TDO-mediated tissue-specific regulation of kynurenine pathway in the brain and gill of Litopenaeus vannamei

Abstract

Background

The kynurenine pathway (KP), central to tryptophan metabolism, regulates neuroimmune interactions in vertebrates through the dual actions of indoleamine 2,3-dioxygenase (IDO) and tryptophan 2,3-dioxygenase (TDO). However, crustaceans lack IDO and rely solely on TDO, yet the tissue-specific roles of TDO in this lineage remain unknown. Using Litopenaeus vannamei, a key aquaculture species, we investigated how TDO-mediated KP adapts to functional constraints in neural and respiratory tissues.

Results

Genomic analyses confirmed the absence of IDO in crustaceans, while LvTDO retained catalytic domains homologous to vertebrates but acquired lineage-specific structural features. Tissue-specific profiling revealed dominant LvTDO expression in brain and gill. RNAi knockdown triggered distinct responses: the brain upregulated oxidative phosphorylation and cytoskeletal pathways but suppressed neural signaling, whereas the gill activated apoptosis and immune pathways while downregulating glycolysis. KEGG analysis further highlighted hypoxia adaptation in gill (HIF-1 pathway) and stress signaling in brain (MAPK/Hippo).

Conclusions

Our findings suggest that L. vannamei may compensate for IDO absence via tissue-specific TDO regulation, with brain-gill axis specialization reflecting adaptive metabolic plasticity. While structural divergences in LvTDO hint at evolutionary innovations, functional equivalence to vertebrate IDO/TDO systems requires further validation. This study highlights the evolutionary flexibility of KP in invertebrates, though metabolite dynamics and long-term physiological impacts remain to be explored.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-025-11948-5.

Background

Tryptophan (Trp) is a crucial essential amino acid in animals, and its metabolic pathway is integral to neuromodulation, immune homeostasis, and energy metabolism [1]. Trp metabolism predominantly encompasses three pathways: kynurenine (KP), 5-hydroxytryptamine (5-HT), and indole pathways [2]. The KP has been identified as the primary metabolic route for Trp, with approximately 95% of Trp is metabolized into various other compounds through this pathway [3]. In addition, it has been determined that 2% of Trp is catalyzed by Trp hydroxylase (TPH) through the 5-HT pathway, culminating in the production of 5-hydroxytryptamine [4]. The indole pathway, facilitated by gut microbiota, involves the enzymatic conversion of Kyn to various derivatives, including indole propionic acid and indoleacetic acid [5]. The equilibrium among these three pathways is crucial for sustaining the health of organisms, and any disturbance in these pathways in humans has been significantly linked to the onset of inflammation, tumors, and metabolic disorders [6].

The KP, a key component of Trp metabolism, functions as a significant nexus between the nervous and immune systems by modulating neurotransmitters and immune signaling molecules in various animal species [7, 8]. In higher organisms, such as mammals and fish, the pathway is co-initiated by two rate-limiting enzymes: indoleamine-2,3-dioxygenase (IDO) and tryptophan-2,3-dioxygenase (TDO) [9]. IDO is primarily expressed in immune cells and plays a crucial role in the regulation of immune tolerance [10]. TDO is mainly expressed in the liver and has a role in energy metabolism and stress response [11]. The functional differentiation of the two enzymes contributes to the multifaceted interplay of neural-immune interactions within the KP. On the one hand, the downstream metabolite kynurenic acid (KYNA) confers neuroprotection against excitotoxic injury by acting as an antagonist to the N-methyl-D-aspartate receptor (NMDAR) [12]. Conversely, the accumulation of neurotoxic substances, such as quinolinic acid (QUIN), has been demonstrated to induce neuroinflammation and result in cognitive dysfunction [13].

The function of the KP is extensively characterized in vertebrates, but its functional resolution in arthropods remains poorly elucidated. In insects, the KP has been shown to be intact and orchestrates diverse physiological processes. For instance, it modulates phototropism in Henosepilachna viginitoctopunctata [14]. Experimental evidence demonstrates its critical involvement in governing insect growth, development, and reproductive cycles [15–17]. Despite seminal discoveries in the physiological modulation mediated by the KP in insects, its mechanistic understanding in crustaceans lacks comprehensive mechanistic insights. Crustaceans, constituting the second largest group within the Arthropoda, possess a distinctive neuroendocrine system and immune defense mechanisms. The KP may be significantly involved in these processes.

