Instruments and Equipments of Central South University (grant numbers: CSUZC202251); and the Fundamental Research Funds for the Central Universities of Central South University (grant numbers: CX20210344).

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Competing interests

The authors declare no competing interests.

Approval for animal experiments

The animal experiments were conducted following laboratory animals’ welfare and ethical principles, and all procedures were approved by the Laboratory Animal Welfare and Ethical Committee of Central South University (CSU-2022-0095). The authors ensured full compliance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines to promote transparency and reproducibility in reporting animal studies.

Methodology compliance statement

All experimental methods were performed in accordance with the relevant guidelines and regulations.