Skip to main content
NCBI home page
Biology Open logoLink to Biology Open
. 2025 Aug 12;14(8):bio062118. doi: 10.1242/bio.062118

Connexin 41.8 governs timely haematopoietic stem and progenitor cell specification

Tim Petzold 1,2,3, Sarah Brivio 1, Tanja Linnerz 1,4, Masakatsu Watanabe 5, Holger Gerhardt 2,3,6, Julien Y Bertrand 1,7,✉
PMCID: PMC12381925  PMID: 40605752

ABSTRACT

Haematopoietic stem and progenitor cells (HSPCs) derive from a subset of endothelial cells (ECs), known as haemogenic ECs by the process of endothelial-to-haematopoietic transition (EHT). Although many factors involved in EHT have been elucidated, we still have a poor understanding of the temporal regulation of this process. Mitochondrial-derived reactive oxygen species (ROS) have been shown to stabilise the hypoxia-inducible factor 1/2α (Hif1/2α) proteins, allowing them to positively regulate EHT. Here, we show a developmental delay in EHT and HSPC induction in a connexin (cx)41.8 (orthologous to mammalian CX40) gap junction mutant, in zebrafish. In mammalian cells, CX40 has been shown to localise to the mitochondria. We demonstrate that Cx41.8 is important for the correct temporal generation of mitochondrial ROS, which stabilise the Hif pathway, allowing for the subsequent specification of the haemogenic endothelium. Taken together, our data indicate that Cx41.8 governs the correct temporal induction of HSPCs.

Keywords: Cx41.8, CX40, HSPC, ROS, Zebrafish

Summary: Cx41.8 is necessary to launch the haemogenic program and induce HSPC formation at the correct time during zebrafish development via a ROS-Hif-Notch-Gata2b pathway.

INTRODUCTION

Haematopoietic stem and progenitor cells (HSPCs) are rare, highly specialised cells that sit at the top of the haematopoietic hierarchy. HSPCs have the ability to self-renew and give rise to progenitor cells, which differentiate into mature blood cells (Laurenti and Gottgens, 2018). In vertebrates, HSPCs derive from the haemogenic endothelium (Ottersbach, 2019), in a highly conserved process known as endothelial-to-haematopoietic transition (EHT) (Bertrand et al., 2010; Boisset et al., 2010; Kissa and Herbomel, 2010; Eilken et al., 2009). Having a detailed understanding of all the factors involved in EHT may allow for in vitro generation of HSPCs from endothelial cells (ECs) in the future, which could have significant implications for regenerative medicine.

Connexin proteins play diverse roles in health and disease (Laird and Lampe, 2018). Six connexins form a connexon, which, when present at the cell membrane, can dock onto a connexon on a neighbouring cell to form a gap junction (Goodenough and Paul, 2009). Gap junctions can facilitate the transport of ions, amino acids and small metabolites across the plasma membrane (Delmar et al., 2018). Interestingly, in mammals, CX40, along with other connexins, has been found to localise to the membrane of intracellular organelles such as the mitochondria (Guo et al., 2017; Boengler et al., 2022), where it promotes the production of reactive oxygen species (ROS) (Guo et al., 2017). We previously demonstrated that zebrafish cx41.8 (orthologous to mammalian CX40) plays a role in HSPC expansion in the caudal haematopoietic tissue (Cacialli et al., 2021). Indeed, HSPCs died by apoptosis in cx41.8t1/t1 mutants as a result of ROS toxicity during their expansion phase, whereas their specification and emergence were unaffected (Cacialli et al., 2021).

Here, we find that another cx41.8 zebrafish mutant, cx41.8tq/tq, has a delay in the specification of the haemogenic endothelium resulting in delayed HSPC emergence. We determine that this phenotype is mechanistically linked with mitochondrial ROS production and the hypoxia-inducible factor (Hif) pathway. We suggest that mitochondrial Cx41.8 contributes to the correct temporal induction of EHT and the subsequent formation of HSPCs during zebrafish development.

RESULTS

cx41.8tq/tq mutants harbour an HSPC specification defect

We previously characterised definitive haematopoiesis in the cx41.8t1/t1 mutant (Cacialli et al., 2021) and decided to investigate whether the cx41.8tq/tq mutant displays the same haematopoietic phenotype. The leotq270 mutant (referred to as cx41.8tq/tq throughout), possesses a missense mutation, I203F, in the fourth transmembrane domain of the protein (Watanabe and Kondo, 2012) (Fig. 1A,B), which results in disruption of the channel function (Watanabe et al., 2006, 2016). Primitive haematopoiesis was found to be unaffected in cx41.8tq/tq embryos relative to controls, as determined by the expression of gata1 and pu.1 (primitive erythrocytes and primitive myeloid cells, respectively), by whole-mount in situ hybridisation (WISH) at 24 hpf (Fig. S1A,B). However, markers of definitive haematopoiesis were found to be significantly altered in cx41.8tq/tq embryos: gata2b expression at 24 hpf (Fig. 1C), and runx1 expression at 24 hpf (Fig. 1D) and 28 hpf (Fig. S2A) were reduced when compared with controls, as determined by WISH. In addition, a reduction in the number of cmyb+ haemogenic endothelial cells on the ventral side of the dorsal aorta in cmyb:GFP embryos was observed in cx41.8tq/tq;cmyb:GFP embryos (see Fig. S3A for representative image) at 28 and 30 hpf (Fig. 1E), providing further evidence for a defect in HSPC specification in cx41.8tq/tq embryos. Interestingly, however, there was no difference in the number of cmyb+ HSPCs budding from the dorsal aorta between cx41.8tq/tq mutants and controls at 32 hpf (Fig. 1E), whilst at 48 and 50 hpf, an increase in the number of cmyb:GFP+ budding HSPCs was present in cx41.8tq/tq embryos, compared to wild-type controls (Fig. 1E), pointing towards an HSPC specification delay in these animals. Of note, we also found a reduction in the number of cmyb:GFP+ multiciliated cells along the yolk tube extension of cx41.8tq/tq;cmyb:GFP embryos relative to controls between 28 and 50 hpf (Fig. S3A,B), although this particular finding was not investigated further.

Fig. 1.

Fig. 1.