Although the L. vannamei is an economically significant species in global crustacean aquaculture [18], its farming practices often face high mortality rates, primarily attributed to stress-induced neuromotor dysfunction and branchial lesions [18]. Comparative genomic studies have revealed decapods retain a complete KP but lack IDO. The L. vannamei TDO (LvTDO) shows significant structural similarity to vertebrate TDO proteins. RNAi-mediated knockdown of LvTDO triggers tissue-specific adaptive reprogramming. In the brain, oxidative phosphorylation and glutathione metabolic pathways were upregulated, whereas tryptophan metabolism was blocked alongside inhibition of neural signaling pathways such as glutamate receptor activity. On the other hand, gill exhibited upregulation of apoptotic pathways and immune-related pathways such as complement activation but showed suppressed activity in glycolysis and lipid biosynthesis. The results suggest that the crustacean KP, which relies exclusively on TDO-mediated catalysis in contrast to the vertebrate dual-enzyme (IDO/TDO) system, may achieve neuroimmune coordination through tissue-specific adaptations. Notably, transcriptomic divergence between brain and gill—such as metabolic suppression in neural tissues versus hypoxia adaptation in respiratory tissues—highlights potential compensatory mechanisms for IDO absence. While structural divergences in LvTDO indicate lineage-specific evolution, their functional significance in rewiring conserved tryptophan pathways requires further validation.

Materials and methods

Ethical statement

All efforts were made to minimize animal suffering and to reduce the number of animals used. L. vannamei are not endangered or protected animals in China. No specific permits are required for studies that do not involve endangered or protected invertebrate species. All experimental procedures comply with the current applicable laws in China.

Cross-genomic analysis of genes in the KP

For cross-genomic analysis of kynurenine pathway genes, 21 phylogenetically species were selected (Table 1). The gene functions were annotated based on the best matched hits to SwissProt using BLAST 2.9.0 + (-p blastp -e 1e-5). The gene motifs and domains were identified from the InterPro member databases using InterProScanm (v5.27–66.0) with parameters (-appl ProDom, PRINTS, Pfam, SMART, PANTHER, ProSiteProfiles, and ProSitePatterns). Related genes were identified by searching gene and domain descriptions with keywords (such as kynurenine) and manually checked considering phylogeny.

Table 1.

The genome databases used in this study

Species	Accession Numbers	Database
Homo sapiens	GCA_000001405.28	NCBI GeneBank
Danio rerio	GCA_000002035.4	NCBI GeneBank
Mus musculus	GCA_000001635.9	NCBI GeneBank
Scylla paramamosain	GCF_035594125.1	NCBI RefSeq
Chionoecetes opilio	GCA_016584305.1	NCBI GeneBank
Eriocheir sinensis	GCF_024679095.1	NCBI RefSeq
Petrolisthes manimaculis	GCA_034508575.1	NCBI GeneBank
Procambarus clarkii	GCF_020424385.1	NCBI RefSeq
Homarus americanus	GCF_018991925.1	NCBI RefSeq
Macrobrachium nipponense	GCF_015104395.2	NCBI RefSeq
Penaeus japonicus	GCF_017312705.1	NCBI RefSeq
Penaeus vannamei	GCF_003789085.1	NCBI RefSeq
Penaeus monodon	GCA_015228065.1	NCBI GeneBank
Penaeus chinensis	GCF_019202785.1	NCBI RefSeq
Tachypleus tridentatus	GCA_004210375.1	NCBI GeneBank
Stegodyphus mimosarum	GCA_044660205.1	NCBI GeneBank
Ixodes scapularis	GCA_016920785.2	NCBI GeneBank
Daphnia magna	GCA_020631705.2	NCBI GeneBank
Daphnia pulex	GCA_021134715.1	NCBI GeneBank
Bombyx mori	GCA_030269925.2	NCBI GeneBank
Drosophila melanogaster	GCA_000001215.4	NCBI GeneBank

Phylogenetic tree and sequence analysis

The evolutionary tree of 21 species was constructed through a Lifemap (Lifemap). Alignment of TDO among various species was performed with the ClustalX program and demonstrated using the Genedoc program. The sequences were obtained from GenBank. The phylogenetic tree was constructed based on a.a. (p distance) with the neighbor-joining method (pairwise deletion) with 1000 bootstrap replicates using MEGA X. In this case, different TDO genes were constructed into a phylogenetic tree. The tree was visualized via iTOL (iTOL).

