KLF11 alleviates rheumatoid arthritis by regulating M1 macrophage polarization via downregulation of YAP1 expression

Abstract

Rheumatoid arthritis (RA) is a chronic autoimmune disease, primarily impacting joints and bones. The Gene Expression Omnibus (GEO) datasets (GSE55235 and GSE10500) revealed that KLF11 expression was lower in the patients with RA, which was confirmed by the collected RA samples. However, KLF11's function and molecular mechanism in RA remain to be elucidated. In our study, we investigated this issue using in vivo and in vitro models. Our findings consistently demonstrated the downregulation of KLF11 in mice with collagen-induced arthritis (CIA). Overexpression of KLF11 reduced the arthritis severity and the extent of bone destruction in mice with CIA, whereas KLF11 knockdown exerted the opposite effect. Additionally, it was noted to inhibit M1 macrophage polarization and the ERK pathway both in vivo and in vitro. The JASPAR database indicated the potential for KLF11 to bind to the YAP1 promoter region. ChIP and dual-luciferase reporter assays confirmed the binding of KLF11 to the promoter of YAP1. Further experiments demonstrated that KLF11 negatively regulated YAP1 expression in THP-1 cells. YAP1 overexpression partially reversed the KLF11's inhibitory effect on the ERK signaling pathway and M1 macrophage polarization in vitro. KLF11 may be a promising therapeutic target for RA.

Introduction

Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease that primarily leads to joint injuries [28]. This disease is defined by the inflammatory cell infiltration in the synovium, cartilage damage, angiogenesis, and synovial hyperplasia [19]. The manifestations include stiffness, pain, swelling, and fever in the affected joints [30]. Statistical data indicates that the prevalence of this condition affects approximately 0.5–1% of the global population [16, 32]. The incidence rate is approximately three times higher in women than in men, with a peak age of onset at 40–50 years old [12]. Moreover, RA can also affect other organs, including the skin, liver, eye, bone, nerves, kidney, heart, and lung [10]. The etiology of RA remains unknown, although numerous risk factors have been identified, including genetics, smoking, obesity, unhealthy dietary habits, periodontal disease, and a family history of the disease [29]. The current therapeutic approaches are employed with the objective of regulating inflammation and pain in individuals diagnosed with RA [1]. Nevertheless, the dearth of knowledge regarding the molecular mechanisms hinders the development of an efficacious therapeutic intervention.

Krüppel-like factor 11 (KLF11), a zinc finger transcription factor, contributes to the pathogenesis of various diseases [36]. The function of KLF11 as a transcriptional activator or repressor is dependent on the context, as evidenced by previous studies [24]. A previous study demonstrated that KLF11 protects against ischemic brain injury by mitigating the inflammatory response [31]. The knockdown of KLF11 in mice has been demonstrated to exacerbate renal fibrosis through the TGF-β/Smad and pro-inflammatory pathways [9]. Moreover, KLF11 has been shown to control inflammatory activation of endothelial cells [11]. A deficiency of endothelial KLF11 has been demonstrated to exacerbate the formation of abdominal aortic aneurysms by regulating the endothelial cell inflammatory response [37]. Overexpression of KLF11 has been demonstrated to protect chondrocytes via the p38 MAPK pathway [14]. However, further investigation is required to elucidate KLF11's expression and function in RA.

In this study, data downloaded from GEO datasets (GSE55235 and GSE10500) revealed that KLF11 expression was lower in patients with RA. In light of the aforementioned evidence, we postulated that KLF11 may exhibit protective effects against RA. To validate this hypothesis, we developed a murine model to confirm the downregulation of KLF11 expression and evaluate KLF11's potential role in RA.

Materials and methods

Data collection

The expression of KLF11 in GSE55235 and GSE10500 datasets was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo) and was analyzed using the GEO2R data analysis tool (https://www.ncbi.nlm.nih.gov/geo/geo2r/). The interaction between transcription factor and target gene was predicated using the Jaspar database (https://jaspar.elixir.no/).

Human synovial tissue collection

Human synovial tissue samples were collected from patients with RA and osteoarthritis (OA) during joint replacement surgery, with OA patients enrolled as controls in this study.