Open in a new tab

The I203F mutation in Cx41.8 results in a defect in haemogenic endothelium induction and HSPC specification. (A) The leotq270 (cx41.8tq/tq) mutant possesses an I203F change in the fourth transmembrane domain. (B) Sanger sequencing shows an A-to-T base change in the cx41.8tq/tq mutant. (C) In situ hybridisation and quantification of gata2b in cx41.8tq/tq mutants and controls at 24 hpf. (D) In situ hybridisation and quantification of runx1 in cx41.8tq/tq mutants and controls at 24 hpf. (E) Quantification of cmyb:GFP+ haemogenic endothelial (HE) cells and HSPCs in cx41.8tq/tq and control embryos between 28 and 50 hpf. Statistical significance was calculated using either a Chi-squared test (C and D) or an unpaired t-test (E). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Scale bars: 200 μm (C and D). Created in BioRender by Petzold, T., 2025. https://BioRender.com/97nw7ib. This figure was sublicensed under CC-BY 4.0 terms.

Since HSPCs are specified from the dorsal aorta in vertebrates (Clements and Traver, 2013), we asked whether arterial EC specification was impaired in cx41.8tq/tq embryos by analysing dll4 expression. However, dll4 expression was normal in cx41.8tq/tq embryos, as determined by WISH at 24 hpf (Fig. S1C) and 28 hpf (Fig. S1D). Altogether, this data indicates that cx41.8 plays a role in the induction of the haemogenic endothelium and subsequent specification of HSPCs from the dorsal aorta.

The HSPC specification defect in cx41.8tq/tq mutants is due to a delay in gata2b expression

To further characterise the HSPC specification defect present in cx41.8tq/tq mutants, we carried out WISH for the HSPC marker genes runx1 and cmyb at later stages in development. WISH staining marking HSPCs was found to be normal in cx41.8tq/tq mutant embryos at 48 hpf (Fig. S2B), 72 hpf (Fig. S2C) and 4.5 dpf (Fig. S2D) as determined by cmyb WISH.

Hence, since HSPC specification is initially reduced, but then recovers in cx41.8tq/tq embryos, we suspected a delay in the formation of the haemogenic endothelium in these mutants. To test this hypothesis, we determined the expression of gata2b at multiple stages in cx41.8tq/tq embryos, since its expression precedes the expression of runx1, and marks the development of the haemogenic endothelium (Butko et al., 2015). gata2b was found to be significantly reduced at 23 hpf (Fig. S4A), 24 hpf (Fig. S4B) and 26 hpf (Fig. S4C) in cx41.8tq/tq mutants compared to control embryos. However, cx41.8tq/tq embryos displayed significantly more gata2b expression at 30 hpf, 32 hpf and 36 hpf (Fig. S5A-C). To validate our in situ hybridisation data findings, we also performed gene expression analysis of gata2b (Fig. S6A), runx1 (Fig. S6B) and cmyb (Fig. S6C) by qPCR on dissected trunks and tails of cx41.8tq/tq embryos and controls at different developmental stages. Broadly, our qPCR data corroborates our WISH findings. Notably, however, the gene expression differences observed by qPCR were not found to be statistically significant, which may be explained by the relatively high variation in expression present between replicates.

Altogether, however, these data demonstrate delayed gata2b expression in the dorsal aorta of cx41.8tq/tq embryos, which we speculate also results in the delay in the expression induction of the downstream genes, runx1 and cmyb. As such, cx41.8tq/tq embryos possess a developmental delay in the formation of the haemogenic endothelium, which subsequently results in the disrupted temporal control of HSPC specification.

cx41.8 is expressed in ECs in the dorsal aorta floor

We previously showed that cx41.8 is expressed in vascular ECs in zebrafish (Denis et al., 2019), and we also reported a critical role for Cx41.8 in bridging HSPCs with their vascular niche in the caudal haematopoietic tissue (Cacialli et al., 2021). Additionally, transcriptomics data recently revealed a high expression of cx41.8 in arterial ECs at 24 hpf (Gurung et al., 2022). In order to investigate the spatiotemporal expression pattern of cx41.8 more precisely, we generated a cx41.8:EGFP zebrafish reporter line using the previously described cx41.8 promoter (Watanabe and Kondo, 2012) (Fig. 2A).

Fig. 2.

Fig. 2.

Open in a new tab

cx41.8 is expressed in presumptive haemogenic endothelial cells of the dorsal aorta. (A) Design of the cx41.8:EGFP plasmid. The upper line indicates the cx41.8 locus structure. The lower line indicates the construct design. Purple boxes indicate the cx41.8 exons; blue boxes indicate the open reading frame; yellow boxes indicate the 4.5 kb sequence upstream of the cx41.8 start codon; black boxes indicate the transposon sequences and the green box indicates the EGFP coding sequence. (B) cx41.8:EGFP expression in the presumptive floor of the aorta at 24 and 28 hpf and in presumptive budding HSPCs (48 hpf). White arrowheads denote presumptive haemogenic endothelial cells in the floor of the aorta and budding HSPCs (48 hpf). (C) Flow cytometry analysis of double-positive cells in 48 hpf kdrl:mCherry+ or cx41.8:EGFP+; kdrl:mCherry+ embryos. (D) Expression of cx41.8:EGFP and kdrl:mCherry from 24-48 hpf. White arrowheads denote cx41.8:EGFP and kdrl:mCherry double-positive endothelial cells in the floor of the dorsal aorta. Scale bars: 100 μm (B and D).

During HSPC specification (24-48 hpf), EGFP was expressed in structures resembling vasculature. In particular, strong expression was detected as a thin line in the region of the axial vasculature (likely the aortic floor, see 24 and 28 hpf in Fig. 2B). Furthermore, at 48 hpf, cx41.8:EGFP expression was detected in rounded cells at the floor of the aorta, which are presumptive budding HSPCs (Fig. 2B). To confirm these findings, we established cx41.8:EGFP;kdrl:mCherry double transgenic embryos. The trunks and tails were dissected from these embryos at 48 hpf and subjected to flow cytometry analyses. A population of double positive cx41.8:EGFP;kdrl:mCherry cells was detected, which was absent in kdrl:mCherry embryos (Fig. 2C, for gating strategy see Fig. S7). This confirms that cx41.8 is expressed in ECs of the zebrafish trunk and tail.