Structural analysis of proteins

The structural domains for TDO were predicted by using SMART (SMART) and annotated by IBS (IBS 2.0). The three-dimensional (3D) model of LvTDO was deduced from AlphaFold 3 (AlphaFold Server). The 3D chemical structures of Trp were downloaded from PubChem (PubChem). The physicochemical properties of the LvTDO were analyzed using the ExPASy-ProtParam tool (Expasy—ProtParam). Molecular docking was conducted utilizing CD-dock (CB-Dock2), while the visualization of binding sites was accomplished through LigPlot.

Animals and tissue samples collection

Sexually immature and healthy individuals of L. vannamei, with an average body weight of 10.0 ± 0.8 g and an average body length of 10.0 ± 0.7 cm, were sourced from the Jinyang Shrimp Farming Center (Guangdong, China). Specimens were maintained in artificial seawater (30 parts per thousand, ppt) at 28 °C with dissolved oxygen sustained at 6.5 ± 0.5 mg/L through continuous aeration, under a 12-h light-12-h dark photoperiod. In total, 13 tissues were harvested, including the brain (Br), eyestalk (Es), gills (Gi), hemocytes (He), hepatopancreas (Hp), heart (Ht), intestines (In), muscle (Ms), ovary (Ov), stomach (St), thoracic ganglion (TN), testis (Ts), and ventral ganglion (VN). In this case, ovary and testis samples were harvested from sexually mature shrimp, and other samples were collected from sexually immature shrimp. Samples were immediately frozen in liquid nitrogen and stored at −80 °C for further mRNA experiments. All efforts were made to minimize animal suffering.

RNA sequencing and gene expression analyses

Transcript levels of LvTDO in different tissues (SRX24542847) were analyzed through RNA sequencing. The transcriptomic data for ontogenetic development stages (PRJNA253518) [19] and molting cycle (PRJNA288849) [20] were obtained from GenBank. Total RNA was isolated using column-based kits (NanoDrop/Qubit QC), and libraries were constructed with the NEBNext® Ultra™ RNA Library Prep Kit (250–300 bp insert selection). Sequencing was performed on an Illumina Novaseq 6000 platform (paired-end 150 bp). Paired-end clean reads were aligned to the L. vannamei reference genome [21] by using HISAT2 (v2.1.0). Transcripts were assembled, and read counts for each gene were calculated using StringTie (v1.3.5). Counts per million mapped reads (CPM) were calculated, and cross-sample normalization was performed using DESeq2 and demonstrated as a heatmap by using TBtools.

Molecular cloning and quantitative real-time PCR (qRT-PCR)

Total RNA was isolated using TRIzol™ reagent (Invitrogen, USA), subjected to DNase I (Invitrogen, USA) treatment to eliminate genomic DNA, and reverse transcribed to first-strand cDNA using the PrimeScript™ II Kit (Takara, Japan). The full-length cDNA sequence of LvTDO was acquired through 3’- and 5’-rapid amplification of cDNA ends (RACE) employing the 3’-Full RACE Core Set Ver. 2.0 and 5’-Full RACE Kit (Takara). The LvTDO open reading frame (ORF) was identified via PCR amplification utilizing gene-specific primers. Amplifications were conducted in 20 μL reaction volumes containing 8 μL sterile distilled H₂O, 0.5 μL of each primer (5 μM), 10 μL 2 × Plus Taq HiFi PCR Mix (MIKX), and 1.0 μL template DNA. Thermal cycling parameters included: initial denaturation at 95 °C for 3 min; 35 cycles of 94 °C for 25 s, 55 °C for 25 s, and 72 °C for 8 s, and a final extension at 72 °C for 5 min. The resultant PCR amplicons were cloned into the pMD-19T vector, transformed into chemically competent E. coli DH5α cells, and subjected to sequencing to verify insert sequence fidelity. For quantitative real-time PCR (qRT-PCR) analysis, SYBR Premix Ex Taq II (Takara, Japan) was employed. Thermal cycling parameters included: 5 min at 95 °C, followed by 45 cycles of 5 s at 95 °C, 30 s at 60 °C. In this case, the transcript expression of LvTDO was routinely normalized using elongation factor 1-α (EF1α, GU136229.1). The relative expression levels were calculated using the comparative Ct method with the 2^−∆∆Ct formula. The data expressed as the mean ± standard error (SE) was analyzed by using one-way ANOVA, followed by Fisher’s least significant difference (LSD) test. All primers used were designed by Primer Premier 6 (Table 2).

Table 2.