Animal model of collagen-induced arthritis (CIA)

Five- to six-week-old male DBA/1 mice (Charles River, China) were allowed to acclimate for one week and then randomly assigned to four groups. The animal procedures were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH) and approved by the Laboratory Animal Ethics Committee of China Medical University. The animal model of CIA was established in accordance with the methodology previously described [15, 20]. In brief, the mice were intradermally injected with 100 µg of collagen type II emulsified in complete Freund's adjuvant at the base of the tail. On day 21, the mice were immunized with an of 100 μg of type II collagen via intradermal injection. Meanwhile, lentivirus carrying KLF11 or NC (5 × 10⁸ particles per mouse)/lentivirus harboring KLF11 shRNA or shNC (5 × 10⁸ particles per mouse) was injected into the ankle joint cavity of mice. On day 30, the mice were administered the same dose of lentivirus. The untreated model mice were injected with the same volume of PBS. At the conclusion of the experiment (day 51), the thickness of the hind paw was quantified using a caliper. The mice were euthanized to collect blood samples and synovial samples.

Evaluation of arthritis severity

The severity of arthritis was evaluated at 5-day intervals following the first immunization. Each paw was evaluated on a scale of 0–4 as previously described [3]. The maximum score for each mouse was 16, based on the assessment of all four paws.

HE staining

For HE staining, paraffin-embedded ankle joint tissues were cut into 4 μm sections in thickness. The sections were deparaffinized with xylene and subsequently rehydrated with graded ethanol. Subsequently, hematoxylin (Sinopharm) was introduced to the sections for a 5-min staining period. Following this, the sections were stained with eosin (Sinopharm) for 3 min, dehydrated in graded ethanol, and cleared in xylene. The pathological alterations were observed via microscopic examination (Olympus).

Safranin O-fast green staining

The ankle joint tissues were fixed in 4% paraformaldehyde for 6 h, embedded in paraffin, and then sectioned into 4 μm sections. The sections were deparaffinized in xylene and stained with Fast Green Solution (Servicebio, China) for 5 min at 25℃. Subsequently, the excess stain was removed, and the sections were stained with Safranin O Solution (Servicebio) for 12 s. The sections were then dehydrated in graded ethanol, cleared in xylene, and sealed with neutral resin. Images were obtained using an Olympus microscope (Japan).

Immunofluorescence

Tissue samples were fixed in 4% paraformaldehyde for 24 h, embedded in O.C.T. compound, snap frozen, and then sectioned. The THP-1 cells grown on glass coverslips were fixed for 15 min in 4% paraformaldehyde. Subsequently, the sections and glass coverslips were then immersed in 0.1% Triton X-100 for 30 min, blocked with goat serum for 15 min at 25℃, and incubated with antibodies to KLF11 (1:50; sc-136101; Santa Cruz), CD86 (1:100; 13,395–1-AP; Proteintech), iNOS (1:500; ab178945; Abcam), or F4/80 (1:100; #29,414–1-AP; Proteintech) at 4℃ overnight. Following a series of PBS washes, the sections were incubated at 25℃ with Alexa Fluor 647-conjugated IgG (1:200; #ab150075; Abcam) for 1 h. Subsequently, the nucleus was counterstained with DAPI. The stained sections and coverslips were then photographed with a confocal fluorescence microscope (Olympus).

ELISA assays

To quantify the levels of pro-inflammatory cytokines, serum and synovial tissues were obtained from the mice, and the culture supernatant was harvested from the treated THP-1 cells. The levels of TNF-α, IL-1β, and IL-6 were quantified using ELISA kits (Beyotime).

Cell culture and treatment

THP-1 cells were obtained from the cell bank at Chinese Academy of Sciences (China). The cells were maintained in RPMI 1640 medium (Gibco) containing 10% FBS (Gibco) at 37℃ in a 5% CO₂ incubator. To induce M1 macrophages, THP-1 cells were treated with 100 ng/mL PMA for 48 h, followed by incubation with 100 ng/mL LPS and 20 ng/mL IFN-γ for an additional 48 h [26].

Cell transfection

Upon reaching 70% confluence, the cells grown on 6-well plates were transfected with sh-KLF11/sh-NC or KLF11 overexpression plasmid/empty vector using Lipofectamine 3000 (Invitrogen). At 24 h post-transfection, the cells were incubated with PMA/LPS/IFN-γ to induce an M1 phenotypic profile as previously described [26].