Finally, by observing cx41.8:EGFP;kdrl:mCherry embryos by fluorescence microscopy, we confirmed that double positive cx41.8:EGFP;kdrl:mCherry ECs are indeed present in the floor of the aorta between 24 and 48 hpf (Fig. 2D). Together, this suggests that cx41.8 is expressed in presumptive haemogenic ECs and budding HSPCs in the aortic floor during the time of EHT and HSPC specification.

Temporal mitochondrial ROS induction of HSPCs requires cx41.8

Previous work has elucidated a key role of mitochondrial-derived ROS in HSPC specification (Harris et al., 2013). Furthermore, the mammalian Cx41.8 orthologue, CX40, has been found to be localised to the mitochondria in mouse and human ECs, and was shown to be necessary for mitochondrial ROS production (Guo et al., 2017). Hence, we wanted to test if the production of mitochondrial ROS was impaired in ECs of the vascular cord, which begins to luminise around 18 hpf (Jin et al., 2005), in cx41.8tq/tq mutants. To determine whether this was the case, we first probed for the presence of total cellular ROS and mitochondrial-derived ROS in the vascular cord at 16 hpf (Fig. 3A). Total cellular ROS were detected in the ventral side of the vascular cord in kdrl:GFP embryos, but were absent in cx41.8tq/tq;kdrl:GFP embryos, as determined by using a cellROX probe (Fig. 3B). Similarly, mitochondrial ROS were also detected on the ventral side of the vascular cord in kdrl:GFP embryos at 16 hpf, but were absent in cx41.8tq/tq;kdrl:GFP embryos, as determined using a mitoSOX probe (Fig. 3C). This indicates that there is indeed a defect in mitochondrial ROS production in vascular cord ECs in cx41.8tq/tq mutant embryos, prior to the induction of gata2b expression.

Fig. 3.

Fig. 3.

Open in a new tab

Mitochondrial-derived ROS production in endothelial cells is required for haemogenic endothelium induction and the specification of HSPCs. (A) Schematic showing the region of 16 hpf embryos which was analysed by fluorescence microscopy in B and C. (B) Fluorescence microscopy images of total cellular ROS detection in kdrl:GFP+ or cx41.8tq/tq;kdrl:GFP+ embryos. White arrowheads denote the presence of ROS in endothelial cells. Numbers indicate the ratio of embryos with the respective phenotype. (C) Fluorescence microscopy images of mitochondrial-derived ROS detection in kdrl:GFP+ or cx41.8tq/tq;kdrl:GFP+ embryos. White arrowheads denote mitochondrial-derived ROS in endothelial cells. Numbers indicate the ratio of embryos with the respective phenotype. (D) Quantification of aortic runx1 signal (in situ hybridisation) at 28 hpf in WT control embryos and those treated with MitoTEMPO, NAC, GSH, heptanol or CBX. (E) Quantification of aortic gata2b signal (in situ hybridisation) at 23 hpf in cx41.8tq/tq control embryos and cx41.8tq/tq embryos treated with H202 or menadione. (F) Quantification of aortic runx1 signal (in situ hybridisation) at 28 hpf in cx41.8tq/tq control embryos and cx41.8tq/tq embryos supplemented with H202 and menadione. Statistical significance was calculated using a Chi-squared test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Scale bars: 25 μm (B and C). Created in BioRender by Petzold, T., 2025. https://BioRender.com/n88jg67. This figure was sublicensed under CC-BY 4.0 terms.

Next, we set out to determine whether modulation of ROS has an effect on haemogenic endothelium induction and HSPC specification. Wild-type (WT) embryos were treated with MitoTEMPO, a specific inhibitor of mitochondrial ROS production (Peterman et al., 2015), and subsequently fixed for WISH. Treatment with MitoTEMPO from 14 hpf resulted in impaired HSPC specification as determined by a significant reduction of runx1 WISH signal at 28 hpf (Fig. 3D). Treatment of WT embryos with the anti-oxidants N-Acetyl-Cysteine (NAC) or reduced L-glutathione (GSH) from 14 hpf, also impaired HSPC specification as determined by runx1 WISH at 28 hpf (Fig. 3D), as was previously shown (Harris et al., 2013). Moreover, treatment of WT embryos with the connexin blockers heptanol (Muto and Kawakami, 2011) and carbenoxolone (CBX) (Casano et al., 2016) from 14 hpf also resulted in a decrease in HSPC specification (Fig. 3D).

Following this, we treated cx41.8tq/tq mutant embryos with the ROS enhancers, H2O2 (Zorov et al., 2014) and menadione (Criddle et al., 2006) from 14 hpf, which resulted in an increased expression of both gata2b at 23 hpf (Fig. 3E) and runx1 at 28 hpf (Fig. 3F), as determined by WISH. H2O2 was able to rescue gata2b expression in a dose-dependent manner (Fig. S8). Together, this data suggests that Cx41.8 plays a key role for the correct temporal generation of mitochondrial ROS and the subsequent induction of the haemogenic program in the dorsal aorta.

Induction of the Hif1/2α-mediated haematopoietic program in response to mitochondrial ROS is dependent on cx41.8

Recent research has demonstrated that hypoxia and mitochondrial ROS are required for the stabilisation of the transcription factors Hif1/2α at the protein level (Harris et al., 2013; Gerri et al., 2018). Mechanistically, ROS stabilise Hif1/2α by inhibiting prolyl hydroxylases which target Hif1/2α for ubiquitination by the von Hippel Lindau (VHL) protein, resulting in their subsequent degradation (Pan et al., 2007; Chowdhury et al., 2016). Hif1/2α have been shown to act upstream of Notch1a/b signalling, which in turn induces gata2b expression and the formation of the haemogenic endothelium (Gerri et al., 2018). Therefore, we hypothesised that the lack of mitochondrial ROS production at 16 hpf in cx41.8tq/tq embryos resulted in the degradation of Hif1/2α and the subsequent lack of gata2b transcriptional activation.