Primers used in this study

Primer name	Primer sequences (5’−3’)
ORF
TDO-F	ATGAGCTGTCCATACGCCAGGG
TDO-R	CTACATCGAAGCTTCACAGG
5'-RACE
TDO-OR	GTTCTCTTGGTTGTATCTTAC
TDO-IR	CATCTTGTGTTCGTCGAC
TDO-IR	ATCTCGTAGATGATTTGTTTG
3'-RACE
TDO-OF	CCAGCTCCTCATGGATGTTG
TDO-IF	CTCCACCCTTAGTGATCGTTAC
qRT-PCR
qTDO-F	GATTGCTCGAGAACAAGGTTG
qTDO-R	GTTCCAGAAGTTGAAGCCC
dsRNA
dsTDO-F	ATCAGTTCAGATTGCTCGAGAAC
dsTDO-R	CTGGTGAGGCTGGTTGAAGC
dsEGFP-F	GAACTTTTCACTGGAGTTGTCC
dsEGFP-R	CATTGTGTGAGTTATAGTTG

RNA interference

The dsLvTDO and dsEGFP was synthesized using a T7 RiboMAX Express RNAi System (Promega). In brief, a partial LvTDO fragment (Table S1) was amplified by PCR with the T7 promotor, and then it was used as the template to produce dsRNA in vitro T7 transcription kit. The dsEGFP was also synthesized as the negative control with the primers listed in Table 2. L. vannamei (approximately 12 g each) were randomly divided into two groups. In the experimental group, shrimp were injected with dsTDO (2 µg/g body weight) in PBS, and controls included injections of dsEGFP in PBS. Following 24 h of LvTDO silencing, the gill and brain tissues (n = 3) were collected from the L. vannamei for RNA extraction, library preparation, and sequencing.

Transcriptomic analysis

Differentially expressed genes (DEGs) were identified using DESeq2 (v1.30.1) with thresholds of FDR-adjusted p < 0.05 and |log₂ (fold change) |> 1, followed by visualization of results via volcano plots generated with ggplot2 (v3.3.5), where significantly upregulated (red) and downregulated (blue) genes were highlighted. Functional enrichment analysis was performed using clusterProfiler (v4.0.5): Gene Ontology (GO) terms were annotated against the Gene Ontology 2022 database, with significant terms (hypergeometric test, p < 0.01) categorized into biological processes, molecular functions, and cellular components, while KEGG pathway enrichment utilized the KEGG 2023 database, retaining pathways with FDR < 0.05, and key pathways were mapped using Pathview for visualization.

Results

Genomic analysis of the KP in diverse species

Genomic analysis of the kynurenine pathway (KP) across taxonomic groups revealed distinct evolutionary conservation patterns of enzymatic components. As illustrated in Fig. 1A, IDO was consistently absent in decapod crustaceans and other non-decapod arthropods, whereas the remaining core KP enzymes (TDO, KMO, KYNU, HAAO, ACMSD, and KYAT) exhibited varying degrees of conservation. In contrast, vertebrates demonstrated near-complete preservation of all KP-related genes. Functional characterization (Fig. 1B) using Litopenaeus vannamei as a representative model confirmed that decapods retain full metabolic competence for tryptophan conversion into both QUIN and KYNA (Table S2) despite IDO deficiency, suggesting the existence of compensatory evolutionary adaptations. These results highlight the remarkable evolutionary plasticity underlying KP functional maintenance, wherein decapods achieve metabolic completeness through alternative genetic architectures while other taxa retain ancestral gene complements.

Fig. 1.

A Comparative genomic analysis of KP enzyme genes (IDO, TDO, AFMID, KMO, KYNU, HAAO, ACMSD, KYAT) across 21 species. The heatmap depicts the presence (colored) or absence (white) of core KP enzymes across decapod crustaceans, non-decapod arthropods, and vertebrates. Note the universal absence of IDO in crustaceans (red box) versus complete KP gene retention in vertebrates. B Putative KP metabolic flow in L. vannamei based on genomic and transcriptomic data. Key: TDO (Tryptophan 2,3-dioxygenase), AFMID (Kynurenine formamidase), KYAT (Kynurenine–oxoglutarate transaminase), KMO (Kynurenine 3-monooxygenase), KYNU (Kynureninase), HAAO (3-hydroxyanthranilate 3,4-dioxygenase)

Molecular characterization of LvTDO in the KP

Figure 2A depicts the cDNA and amino acid sequence of the LvTDO, revealing a full-length coding sequence of 442 amino acids and sharing high sequence similarity to the known TDOs in other species. Figure 2B confirms the structural domain analysis of LvTDO, identifying a conserved Trp_dioxygenase domain extending from amino acid 12 to 360. The structural features of LvTDO, as illustrated in Fig. 2, confirm its classification as a functional TDO. The molecular weight of the LvTDO protein is 51.6 kDa, with a theoretical isoelectric point (pI) of 5.55 and an instability index of 59.11, classifying it as a instable, hydrophilic protein (grand average of hydropathy (GRAVY): − 0.560) according to ExPASy-ProtParam analysis.