Real-time PCR

Total RNA was extracted from THP-1 cells and the synovial tissues using TRIzol reagent (Invitrogen, USA). The absorbance was measured using the NanoDrop spectrophotometer (Thermo Fisher) to calculate the A260/A280 ratio. The total RNAs was reverse-transcribed into cDNA using M-MLV reverse transcriptase (Invitrogen, USA), and real-time PCR was conducted using SYBR Green Master Mix (Applied Biosystems, USA) on the 7500 Fast Real-Time PCR System (Applied Biosystems). The primers were synthesized by Sangon Biotech (China) for use in this study. The relative expression was calculated using the 2^–ΔΔCt method. The primer sequences are listed in Table 1.

Table 1.

Primer sequences for real-time PCR

Name	Forward (5'–3')	Reverse (5'–3')
IL-1β (mouse)	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT
TNF-α (mouse)	CAACCAACTAGTGGTGCCAG	GTGGGTGAGGAGCACGTAG
IL-6 (mouse)	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
CD86 (mouse)	AAAGTTGGTTCTGTACGAGCAC	GGCCCAGGTACTTGGCATT
iNOS (mouse)	CAGATCGAGCCCTGGAAGAC	CTGGTCCATGCAGACAACCT
β-actin (mouse)	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
KLF11 (human)	ACGGTCTTGGCGGCCTAG	ACTTTCATCAAAACCAGCCTCC
CD86 (human)	CTGCTCATCTATACACGGTTACC	GGAAACGTCGTACAGTTCTGTG
iNOS (human)	TCTTGGTCAAAGCTGTGCTC	CATTGCCAAACGTACTGGTC
YAP1 (human)	TAGCCCTGCGTAGCCAGTTA	TCATGCTTAGTCCACTGTCTGT
β-actin (human)	GTACCACTGGCATCGTGATGGACT	CCGCTCATTGCCAATGGTGAT

Western blotting

Total protein was extracted from the synovial tissues and THP-1 cells using RIPA buffer (Thermo Fisher Scientific). The protein concentration was determined using the BCA method (Beyotime, China), as described by the manufacturer. Subsequently, the samples were subjected to SDS-PAGE and subsequently electrophoretically transferred onto PVDF membranes (Millipore, USA). Following a blocking step with 5% non-fat milk, the membranes were incubated with antibodies against KLF11 (1:1000; sc-136101; Santa Cruz, USA), CD86 (1:2000; 13,395–1-AP; Proteintech, USA), YAP1 (1:3000; 13,584–1-AP; Proteintech), iNOS (1:1000; ab178945; Abcam, USA), p-ERK1/2 (1:1000; #4370; CST, USA), and ERK1/2 (1:1000; #4695; CST) at 4℃ overnight. This was followed by an incubation with HRP-conjugated secondary antibody (1:5000; #ab205718; Abcam) for 1 h at 37℃. Visualization of bands was achieved using BeyoECL Plus Reagent (Beyotime).

Luciferase reporter assay

The promoter fragments of YAP1 were cloned into the pGL3-basic vector (Promega, USA) for subsequent analysis. THP-1 cells were co-transfected with a recombinant plasmid carrying the promoter fragment of YAP1 and a KLF11 overexpression plasmid using Lipofectamine 3000 (Invitrogen). At 24 h post-transfection, relative luciferase activity was monitored using a Dual-Luciferase Reporter Assay System (Promega).

Chromatin immunoprecipitation (ChIP) assay

A ChIP assay was conducted using the ChIP assay kit (Beyotime, China). In brief, the cells were exposed to 1% formaldehyde for 10 min at 37℃ and the cross-linking was terminated by 5 min of incubation with glycine solution at 25℃. The cells were lysed in SDS lysis buffer for 10 min on ice. Thereafter, the chromatins were subjected to sonication, resulting in the generation of DNA fragments with a length of approximately 200 to 1000 bp. Subsequently, the supernatant was harvested and diluted after a 5-min centrifugation at 12,000 × g. A total of 50 µl of Protein A/G magnetic beads was added to the supernatant in order to remove any non-specific binding. Subsequently, the supernatant was incubated with an antibody against KLF11 (1:50; Proteintech) or normal IgG at 4℃ overnight. A total of 80 µl of Protein A/G magnetic beads were added to capture the antibody-chromatin complexes at 4 °C for 1 h. Following elution, the obtained DNA fragments were subjected to PCR analysis.