To test whether cx41.8 is involved in this ROS-Hif1/2α-Notch1a/b-gata2b pathway, cx41.8tq/tq embryos were treated with either cobalt chloride (CoCl2), a hypoxia mimetic that interferes with the interaction between Hif1/2α and VHL (Yuan et al., 2003), or the prolyl hydroxylase inhibitor dimethyloxallyl glycine (DMOG) (Takeda et al., 2009). Treatment with CoCl2 or DMOG from 14 hpf resulted in a rescue of both gata2b (Fig. 4A) and runx1 (Fig. 4B) expression in cx41.8tq/tq embryos at 23 and 28 hpf, respectively.

Fig. 4.

Fig. 4.

Open in a new tab

Stabilisation of Hif1/2α rescues haemogenic endothelium induction and HSPC specification in cx41.8tq/tq mutants. (A) Quantification of aortic gata2b signal (in situ hybridisation) at 23 hpf in cx41.8tq/tq control embryos and cx41.8tq/tq embryos supplemented with CoCl2 or DMOG. (B) Quantification of aortic runx1 signal (in situ hybridisation) at 28 hpf in cx41.8tq/tq control embryos and cx41.8tq/tq embryos treated with CoCl2 or DMOG. (C) In situ hybridisation and quantification of gata2b at 23 hpf in WT control embryos and cx41.8tq/tq embryos injected with either control- or vhl-MO. (D) In situ hybridisation and quantification of runx1 at 28 hpf in control-MO or vhl-MO injected wild-type or cx41.8tq/tq mutant embryos. Statistical significance was calculated using a Chi-squared test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Scale bars: C, 100 μm, D, 200 μm.

We then used a previously described vhl morpholino (MO) (Klems et al., 2020; Wild et al., 2017; Santhakumar et al., 2012) to prevent vhl function. The vhl-MO resulted in the induction of a cryptic splice site in exon 1 of the vhl transcript (Fig. S9A) and the subsequent loss of 18 amino acids from the VHL beta domain (Fig. S9B), required for the interaction between VHL and Hif1/2α (Haase, 2009). MO-mediated knockdown of vhl in WT embryos resulted in an increase in gata2b expression at 23 hpf (Fig. 4C) whilst there was a non-significant increase in runx1 expression at 28 hpf (Fig. 4D), since expression of this marker is already high in the majority of control MO-injected WT embryos. MO-mediated knockdown of vhl in cx41.8tq/tq embryos resulted in a rescue of gata2b expression at 23 hpf (Fig. 4C) and also rescued runx1 expression at 28 hpf (Fig. 4D), showing that the delay in gata2b expression was likely due to the degradation of Hif1/2α.

Finally, in order to solidify our model, we performed qPCR on dissected trunks and tails of cx41.8tq/tq embryos and controls to investigate the expression of the hif2a and notch1 paralogues, hif2aa and notch1b. While we expected the expression of hif2aa to be similar in cx41.8tq/tq embryos and controls, we predicted a delay in the expression of notch1b in cx41.8tq/tq mutants. Indeed, we found that while hif2aa expression levels remained relatively equal between cx41.8tq/tq embryos and controls between 24 and 36 hpf (Fig. S10A), notch1b expression was reduced in cx41.8tq/tq embryos at 24 and 36 hpf (Fig. S10B), which was no longer the case at 48 hpf (Fig. S10B). In summary, this data provides evidence for the involvement of cx41.8 in a ROS-Hif1/2α-Notch1a/b-gata2b pathway that governs timely induction of the haemogenic endothelium and HSPC specification.

DISCUSSION

Here, we have demonstrated that there is a delay in the development of the haemogenic endothelium and the subsequent specification of HSPCs in the absence of a fully functional Cx41.8. Mechanistically, Cx41.8 seems to play a key role in the production of mitochondrial ROS. This may be the result of reduced calcium uptake into the mitochondria in cx41.8tq/tq mutants, as has been reported in CX40-deficient ECs (Guo et al., 2017). Furthermore, whilst an increase in mitochondrial metabolism was previously found to drive mitochondrial ROS generation in response to glucose, enhancing HSPC induction (Harris et al., 2013), calcium entry into the mitochondria has also been demonstrated to induce mitochondrial metabolism (Rossi et al., 2019; Jouaville et al., 1999). Hence, we speculate that mitochondrial calcium influx, occurring in a Cx41.8 dependent manner, drives mitochondrial metabolism, resulting in an increase in mitochondrial ROS production. Ultimately, this elevation in ROS then induces the downstream haematopoietic program.

The partial functionality of the Cx41.8 channel in cx41.8tq/tq mutants (Watanabe et al., 2006) may explain why the HSPC program is delayed but induced, as mitochondrial ROS generation may eventually reach the threshold required to sufficiently stabilise the Hif1/2α proteins for downstream transcriptional activation of gata2b. This could also result from functional redundancy between Cx41.8 and other connexins such as Cx43 or Cx45.6 in the mitochondria, since they are also expressed in zebrafish arterial ECs at 24 hpf (Gurung et al., 2022) and cx43 knockdown has previously been shown to result in an HSPC specification defect in zebrafish (Jiang et al., 2010). This potential functional redundancy may also provide an explanation as to why HSPCs are specified normally, without any delay, in cx41.8t1/t1 embryos (Cacialli et al., 2021). In these null mutants, cx41.8 expression is completely absent but may be functionally compensated by other connexins, whereas in cx41.8tq/tq mutants, although cx41.8 is expressed, its channel function is reduced (Watanabe et al., 2006, 2016). Moreover, as Cx41.8 may form heterotypic channels with Cx43 and/or Cx45.6 (and potentially also with others), the function of these chimeric channels would also be altered.

GATA2 has been shown to positively autoregulate its own expression in mice (Katsumura et al., 2016; Nozawa et al., 2009), and Gata2b may also act in this way in zebrafish (Dobrzycki et al., 2020). Therefore, one can speculate that once gata2b expression has been induced by the Cx41.8-mitoROS-Hif1/2α-Notch1a/b-gata2b pathway, it may also further activate its own expression, increasing robustness of the haematopoietic transcriptional program. In any case, whether gata2a, a paralogue of gata2b, which was previously shown to contribute to definitive haematopoiesis in zebrafish (Gioacchino et al., 2021; Bresciani et al., 2021), also plays a role in the molecular pathway that we have uncovered, remains to be explored in future work.