Fig. 2.

A Full-length cDNA and deduced amino acid sequence of LvTDO. The blue Amino acid sequence represents the Trp_dioxygenase domain. B Domain architecture of LvTDO

Structural conservation and phylogenetic analysis of LvTDO

Based on multiple sequence alignment analysis (Fig. 3A), LvTDO exhibits high homology within the catalytic core domain compared to TDO from D. rerio (DrTDO), H. sapiens (HsTDO), and M. musculus (MsTDO), suggesting that Trp_dioxygenase exhibits deep evolutionary conservation across species. However, structural domain analysis reveals significant sequence divergence in the non-catalytic N- and C-terminal regions of LvTDO, characterized by low-complexity insertions specific to crustaceans. Molecular phylogenetic(Table. S3) analysis further indicates that LvTDO forms a monophyletic clade with decapod crustaceans, while vertebrate TDO clusters independently as a distinct evolutionary lineage (Fig. 3B).

Fig. 3.

A Multiple sequence alignment of TDO catalytic domains across species (D. rerio, H. sapiens, M. musculus, L. vannamei). Orange shadows represent conserved amino acids, green represents similar amino acids. B Phylogenetic tree of TDO orthologs

Structural differences in the binding sites of LvTDO and HsTDO

Molecular docking analysis revealed significant structural differences in the tryptophan binding mechanism between LvTDO and HsTDO. Although both enzymes utilize conserved glycine residues (Gly³²⁹/Gly³³¹ in LvTDO; Gly³⁴⁷ in HsTDO) to maintain the conformational flexibility of the protein skeleton, but there is a clear functional divergence in the hydrogen bond network: Gly³³¹ in LvTDO formed A weak hydrogen bond interaction with the N–H group of the tryptophan indole ring (bond length 3.24 Å), while Gly³⁴⁷ in HsTDO did not directly participate in hydrogen bond formation. Thr³⁴² and Ser¹⁵¹ form A more compact hydrogen bond network (2.9–3.2 Å). From the structural features, LvTDO reflects its evolutionary adaptation to the low tryptophan concentration in the aquatic environment through the π-π packing interaction of Phe¹²⁵ and Phe¹³⁸ and the narrow substrate binding channel entrance formed by Val³¹⁹ and Met³²² (Fig. 4A). In contrast, HsTDO exhibited a more open substrate binding conformation (Thr³⁴²/Met³³⁵) and utilized the hydrophobic interaction of Leu³³⁶, features consistent with its physiological function in maintaining systemic tryptophan homeostasis (Fig. 4B). This marked divergence in the function of glycine residues sheds light on the evolutionary differences in the regulatory mechanisms of tryptophan metabolism between aquatic crustaceans and higher mammals from a structural biology perspective.

Fig. 4.

Structural divergence in Trp-binding sites. Green amino acids represent the presence of hydrogen bond interactions. A LvTDO-Trp. B HsTDO-Trp

LvTDO expression profiling

Transcriptomic analysis revealed that the LvTDO exhibits significantly higher expression levels in brain and gill compared to other tissues, with specific upregulation (Fig. 5A) observed during the zoea of ontogenetic stage and the P1 stage of molting (Fig. S1). Validation via qRT-PCR demonstrated that LvTDO expression was highest in brain tissue, followed by gill tissue, while expression levels in the hepatopancreas, muscle, and ovary were the lowest (Fig. 5B). This tissue-specific expression pattern corroborated the transcriptomic findings.

Fig. 5.