Statistical analysis

The data are presented as mean ± standard deviation. The statistical analyses were conducted using one-way ANOVA, followed by Tukey's test or student's t-test. P < 0.05 was considered statistically significant.

Results

KLF11 is downregulated in patients with RA

First, we downloaded data from the GEO datasets and then screened differentially expressed mRNAs. The results demonstrated a significant reduction in KLF11 expression in the synovial tissues of patients with either RA compared to healthy donors (GSE55235). Furthermore, the GSE10500 dataset was employed to substantiate the downregulation of KLF11 in RA. KLF11 expression was significantly reduced in the PBMCs of patients with RA (GSE10500) (Fig. 1A). The samples of RA synovial tissues were collected to detect the expression of KLF11. As shown in Fig. 1B and C, the mRNA and protein levels of KLF11 in RA synovial tissues were observably downregulated, indicating that KLF11 might have a potential role in the pathogenesis of RA.

Fig. 1.

KLF11 overexpression attenuates arthritis severity and bone destruction in mice with collagen-induced arthritis (CIA). A The data from the GEO datasets (GSE55235 and GSE10500) were downloaded and then KLF11 expression in patients with RA and the healthy controls was analyzed. The mRNA (B) and protein (C) levels of KLF11 in the synovial tissues from RA patients and controls (OA patients). ^** represents P < 0.01 when compared to the OA group. 1: OA, 2: RA. D The animal model of CIA was established and then the lentivirus carrying KLF11 or lentivirus harboring KLF11 shRNA (5 × 10⁸ particles per mouse) was injected into the ankle joint cavity of mice. After the animal experiments, the synovial tissues were harvested from the mice. The levels of KLF11 protein in the synovial tissues were quantified by western blotting. β-actin was utilized as the internal control. E At the conclusion of the experiment, the thickness of the hind paw was quantified using a caliper. F The severity of arthritis was evaluated at 5-day intervals following the first immunization. Each paw was evaluated on a scale of 0–4 and the maximum score for each mouse was 16, based on the assessment of all four paws. G The pathological alterations were observed by HE staining. H The extent of cartilage damage in ankle joint tissues was evaluated by safranin O-fast green staining. I Immunofluorescence staining of F4/80 and KLF11 in the synovial tissues. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the CIA + vector/CIA + shNC group

KLF11 overexpression attenuates arthritis severity and bone destruction in CIA mice

To investigate KLF11's role in RA, a CIA mouse model was developed to mimic this disease. KLF11 levels were reduced in the synovial tissues of CIA mice compared with the control mice. Injection of lentivirus carrying KLF11 gene significantly upregulated KLF11 levels in CIA mice, whereas lentivirus harboring KLF11 shRNA markedly reduced KLF11 expression (Fig. 1D). Furthermore, the hind paw of CIA mice exhibited a notable increase in thickness compared to control mice. The overexpression of KLF11 resulted in a reduction in hind paw thickness in CIA mice when compared to those that received vector injections, conversely, KLF11 knockdown further aggravated the swelling in CIA mice (Fig. 1E). The arthritis score in CIA mice was significantly elevated following the second immunization. KLF11 overexpression resulted in a reduction in the arthritis score, whereas KLF11 knockdown led to an increase (Fig. 1F). Histological examination revealed that CIA mice displayed pronounced synovial hyperplasia and articular surface destruction in ankle joint tissues. In contrast, the overexpression of KLF11 resulted in the alleviation of these pathological changes in CIA mice (Fig. 1G). The extent of cartilage damage in ankle joint tissues was evaluated. The control mice exhibited normal articular cartilage without evidence of injury. The CIA mice displayed evidence of bone and cartilage destruction, whereas this was attenuated by KLF11 overexpression (Fig. 1H). Meanwhile, KLF11 knockdown aggravated CIA-induced pathological changes (Fig. 1G and H). Immunofluorescence assay targeting KLF11 and F4/80 corroborated the downregulation of KLF11 and upregulation of the microglial marker F4/80 in CIA mice. It further demonstrated that KLF11 overexpression in synovial tissues reduced microglial recruitment (Fig. 1I). Conversely, KLF11 knockout yielded the opposite results with increased microglial infiltration. Notably, KLF11 and F4/80 exhibited colocalization, suggesting that KLF11 might directly regulate microglial activity, thereby participating in the pathological progression.