In summary, we suggest that mitochondrial channels formed by Cx41.8 and perhaps also others, are important for ROS production in the mitochondria of vascular cord ECs, as early as 16 hpf. These mitochondrial-derived ROS stabilise the transcription factors Hif1/2α, which subsequently translocate into the nucleus leading to the expression induction of gata2b in a Notch1a/b-dependent manner (Fig. 5), as shown previously (Gerri et al., 2018). This signalling cascade ends with the specification of the haemogenic endothelium, leading to the formation of HSPCs. cx41.8tq/tq mutants display a delay in the transcriptional program regulating the formation of the haemogenic endothelium and HSPCs. Hence, cx41.8 facilitates the correct temporal induction of HSPCs. We speculate that this is likely to also be the case in mammals, since CX40 (the mammalian orthologue of cx41.8) is highly expressed in the haemogenic endothelium of mouse (Fadlullah et al., 2022) and humans (Calvanese et al., 2022), and as CX40 localises to the mitochondria in ECs of both these species (Guo et al., 2017).

Fig. 5.

Fig. 5.

Open in a new tab

Proposed model of the role of Cx41.8 in HSPC specification. Cx41.8 localises to the mitochondria in haemogenic endothelial cells, allowing mitochondrial ROS production which stabilises Hif1/2α, which in turn induces gata2b expression via Notch1a/b signalling. Created in BioRender by Petzold, T., 2025. https://BioRender.com/konhezh. This figure was sublicensed under CC-BY 4.0 terms.

Further research will be required to determine the exact mechanism(s) by which mitochondrial ROS are produced specifically in this EC subpopulation. This may involve sterile inflammation, which is particularly important for the induction of EHT and the budding of nascent HSPCs from the aortic floor (Espin-Palazon et al., 2014; Li et al., 2014; Collins et al., 2021). Our data contribute to a better understanding of the factors required for the initiation of the haemogenic program, which may have significant implications for enhancement of current regenerative medicine protocols, to produce haematopoietic progenitor cells in vitro.

MATERIALS AND METHODS

Ethical statement

Zebrafish were raised in accordance with FELASA and Swiss guidelines (Alestrom et al., 2020). No authorisation was required since experiments were carried out on embryos up to 5 days post fertilization. All efforts were made to comply to the 3R guidelines.

Zebrafish husbandry

AB* zebrafish, as well as transgenic zebrafish lines were kept in a 14/10 h light/dark cycle at 28.5°C. Embryos were obtained as described previously (Westerfield, 2000). Embryos were staged by hours post fertilization (hpf) as described previously (Kimmel et al., 1995). In this study the mutant zebrafish line leo270/270 (Watanabe et al., 2006) (referred to as cx41.8tq/tq) was utilised and genotyped by PCR (using primers listed in Table S1), followed by Sanger sequencing (Fig. 1B). The following transgenic lines were used in this study: Tg(kdrl:GFP)s843 (Jin et al., 2005), Tg(kdrl:Has.HRASmCherry)s896 (Chi et al., 2008) (referred to as Tg(kdrl:mCherry)), Tg(cmyb:GFP)zf169 (North et al., 2007) and Tg(cx41.8:EGFP) (Watanabe and Kondo, 2012). Zebrafish embryos were treated with 0.003% 1-phenyl-2-thiourea (PTU, Sigma P7629) starting at 24 hpf to prevent pigmentation.

Generation of transgenic animals

For Tg(cx41.8:EGFP) zebrafish generation, 50 pg of the Tol2 cx41.8:EGFP plasmid, described previously (Watanabe and Kondo, 2012), was co-injected with 50 pg of tol2 transposase mRNA into AB* zebrafish embryos. Injected F0s were mated with AB* zebrafish, and the resulting F1 offspring were screened by fluorescence microscopy to assess germline integration of the Tol2 construct. F2 zebrafish adults were subsequently mated and their offspring utilised in experiments.

WISH

WISH was performed on 4% paraformaldehyde-fixed embryos as described previously (Thisse and Thisse, 2008). Digoxigenin-labelled dll4, gata1, pu.1, gata2b, runx1 and cmyb in situ probes were used and their generation has been described previously (Cacialli et al., 2021; Mahony et al., 2016).

Chemical treatments

All compounds used in this study were purchased from Sigma-Aldrich. Zebrafish embryos were exposed to compounds in 0.003% 1-phenyl-2-thiourea (PTU, Sigma, P7629) E3 (fish) water in multi-well plates from 14 hpf to either 23 or 28 hpf. Following exposure, embryos were fixed in 4% paraformaldehyde. All chemical treatment experiments are a combination of at least two independent experiments with independent clutches.

Flow cytometry

Dissected embryos were incubated with a liberase-blendzyme 3 (Roche) solution for 90 min at 33°C, then dissociated and resuspended in 0.9× PBS-1% fetal calf serum, as described previously (Cacialli et al., 2021). We distinguished and excluded dead cells by staining them with SYTOX Red (Life Technologies). Cell suspensions were passed through a 40 mm filter prior to flow cytometry. Data were acquired on a LSR2Fortessa (BD Biosciences, software diva8.0.2) and analysed with FlowJo (v10).

Total cellular and mitochondrial reactive oxygen species detection

Whole-mount staining with the cellROX (Invitrogen) or MitoSOX (Life Technologies) probes was performed on living zebrafish embryos at 16 hpf, following the methods described previously (Mugoni et al., 2014). Embryos were exposed to either a 5 µM cellROX or a 5 µM MitoSOX solution for 45 min and incubated at 28.5°C. Subsequently, imaging was carried out by fluorescence microscopy.

Microscopy

WISH images were taken on an Olympus MVX10 microscope in 100% glycerol. Confocal imaging in Fig. 2B and D was performed using an upright 3i spinning-disc confocal microscope and using a Zeiss Plan-Apochromat 20× or 40× water-dipping objective. All other fluorescent images were taken with an IX83 microscope [Olympus; Figs 2D (48 hpf), 3B,C and Fig. S3A]. All images were taken using the CellSens Dimension software (Olympus).