A Expression profiles of LvTDO in various tissues, ontogenetic development stage and molting stage by transcriptomic analysis. The selected tissues include the brain (Br), thoracic nerve (TN), ventral nerve cord (VN), eyestalk (Es), heart (Ht), hepatopancreas (Hp), stomach (St), intestines (In), muscle (Ms), gill (Gi), hemocytes (He), ovary (Ov) and testis (Ts). The ontogenetic development stage includes embryo, nauplius, zoea, mysis, and postlarvae. The molting stage includes postmolt (P1 and P2 stages), intermolt (C stage) and premolt (D0, D1, D2, D3, and D4 stages). B The relative mRNA expression of LvTDO among different tissues by qPCR (mean ± SE; ANOVA, p < 0.05)

Divergent transcriptomic landscapes in brain and gill after LvTDO knockdown

To investigate the transcriptional responses to LvTDO knockdown, RNA-Seq was performed on the brain and gill from L. vannamei at 24 h post-injection of dsLvTDO. Comparative transcriptomic profiling under stringent thresholds of |log₂FC|≥ 2 and p < 0.05 revealed that dsLvTDO injection induced marked differential expression in the brain and gill of L. vannamei relative to dsEGFP. In the brain, 1139 genes were significantly upregulated alongside 1248 downregulated genes (Fig. 6A), whereas the gill exhibited 423 upregulated and 1093 downregulated genes (Fig. 6B).

Fig. 6.

Transcriptomic responses to LvTDO knockdown (|log₂FC|> 2, p < 0.05). A DEGs in brain. B DEGs in gill

GO analysis of brain and gill following LvTDO knockdown

The knockdown of LvTDO significantly affected the metabolic processes, redox balance, and cellular structural functions in the brain of L. vannamei. The significant downregulation of ribosome-associated functional genes (e.g., structural constituent of ribosome, GO: 0003735) and translation processes (GO: 0006412) indicated a severe suppression of protein synthesis capacity, potentially due to metabolic reprogramming that limited cellular growth. Additionally, the downregulation of mitochondrial function-related entries (e.g., mitochondrial inner membrane, GO: 0005743; NADH dehydrogenase activity, GO: 0008137) suggested that TDO knockdown blocked the kynurenine metabolic pathway, reduced NAD + production, and consequently inhibited mitochondrial oxidative phosphorylation, leading to insufficient ATP synthesis. The concurrent downregulation of oxidation–reduction processes (GO: 0055114) and oxidoreductase activity (GO: 0016491) further exacerbated oxidative stress risks, potentially resulting in the accumulation of reactive oxygen species (ROS) and damage to neuronal cells. Notably, the brain exhibited compensatory mechanisms by upregulating cytoskeleton-related processes (GO: 0030036) and protein tyrosine phosphatase activity (GO: 0004713), dynamically adjusting cellular morphology and signaling pathways, which may serve to counteract metabolic stress or maintain neuroplasticity (Fig. 7A).

Fig. 7.

GO enrichment analysis. A Brain. B Gill

In gill, significant enrichment of metabolic processes (GO: 0008152) and upregulation of key glycolytic enzyme activities (e.g., triosephosphate isomerase activity, GO: 0004807) indicate adaptive metabolic reprogramming, potentially compensating for ATP deficiency caused by impaired oxidative phosphorylation through enhanced anaerobic metabolic pathways. Redox balance, as a central regulatory node, is highlighted by the significant enrichment in oxidation–reduction processes (GO: 0055114) and widespread involvement of oxidoreductase activity (GO: 0016491), suggesting dynamic regulation of ROS metabolism to maintain redox homeostasis. However, the downregulation of iron ion binding (GO: 0005506) and heme-related functions may reduce mitochondrial electron transport chain efficiency, exacerbating oxidative damage risks. In the stress response, inhibition of DNA repair (GO: 0006281) and protein folding functions (GO:0000413) reflects potential declines in genomic stability and cellular repair capacity under chronic environmental stress. Bidirectional regulation of acyltransferase activities (downregulation of GO: 0016747 and upregulation of GO: 0008080) implies coordinated remodeling of lipid metabolism and detoxification pathways. Notably, synchronous downregulation of iron metabolism-related genes (GO: 0005506) may amplify cellular stress effects through ferroptosis pathways (Fig. 7B).

KEGG analysis of brain and gill in following LvTDO knockdown

KEGG analysis pronounced repression of energy metabolism and protein biosynthesis in the brain. Specifically, the repression of the tricarboxylic acid (TCA) cycle and oxidative phosphorylation pathways implicated in diminished mitochondrial ATP production, which may compromise neuronal energy homeostasis. Moreover, the inhibition of metabolic pathways for specific amino acids, such as valine, leucine, and Trp, along with the repression of genes associated with ribosomal biogenesis and mitochondrial synthesis (e.g., ribosome pathway), provided further evidence of obstructed protein translation and catabolism (Fig. 8A).

Fig. 8.