KLF11 overexpression inhibits the inflammatory response in CIA mice

Subsequently, the serum levels of pro-inflammatory cytokines were evaluated. The results demonstrated a notable elevation in the serum levels of IL-6, IL-1β, and TNF-α in CIA mice when compared to the control group. KLF11 overexpression resulted in reduced levels of these cytokines in the serum, while KLF11 knockdown led to an increase (Fig. 2A). To confirm the alterations in pro-inflammatory cytokines, the synovial tissues were harvested. The induction of CIA resulted in elevated mRNA levels of the cytokines in synovial tissues compared to the control mice. However, KLF11 overexpression led to a notable down-expression of these cytokines in CIA mice, whereas KLF11 knockdown exerted the opposite effect (Fig. 2B). The levels of all the three cytokines were significantly elevated in CIA mice, as demonstrated by ELISA assay. KLF11 overexpression decreased their levels in CIA mice, while increased with KLF11 knockdown (Fig. 2C), indicating KLF11 inhibited the inflammatory response in CIA mice.

Fig. 2.

KLF11 overexpression reduces the levels of pro-inflammatory cytokines in CIA mice. A At the conclusion of the experiment, the mice were euthanized to collect blood samples. The serum levels of IL-6, IL-1β, and TNF-α in mice were determined using ELISA kits. B The levels of IL-6, IL-1β, and TNF-α mRNA in the synovial tissues of mice were quantified by real-time PCR. β-actin was utilized as the internal control. C The levels of IL-6, IL-1β, and TNF-α protein in the synovial tissues of mice were quantified by western blotting. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the CIA + vector/CIA + shNC group

KLF11 overexpression inhibits M1 macrophage polarization and the ERK signaling pathway in CIA mice

We subsequently examined the potential association between the protective effect of KLF6 against CIA and macrophage polarization. The synovial tissues of CIA mice demonstrated elevated levels of CD86 and iNOS mRNA in comparison to the controls. KLF11 overexpression resulted in a reduction of both mRNA levels in CIA mice, which could be reversed by KLF11 knockdown (Fig. 3A). Additionally, the number of CD86⁺ F4/80⁺ and iNOS⁺ F4/80⁺ double-positive cells was elevated in CIA mice. The number of CD86⁺ F4/80⁺ and iNOS⁺ F4/80⁺ double-positive cells was reduced in CIA mice following KLF11 overexpression and was increased with KLF11 knockdown (Fig. 3B). The objective of our study was to gain further insight into the molecular mechanism by which KLF11 exerts its protective effects against CIA in vivo. The results demonstrated that the p-ERK/ERK ratio was higher in CIA mice than control mice, indicating the activation of this pathway. The overexpression of KLF11 resulted in a reduction of the p-ERK/ERK ratio in CIA mice compared to those treated with a vector control (Fig. 4A). Consistent with previous findings, ERK activation was significantly enhanced following KLF11 knockdown (Fig. 4B).

Fig. 3.

KLF11 overexpression inhibits macrophage polarization towards M1 phenotype in CIA mice. A-B The levels of M1 macrophage markers, including CD86 and iNOS, in the synovial tissues of mice with KLF11 overexpression or knockdown were quantified by real-time PCR. B The expression levels of F4/80, CD86 and iNOS in the synovial tissues were examined by immunofluorescence assay. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the CIA + vector/CIA + shNC group

Fig. 4.