MO injections

The standard control (CCTCTTACCTCAGTTACAATTTATA) and vhl (GCATAATTTCACGAACCCACAAAAG) MO oligonucleotides were purchased from GeneTools (Philomath, OR, USA). MO efficiency was tested by PCR (Fig. S9C) from total RNA extracted from 15 embryos per sample at 24 hpf (using primers listed in Table S3). The vhl-MO-induced loss of 54 bp from exon 1 of the vhl transcript upon injection of 6 ng of MO was confirmed by Sanger sequencing (Fig. S9D). In all subsequent MO experiments, 6 ng of vhl or standard control MO was injected per embryo. All morpholino experiments are a combination of three experiments with independent clutches.

Quantitative real-time PCR and analyses

Total RNA was extracted using RNeasy minikit (Qiagen) and reverse transcribed into cDNA using a Superscript III kit (Invitrogen). Quantitative real-time PCR (qPCR) was performed using a KAPA SYBR FAST Universal qPCR Kit (KAPA BIOSYSTEMS) and run on a CFX connect real-time system (Bio-Rad). All qPCR primers used for gene expression are listed in Table S2. Trunks and tails of embryos were dissected from embryos for all qPCR experiments and ∼30 embryos were used for each condition. All qPCR experiments were performed using technical triplicates. All expression values were normalised to the expression of ef1-alpha. Experiments were each repeated two or three times and fold-change averages from each experiment were combined.

Image processing and analyses

All images were processed using Fiji ImageJ (NIH) (Schindelin et al. 2012). For quantification of cmyb GFP+ haemogenic endothelium, HSPCs and multi-ciliated cells, cells in the trunk region spanning the length of the yolk tube extension were included in the analysis in each case. WISH phenotypic variation was analysed qualitatively and depicted graphically as the percentage of total embryos scored exhibiting high, medium or low gene expression in the region of interest, as done previously (Lefkopoulos et al. 2020). In detail, qualitative scoring (number of embryos with altered signal per total number of embryos making up the sample for each case) of WISH staining was conducted manually. The individual performing the categorization evaluated the staining intensity and, due to the versatility of staining from experiment to experiment, used the staining exhibited by the majority of the control embryos of each individual experiment as a reference point. The individual categorised as ‘low expression’ the embryos depicting a staining lower than the staining of the majority of control embryos, as ‘medium expression’ the embryos depicting a staining approximately equal to the staining of the majority of control embryos and as ‘high expression’ the embryos showing a higher intensity compared to the staining of the majority of control embryos. The in situ hybridization scoring presented in the manuscript represents the work of one individual, to avoid combining systematic errors. The individual categorizing the phenotypes into low, medium, high turned the numbers of embryos into % percentages (number of embryos depicting the particular staining intensity/total number of embryos examined in the experimental sample×100%), before statistical analyses was carried out. Details of the statistical test(s) used to determine significance are described in the section Data analyses.

Data analyses

At least three independent experiments were carried out in all cases, unless stated otherwise. In all experiments, normality was assumed, and variance was comparable between groups. Sample size was selected empirically according to previous experience in the assessment of experimental variability and sample sizes are indicated in each figure, when appropriate. Numerical data are the mean±s.e.m., unless stated otherwise. Statistical tests used are stated in each figure legend. Statistical differences are denoted as *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 in all figures. Statistical calculations and the graphs for the numerical data were performed using Prism 10 software (GraphPad Software).

Supplementary Material

biolopen-14-062118_review_history.pdf (755.2KB, pdf)
Supplementary information
biolopen-14-062118-s1.pdf (8.9MB, pdf)
DOI: 10.1242/biolopen.062118_sup1

Acknowledgements

We would like to thank all lab members for their comments and suggestions during this project. We would also like to thank Prof. Brenda Kwak for helpful discussions about connexins. This work would not have been possible without support from the animal, flow-cytometry and imaging facilities at The University of Geneva.

Footnotes

Author contributions

Conceptualization: J.Y.B.; Data curation: T.P., S.B.; Formal analysis: T.P., S.B., T.L.; Methodology: T.P., J.Y.B.; Resources: M.W., H.G.; Supervision: J.Y.B.; Writing – original draft: T.P., J.Y.B.; Writing – review & editing: T.P., J.Y.B.

Funding

T.P. benefitted from a grant from the Gabbiani Fund. J.Y.B. was funded by the Swiss National Fund (grant #310030_184814) and by the Fondation Privée des Hopitaux de Genève. Open Access funding provided by University of Geneva. Deposited in PMC for immediate release.

Data and resource availability

Raw data is accessible on Yareta (https://yareta.unige.ch/archives/74e35492-529f-4266-a898-4f43dc5e6102) and in the supplementary information.

Peer review history

The peer review history is available online at https://journals.biologists.com/bio/lookup/doi/10.1242/bio.062118.reviewer-comments.pdf.