KEGG pathway analysis. A Downregulated in brain. B Upregulated in brain. C Downregulated in gill. D Upregulated in gill

In contrast, the activated pathways in the brain were predominantly associated with cellular signaling and structural reconfiguration. The activation of axon guidance and focal adhesion pathways may engage Rho GTPase-mediated cytoskeletal rearrangements to preserve synaptic plasticity. The upregulation of the MAPK and Hippo signaling cascades indicated a coordinated cellular response to metabolic stress, modulating proliferation and apoptosis through the ERK and YAP/TAZ signaling nodes (Fig. 8B).

In gill, the attenuated pathways were distinguished by compromised DNA repair mechanisms and metabolic dysfunction. The suppression of the Fanconi anemia pathway and base excision repair may undermine the capacity for DNA damage repair, thereby augmenting genomic instability. Additionally, the concurrent downregulation of oxidative phosphorylation and glycolysis suggested a pervasive restriction in energy metabolism, which could detrimentally impact osmoregulatory and ion transport functions (Fig. 8C).

Conversely, the activated pathways in the gill were linked to metabolic adaptation and enhanced stress resilience. The significant activation of the Calvin cycle and glycolysis may serve as a compensatory mechanism for energy deficits through enhanced carbon fixation and gluconeogenesis, a metabolic strategy commonly observed in crustaceans acclimating to hypoxic conditions. The upregulation of the HIF-1 signaling pathway provided further evidence of hypoxia acclimation mechanisms (Fig. 8D).

Discussion

The KP possesses a high level of conservation between vertebrates and invertebrates, and is especially relevant to neuroscience [22, 23]. Current research has demonstrated that TDO and IDO, as the core rate-limiting enzymes in the KP, have been validated across taxonomic groups including vertebrates, mollusks, and insects [22–24]. Phylogenomic comparative analyses revealed distinct evolutionary trajectories in the KP between crustaceans and vertebrates. Specifically, decapods exclusively retain TDO orthologs, while exhibiting a complete absence of IDO homologs within the crustacean clade, in contrast to the conserved dual-enzyme IDO/TDO system observed in vertebrates (Fig. 1A).

While the catalytic core of LvTDO remains highly conserved with vertebrate TDO orthologs (Fig. 3A), structural divergences may modulate substrate affinity and regulatory specificity, such as low-complexity insertions at N/C termini (Fig. 2B) and altered hydrogen-bonding networks in the Trp-binding site (Fig. 4). Phylogenetic analysis further supports functional divergence, with crustacean TDOs forming a monophyletic clade separate from vertebrates (Fig. 3B), indicative of adaptive evolution under distinct selective pressures. This structural and evolutionary differentiation likely enables the crustacean-specific KP to achieve multifunctional regulation through TDO expression, despite lacking IDO-mediated immune modulation mechanisms typical of vertebrates [25, 26].

The KP in L. vannamei exhibits exclusive dependence on TDO-mediated catalysis (Fig. 1B). This lineage-specific adaptation likely reflects evolutionary optimization under distinctive immunological and metabolic constraints. In contrast, vertebrates have evolutionarily conserved the functional dichotomy of the IDO/TDO system, where IDO serves as a central modulator of immune tolerance, while TDO primarily orchestrates hepatic Trp catabolism for systemic energy homeostasis [27, 28]. The tissue-stage specificity of LvTDO expression underscores adaptive metabolic plasticity. Brain-enriched expression likely compensates for IDO absence by modulating glutamate signaling and redox homeostasis (Fig. 7A), preventing QUIN-mediated neurotoxicity. Similarly, LvTDO induction during zoea supports developmental energy demands via Trp catabolism, while its P1-stage upregulation in gill activates HIF-1-mediated hypoxia tolerance (Fig. 8D), a safeguard against oxygen deprivation in newly molted shrimp. This spatiotemporal regulation positions TDO as a multifunctional orchestrator of neuroimmune-metabolic adaptations in crustaceans (Fig. 5).

Based on the GO enrichment analysis of brain and gill tissues following LvTDO knockdown, several key tissue-specific metabolic and functional adaptations emerge (Fig. 7A, B). In the brain, the most striking finding was the coordinated downregulation of ribosomal functions (GO:0003735, GO:0006412) and mitochondrial processes (GO:0005743, GO:0008137), suggesting a systemic suppression of protein synthesis and oxidative phosphorylation capacity. This metabolic reprogramming likely reflects neuronal adaptation to reduced NAD⁺ availability from KP blockade, as evidenced by the parallel downregulation of oxidation–reduction processes (GO:0055114) and oxidoreductase activity (GO:0016491). Interestingly, the brain compensated through upregulation of cytoskeletal organization (GO:0030036) and protein tyrosine phosphatase activity (GO:0004713), potentially maintaining neuroplasticity under metabolic stress.