KLF11 overexpression inhibits the ERK signaling pathway in CIA mice. Total protein was extracted from the synovial tissues using RIPA buffer and then subjected to western blotting. The expression levels of p-ERK and ERK were quantified by western blotting. The ratio of p-ERK to ERK was calculated. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the CIA + vector/CIA + shNC group

KLF11 overexpression suppresses M1 macrophage polarization and the ERK signaling pathway in vitro

To examine KLF11's impact on macrophage polarization in vitro, THP-1 cells were stimulated to differentiate into M1 phenotype. Subsequently, we evaluated the expression of KLF11. The mRNA and protein levels of KLF11 were significantly reduced in LPS/IFN-γ-stimulated cells. Transfection with a plasmid encoding KLF11 resulted in increased KLF11 levels in LPS/IFN-γ-stimulated cells (Fig. 5A, B). Furthermore, treatment with LPS/IFN-γ resulted in a marked elevation in mRNA and protein levels of both CD86 and iNOS. KLF11 overexpression resulted in a reduction in the expression of CD86 and iNOS in LPS/IFN-γ-treated cells. Immunofluorescence assays consistently demonstrated the upregulation of CD86 and iNOS after LPS/IFN-γ stimulation. KLF11 overexpression was observed to reduce the expression of both markers (Fig. 5C). LPS/IFN-γ exposure markedly enhanced cytokine production within the culture supernatant. However, the increases in these pro-inflammatory cytokines were effectively mitigated following KLF11 overexpression (Fig. 5D). To further substantiate the role of ERK signaling, we conducted in vitro measurements of total and phosphorylated ERK. The ratio of p-ERK/ERK was higher in LPS/IFN-γ-exposed cells. Overexpression of KLF11 resulted in a notable reduction in the p-ERK/ERK ratio in LPS/IFN-γ-exposed cells (Fig. 5E).

Fig. 5.

KLF11 overexpression suppresses M1 macrophage polarization and the ERK signaling pathway in vitro. A The levels of KLF11, CD86, and iNOS mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. B The levels of KLF11, CD86, and iNOS protein were quantified by western blotting. β-actin was utilized as the internal control. C The expression levels of CD86 and iNOS were evaluated by immunofluorescence assay. D The production of IL-6, IL-1β, and TNF-α within the culture supernatant was examined by ELISA kits. E The expression levels of p-ERK and ERK were quantified by western blotting. The ratio of p-ERK to ERK was calculated. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the IFN-γ + LPS + vector group

KLF11 negatively regulates YAP1 expression through the mechanism of transcriptional regulation

As illustrated in Fig. 6A, the binding motif of KLF11 was predicted. Utilizing the JASPAR database, we discovered that the YAP1 promoter region contained multiple potential binding sites for KLF11. To ascertain whether KLF11 binds to the YAP1 promoter, a ChIP assay was conducted. The findings indicated the binding of KLF11 to the YAP1 promoter region (Fig. 6B). To ascertain whether KLF11 regulates the transcriptional level of YAP1, we inserted different lengths of the YAP1 promoter sequences (− 2100 to + 50, − 1400 to + 50, and − 700 to + 50) into pGL3 vector and then conducted the dual-luciferase reporter assay. KLF11 overexpression reduced the luciferase activity of the recombinant plasmid containing the complete sequence of the YAP1 promoter, spanning from − 2100 to + 50. Nevertheless, KLF11 overexpression did not reduce the luciferase activity of recombinant plasmids containing promoter fragments of YAP1 (− 1400 to + 50 and − 700 to + 50) (Fig. 6C). Furthermore, the impact of KLF11 knockdown or overexpression on YAP1 expression was confirmed. KLF11 was downregulated in cells following transfection with sh-KLF11 (Fig. 6D, E). Notably, KLF11 knockdown was found to markedly elevate YAP1 mRNA (Fig. 6F) and protein levels (Fig. 6G), whereas KLF11 overexpression led to a reduction in YAP1 (Fig. 6H, I).

Fig. 6.

KLF11 negatively regulates YAP1 expression by binding to and repressing its promoter activity. A The binding motif of KLF11 in the promoter region of YAP1 was predicted using the JASPAR database. B A ChIP assay was conducted to ascertain the binding of KLF11 to the YAP1 promoter. C The different lengths of the YAP1 promoter sequences (− 2100 to + 50, − 1400 to + 50, and − 700 to + 50) were inserted into pGL3 vector and then conducted the dual-luciferase reporter assay. ^** represents P < 0.01 when compared to the vector group. D The cells were transfected with sh1-KLF11, sh2-KLF11, and sh-NC. The levels of KLF11 mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. E After transfection with shRNAs, the levels of KLF11 protein were quantified by western blotting. β-actin was utilized as the internal control. F After transfection with shRNAs, the levels of YAP1 mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. G After transfection with shRNAs, the levels of YAP1 protein were quantified by western blotting. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the sh-NC group. H The cells were transfected with a KLF11 overexpression plasmid or empty vector. The levels of YAP1 mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. I After transfection with the overexpression plasmid, the levels of YAP1 protein were quantified by western blotting. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the vector group