References

  1. Alestrom, P., D'Angelo, L., Midtlyng, P. J., Schorderet, D. F., Schulte-Merker, S., Sohm, F. and Warner, S. (2020). Zebrafish: Housing and husbandry recommendations. Lab. Anim. 54, 213-224. 10.1177/0023677219869037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bertrand, J. Y., Chi, N. C., Santoso, B., Teng, S., Stainier, D. Y. R. and Traver, D. (2010). Haematopoietic stem cells derive directly from aortic endothelium during development. Nature 464, 108-111. 10.1038/nature08738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Boengler, K., Leybaert, L., Ruiz-Meana, M. and Schulz, R. (2022). Connexin 43 in mitochondria: what do we really know about its function? Front. Physiol. 13, 928934. 10.3389/fphys.2022.928934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boisset, J. C., Van Cappellen, W., Andrieu-Soler, C., Galjart, N., Dzierzak, E. and Robin, C. (2010). In vivo imaging of haematopoietic cells emerging from the mouse aortic endothelium. Nature 464, 116-120. 10.1038/nature08764 [DOI] [PubMed] [Google Scholar]
  5. Bresciani, E., Carrington, B., Yu, K., Kim, E. M., Zhen, T., Guzman, V. S., Broadbridge, E., Bishop, K., Kirby, M., Harper, U.et al. (2021). Redundant mechanisms driven independently by RUNX1 and GATA2 for hematopoietic development. Blood Adv. 5, 4949-4962. 10.1182/bloodadvances.2020003969 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Butko, E., Distel, M., Pouget, C., Weijts, B., Kobayashi, I., Ng, K., Mosimann, C., Poulain, F. E., McPherson, A., Ni, C.-W.et al. (2015). Gata2b is a restricted early regulator of hemogenic endothelium in the zebrafish embryo. Development 142, 1050-1061. 10.1242/dev.119180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cacialli, P., Mahony, C. B., Petzold, T., Bordignon, P., Rougemont, A.-L. and Bertrand, J. Y. (2021). A connexin/ifi30 pathway bridges HSCs with their niche to dampen oxidative stress. Nat. Commun. 12, 4484. 10.1038/s41467-021-24831-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Calvanese, V., Capellera-Garcia, S., Ma, F., Fares, I., Liebscher, S., Ng, E. S., Ekstrand, S., Aguadé-Gorgorió, J., Vavilina, A., Lefaudeux, D.et al. (2022). Mapping human haematopoietic stem cells from haemogenic endothelium to birth. Nature 604, 534-540. 10.1038/s41586-022-04571-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Casano, A. M., Albert, M. and Peri, F. (2016). Developmental apoptosis mediates entry and positioning of microglia in the zebrafish brain. Cell Rep. 16, 897-906. 10.1016/j.celrep.2016.06.033 [DOI] [PubMed] [Google Scholar]
  10. Chi, N. C., Shaw, R. M., De Val, S., Kang, G., Jan, L. Y., Black, B. L. and Stainier, D. Y. R. (2008). Foxn4 directly regulates tbx2b expression and atrioventricular canal formation. Genes Dev. 22, 734-739. 10.1101/gad.1629408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chowdhury, R., Leung, I. K. H., Tian, Y.-M., Abboud, M. I., Ge, W., Domene, C., Cantrelle, F.-X., Landrieu, I., Hardy, A. P., Pugh, C. W.et al. (2016). Structural basis for oxygen degradation domain selectivity of the HIF prolyl hydroxylases. Nat. Commun. 7, 12673. 10.1038/ncomms12673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Clements, W. K. and Traver, D. (2013). Signalling pathways that control vertebrate haematopoietic stem cell specification. Nat. Rev. Immunol. 13, 336-348. 10.1038/nri3443 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Collins, A., Mitchell, C. A. and Passegue, E. (2021). Inflammatory signaling regulates hematopoietic stem and progenitor cell development and homeostasis. J. Exp. Med. 218, e20201545. 10.1084/jem.20201545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Criddle, D. N., Gillies, S., Baumgartner-Wilson, H. K., Jaffar, M., Chinje, E. C., Passmore, S., Chvanov, M., Barrow, S., Gerasimenko, O. V., Tepikin, A. V.et al. (2006). Menadione-induced reactive oxygen species generation via redox cycling promotes apoptosis of murine pancreatic acinar cells. J. Biol. Chem. 281, 40485-40492. 10.1074/jbc.M607704200 [DOI] [PubMed] [Google Scholar]
  15. Delmar, M., Laird, D. W., Naus, C. C., Nielsen, M. S., Verselis, V. K. and White, T. W. (2018). Connexins and disease. Cold Spring Harb. Perspect Biol. 10, a029348. 10.1101/cshperspect.a029348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Denis, J. F., Diagbouga, M. R., Molica, F., Hautefort, A., Linnerz, T., Watanabe, M., Lemeille, S., Bertrand, J. Y. and Kwak, B. R. (2019). KLF4-induced connexin40 expression contributes to arterial endothelial quiescence. Front Physiol. 10, 80. 10.3389/fphys.2019.00080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dobrzycki, T., Mahony, C. B., Krecsmarik, M., Koyunlar, C., Rispoli, R., Peulen-Zink, J., Gussinklo, K., Fedlaoui, B., De Pater, E., Patient, R.et al. (2020). Deletion of a conserved Gata2 enhancer impairs haemogenic endothelium programming and adult Zebrafish haematopoiesis. Commun Biol. 3, 71. 10.1038/s42003-020-0798-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Eilken, H. M., Nishikawa, S. and Schroeder, T. (2009). Continuous single-cell imaging of blood generation from haemogenic endothelium. Nature 457, 896-900. 10.1038/nature07760 [DOI] [PubMed] [Google Scholar]
  19. Espin-Palazon, R., Stachura, D. L., Campbell, C. A., García-Moreno, D., Del Cid, N., Kim, A. D., Candel, S., Meseguer, J., Mulero, V. and Traver, D. (2014). Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell 159, 1070-1085. 10.1016/j.cell.2014.10.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fadlullah, M. Z. H., Neo, W. H., Lie-A-Ling, M., Thambyrajah, R., Patel, R., Mevel, R., Aksoy, I., Do Khoa, N., Savatier, P., Fontenille, L.et al. (2022). Murine AGM single-cell profiling identifies a continuum of hemogenic endothelium differentiation marked by ACE. Blood 139, 343-356. 10.1182/blood.2020007885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gerri, C., Marass, M., Rossi, A. and Stainier, D. Y. R. (2018). Hif-1alpha and Hif-2alpha regulate hemogenic endothelium and hematopoietic stem cell formation in zebrafish. Blood 131, 963-973. 10.1182/blood-2017-07-797795 [DOI] [PubMed] [Google Scholar]