In contrast, gill tissue exhibited distinct stress responses centered on metabolic flexibility. While sharing the downregulation of oxidoreductase activity (GO:0016491), the gill uniquely upregulated glycolytic enzymes (GO:0004807) and showed impaired iron metabolism (GO:0005506), indicating a shift toward anaerobic metabolism and potential ferroptosis susceptibility. The tissue-specific divergence was most pronounced in DNA repair mechanisms (GO:0006281), which were suppressed in gill but unaffected in brain, suggesting differential genomic vulnerability to oxidative stress. These GO patterns collectively reveal that L. vannamei’s TDO-centric KP has evolved tissue-specific regulatory architectures, with neural tissue prioritizing structural plasticity and branchial tissue emphasizing metabolic flexibility—as compensatory mechanisms for the absence of vertebrate-like IDO/TDO duality. The findings align with crustaceans’ need to balance neuroprotection and respiratory demands under environmental fluctuations.

In human, KP achieves neuroimmune integration through the functional dichotomy of its dual-enzyme system. This regulatory architecture enables bidirectional signaling between neural circuits and immune networks [29]. Similarly, after LvTDO knockout, the transcriptomic responses in the brain and gill showed significant differences. The inhibition of cerebral energy metabolism (Fig. 8A) likely stems from NAD⁺ synthesis deficiency caused by KP blockade, aligning with mitochondrial dysfunction observed in mammals with kynurenine metabolic defects [3]. Conversely, the suppression of glycolysis and lipid biosynthesis in the gill (Fig. 8C) may compel a metabolic shift toward alternative energy-generating pathways (Fig. 8D), a flexibility characteristic of crustacean adaptive strategies under environmental stress [20]. Furthermore, brain-specific activation of MAPK and Hippo signaling pathways (Fig. 8B) suggests coordinated regulation of cellular survival and apoptosis, while gill-specific upregulation of HIF-1 signaling (Fig. 8D) implies hypoxia preconditioning. Such tissue-specific adaptive responses likely reflect fundamental physiological divergences between neural and branchial systems in L. vannamei.

While this study primarily focused on transcriptomic profiling, future investigations should integrate metabolomic approaches to validate KP metabolite flux dynamics and employ protein–protein interaction networks to delineate TDO-regulated signaling hubs. Furthermore, the phenotypic consequences of TDO knockout on immune competency and ethologically relevant behaviors remain to be systematically investigated. Whether the crustacean KP indirectly regulates immunity through microbial symbiosis is also a direction of deeper investigation [5].

Conclusion

Our findings propose that L. vannamei compensates for IDO absence through tissue-specific TDO regulation, enabling metabolic-immune coordination despite structural simplification of the KP. While structural divergences in LvTDO hint at lineage-specific adaptations, their functional significance requires validation. This study underscores the evolutionary flexibility of tryptophan metabolism and provides a framework for probing invertebrate neuroimmunity—a critical step toward improving aquaculture sustainability in changing environments.

Abbreviations

IDO

Indoleamine-2,3-dioxygenase

TDO

Tryptophan-2,3-dioxygenase

AFMID

Kynurenine formamidase

KMO

Kynurenine-oxoglutarate transaminase

KYNU

Kynureninase

HAAO

3-Hydroxyanthranilate 3,4-dioxygenase

ACMSD

2-Amino-3-carboxymuconate-6-semialdehyde decarboxylase

KYAT

Kynurenine-oxoglutarate transaminase

QUIN

Quinolinic acid

KYNA

Kynurenic acid

DEGs

Differentially expressed genes

GO

Gene ontology

KEGG

Kyoto encyclopedia of genes and genomes

ppt

Parts per thousand

Authors’ contributions

G.T., J.L., and X.Z. performed experiment and collected tissues. G.T., H.Y., and X.Z. generated sequencing data. G.T. and H.Y. analyzed data and generated figures. H.Y., and J.Y. conceptualized the experiment and drafted main manuscript text. H.Li, and Y.S. carried out Validation, Data curation, Writing-review and editing. All authors reviewed the manuscript.

Funding

This study was supported by the Natural Science Foundation of Hebei Province of China (D2022201003).

Data availability

Sequence data that support the findings of this study have been deposited in the National Center for Biotechnology Information Sequence Read Archive database with the primary accession code PRJNA1254893.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.