YAP1 overexpression partially reverses the KLF11's inhibitory effect on M1 macrophage polarization and the ERK signaling pathway

To explore YAP1's role in the modulation of M1 macrophage polarization by KLF11, THP-1 cells were induced into an M1 phenotypic profile, and the expression of YAP1 was then determined. YAP1 levels were elevated in LPS/IFN-γ-stimulated cells in comparison to the control cells. Notably, KLF11 overexpression was observed to significantly reduce the levels of YAP1 mRNA and protein in LPS/IFN-γ-exposed cells (Fig. 7A, B). Following transfection with the YAP1 overexpression plasmid, a significant upregulation was observed in YAP1 levels in parental THP-1 cells (Fig. 7C, D). YAP1 overexpression partially reversed the impact of KLF11 on M1 macrophage markers in LPS/IFN-γ-exposed cells, as evidenced by immunofluorescence (Fig. 7E) and western blotting (Fig. 7F). Furthermore, KLF11's inhibitory effect on pro-inflammatory cytokine secretion (Fig. 7G) and the ERK pathway (Fig. 7H) was partially attenuated by YAP1 overexpression.

Fig. 7.

YAP1 overexpression partially reverses the inhibitory effect of KLF11. A The levels of YAP1 mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. B The levels of YAP1 protein were quantified by western blotting. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the Control group. ^## represents P < 0.01 when compared to the IFN-γ + LPS + vector group. C The cells were transfected with a YAP1 overexpression plasmid or empty vector. The levels of YAP1 mRNA were quantified by real-time PCR. β-actin was utilized as the internal control. D After transfection with the overexpression plasmid, the levels of YAP1 protein were quantified by western blotting. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the vector group. E The expression levels of CD86 and iNOS were examined by immunofluorescence assay. F The levels of CD86 and iNOS protein were quantified by western blotting. β-actin was utilized as the internal control. G The expression levels of p-ERK and ERK were quantified by western blotting. The ratio of p-ERK to ERK was calculated. β-actin was utilized as the internal control. ^** represents P < 0.01 when compared to the IFN-γ + LPS + KLF11 OE + vector group

Discussion

RA is a multi-system inflammatory autoimmune disease that primarily affects joints and bones [7, 18]. It has been reported that other members of the KLF family paly a pathogenic role in RA [4, 6]. The knockout of KLF4 has been demonstrated to ameliorate CIA in mice by influencing the cellular behaviors of fibroblast-like synoviocytes [6]. The knockdown of KLF7 has been demonstrated to inhibit the inflammatory response and proliferation of fibroblast-like synoviocytes in RA [4]. Nevertheless, KLF11's function in RA remain to be elucidated. We initially downloaded data from the GEO datasets (GSE55235 and GSE10500), which revealed that KLF11 was aberrantly downregulated in the PBMCs and synovial tissues of patients with RA. Furthermore, the mRNA and protein levels of KLF11 was lower in RA patients than in control. Meanwhile, KLF11 expression was also found to be downregulated in mice with CIA, a widely utilized in vivo model of RA. Based on this evidence, we postulated that KLF11 may exhibit a protective effect against RA.

Macrophages represent the initial line of defense in the innate immune system, performing a critical function in host inflammation and tissue homeostasis [17]. An imbalance in M1 and M2 macrophages has been identified as a contributing factor in the pathophysiology of RA [34]. At present, no pharmaceutical agents targeting macrophages have been approved for RA treatment in clinical trials. The proportion of M1 macrophages (pro-inflammatory state) was higher in CIA mice than in control mice. M1 macrophages release multiple pro-inflammatory factors, which contribute to the pathogenesis of RA [8]. A previous study has demonstrated that KLF11 knockdown exacerbates traumatic brain injury in mice by promoting M1 microglia/macrophage polarization [40]. Additionally, the anti-inflammatory effect of KLF11 has been reported in other studies [9, 11]. However, it remains unclear whether KLF11 exerts its protective effect against RA via regulation of M1 macrophage polarization. KLF11 overexpression resulted in a reduction in the population of M1 macrophages in CIA mice, whereas KLF11 knockdown exerted the opposite effect. Furthermore, additional in vitro investigations to elucidate KLF11's role in M1 macrophage polarization were conducted. As anticipated, KLF11 overexpression impeded M1 macrophage polarization and diminished the levels of pro-inflammatory cytokines. Inhibition of M1 macrophage polarization contributes to the amelioration of RA [13, 25]. Targeting M1 macrophages may prove an efficacious therapeutic strategy for RA [21]. It has been demonstrated that koumine can alleviate RA in mice by restoring the M1/M2 macrophage balance [25]. Additionally, punicalagin has been demonstrated to reduce the proportion of M1 macrophage, thereby ameliorating RA in mice via the NF-κB pathway [13]. Therefore, it can be postulated that the inhibition of M1 macrophage polarization may be one of the mechanisms involved in the protection of KLF11 against RA. The ERK pathway is associated with the regulation of M1 macrophage polarization [5, 39]. Our findings indicate that KLF11 overexpression resulted in the inhibition of the ERK pathway in CIA mice and in LPS/IFN-γ-stimulated cells (M1 macrophages). These results suggest that KLF11 overexpression may protect against RA by inhibiting M1 macrophage polarization via the ERK signaling pathway.

Previous studies have revealed that KLF11 serves as a transcriptional repressor [22, 23, 38]. Mechanistically, KLF11 could prevent arterial and venous thrombosis by transcriptionally suppressing tissue factor [22, 23]. Moreover, KLF11 could enhance ferroptosis and the chemosensitivity of lung adenocarcinoma by binding to the GPX4 promoter and inhibiting its transcriptional activity [38]. A search of the JASPAR database revealed the presence of multiple potential binding sites for the transcription factor KLF11 within the YAP1 promoter region. However, whether YAP1 plays a role in the protection of KLF11 against CIA and macrophage polarization remains uncertain. The results demonstrated that KLF11 bound to the YAP1 promoter, negatively regulating its expression at the transcriptional level. This finding suggests that KLF11 functions as a transcriptional suppressor of YAP1. YAP1 is a transcriptional co-activator protein that is associated with a number of different biological processes [33]. A recent study has demonstrated that YAP1 is overexpressed in RA fibroblast-like synoviocytes, and the knockdown of YAP1 can inhibit cell migration and invasion by inducing autophagy [41]. YAP1 has been demonstrated to augment the pathogenic behaviors of RA fibroblast-like synoviocytes, thereby exacerbating arthritis severity in mice [2]. Furthermore, YAP1 plays a role in promoting M1macrophage polarization [27, 35, 42]. Our study demonstrated that YAP1 overexpression partially antagonized KLF11's inhibitory effect on M1 macrophage polarization and the ERK signaling pathway, suggesting that YAP1 may be a specific target of KLF11 in the protection against RA.

In conclusion, our findings demonstrated that KLF11 was expressed at a lower level in patients with RA and in mice with CIA. KLF11 overexpression inhibited M1 macrophage polarization, thereby attenuating the severity of CIA in mice. This was achieved by means of a negative regulation of YAP1 expression and the inactivation of the ERK pathway. KLF11 may represent a promising therapeutic target for RA.

Authors’ contributions

SD conceived and designed research; XL, FF, and HL performed experiments; XL, FF, and HL analyzed data; XL, HD, CW, and SD interpreted results of experiments; XL, FF, HD, CW, and HL prepared figures; XL and FF drafted manuscript; SD edited and revised manuscript; XL, FF, HD, CW, HL, and SD approved final version of manuscript.

Funding

This study was supported by grants from the Scientific Research Project of the Educational Department of Liaoning Province (LJKMZ20221198).

Scientific Research Project of the Educational Department of Liaoning Province,LJKMZ20221198

Data availability

Data are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

The animal procedures were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH) and approved by the Laboratory Animal Ethics Committee of China Medical University.

The clinical sample collection was approved by the Institutional Ethics Committee of China Medical University and informed consent was provided from all participants.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.