  22. Gioacchino, E., Koyunlar, C., Zink, J., De Looper, H., De Jong, M., Dobrzycki, T., Mahony, C. B., Hoogenboezem, R., Bosch, D., Van Strien, P. M. H.et al. (2021). Essential role for Gata2 in modulating lineage output from hematopoietic stem cells in zebrafish. Blood Adv. 5, 2687-2700. 10.1182/bloodadvances.2020002993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Goodenough, D. A. and Paul, D. L. (2009). Gap junctions. Cold Spring Harb. Perspect. Biol. 1, a002576. 10.1101/cshperspect.a002576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Guo, R., Si, R., Scott, B. T. and Makino, A. (2017). Mitochondrial connexin40 regulates mitochondrial calcium uptake in coronary endothelial cells. Am. J. Physiol. Cell Physiol. 312, C398-C406. 10.1152/ajpcell.00283.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gurung, S., Restrepo, N. K., Chestnut, B., Klimkaite, L. and Sumanas, S. (2022). Single-cell transcriptomic analysis of vascular endothelial cells in zebrafish embryos. Sci. Rep. 12, 13065. 10.1038/s41598-022-17127-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Haase, V. H. (2009). The VHL tumor suppressor: master regulator of HIF. Curr. Pharm. Des. 15, 3895-3903. 10.2174/138161209789649394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Harris, J. M., Esain, V., Frechette, G. M., Harris, L. J., Cox, A. G., Cortes, M., Garnaas, M. K., Carroll, K. J., Cutting, C. C., Khan, T.et al. (2013). Glucose metabolism impacts the spatiotemporal onset and magnitude of HSC induction in vivo. Blood 121, 2483-2493. 10.1182/blood-2012-12-471201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jiang, Q., Liu, D., Sun, S., Hu, J., Tan, L., Wang, Y., Gui, Y., Yu, M. and Song, H. (2010). Critical role of connexin43 in zebrafish late primitive and definitive hematopoiesis. Fish Physiol. Biochem. 36, 945-951. 10.1007/s10695-009-9371-1 [DOI] [PubMed] [Google Scholar]
  29. Jin, S. W., Beis, D., Mitchell, T., Chen, J.-N. and Stainier, D. Y. R. (2005). Cellular and molecular analyses of vascular tube and lumen formation in zebrafish. Development 132, 5199-5209. 10.1242/dev.02087 [DOI] [PubMed] [Google Scholar]
  30. Jouaville, L. S., Pinton, P., Bastianutto, C., Rutter, G. A. and Rizzuto, R. (1999). Regulation of mitochondrial ATP synthesis by calcium: evidence for a long-term metabolic priming. Proc. Natl. Acad. Sci. USA 96, 13807-13812. 10.1073/pnas.96.24.13807 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Katsumura, K. R., Ong, I. M., Devilbiss, A. W., Sanalkumar, R. and Bresnick, E. H. (2016). GATA factor-dependent positive-feedback circuit in acute myeloid leukemia cells. Cell Rep. 16, 2428-2441. 10.1016/j.celrep.2016.07.058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of Embryonic-Development of the Zebrafish. Dev. Dyn. 203, 253-310. 10.1002/aja.1002030302 [DOI] [PubMed] [Google Scholar]
  33. Kissa, K. and Herbomel, P. (2010). Blood stem cells emerge from aortic endothelium by a novel type of cell transition. Nature 464, 112-115. 10.1038/nature08761 [DOI] [PubMed] [Google Scholar]
  34. Klems, A., Van Rijssel, J., Ramms, A. S., Wild, R., Hammer, J., Merkel, M., Derenbach, L., Prã©Au, L., Hinkel, R., Suarez-Martinez, I.et al. (2020). The GEF Trio controls endothelial cell size and arterial remodeling downstream of Vegf signaling in both zebrafish and cell models. Nat. Commun. 11, 5319. 10.1038/s41467-020-19008-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Laird, D. W. and Lampe, P. D. (2018). Therapeutic strategies targeting connexins. Nat. Rev. Drug Discov. 17, 905-921. 10.1038/nrd.2018.138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Laurenti, E. and Gottgens, B. (2018). From haematopoietic stem cells to complex differentiation landscapes. Nature 553, 418-426. 10.1038/nature25022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lefkopoulos, S., Polyzou, A., Derecka, M., Bergo, V., Clapes, T., Cauchy, P., Jerez-Longres, C., Onishi-Seebacher, M., Yin, N., Martagon-Calderón, N.-A.et al. (2020). Repetitive elements trigger RIG-I-like receptor signaling that regulates the emergence of hematopoietic stem and progenitor cells. Immunity 53, 934-951.e9. 10.1016/j.immuni.2020.10.007 [DOI] [PubMed] [Google Scholar]
  38. Li, Y., Esain, V., Teng, L., Xu, J., Kwan, W., Frost, I. M., Yzaguirre, A. D., Cai, X., Cortes, M., Maijenburg, M. W.et al. (2014). Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Genes Dev. 28, 2597-2612. 10.1101/gad.253302.114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mahony, C. B., Fish, R. J., Pasche, C. and Bertrand, J. Y. (2016). tfec controls the hematopoietic stem cell vascular niche during zebrafish embryogenesis. Blood 128, 1336-1345. 10.1182/blood-2016-04-710137 [DOI] [PubMed] [Google Scholar]
  40. Mugoni, V., Camporeale, A. and Santoro, M. M. (2014). Analysis of oxidative stress in zebrafish embryos. J. Vis. Exp. 51328. 10.3791/51328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Muto, A. and Kawakami, K. (2011). Imaging functional neural circuits in zebrafish with a new GCaMP and the Gal4FF-UAS system. Commun. Integr. Biol. 4, 566-568. 10.4161/cib.15848 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. North, T. E., Goessling, W., Walkley, C. R., Lengerke, C., Kopani, K. R., Lord, A. M., Weber, G. J., Bowman, T. V., Jang, I.-H., Grosser, T.et al. (2007). Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature 447, 1007-10U7. 10.1038/nature05883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nozawa, D., Suzuki, N., Kobayashi-Osaki, M., Pan, X., Engel, J. D. and Yamamoto, M. (2009). GATA2-dependent and region-specific regulation of Gata2 transcription in the mouse midbrain. Genes Cells 14, 569-582. 10.1111/j.1365-2443.2009.01289.x [DOI] [PubMed] [Google Scholar]
  44. Ottersbach, K. (2019). Endothelial-to-haematopoietic transition: an update on the process of making blood. Biochem. Soc. Trans. 47, 591-601. 10.1042/BST20180320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Pan, Y., Mansfield, K. D., Bertozzi, C. C., Rudenko, V., Chan, D. A., Giaccia, A. J. and Simon, M. C. (2007). Multiple factors affecting cellular redox status and energy metabolism modulate hypoxia-inducible factor prolyl hydroxylase activity in vivo and in vitro. Mol. Cell. Biol. 27, 912-925. 10.1128/MCB.01223-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Peterman, E. M., Sullivan, C., Goody, M. F., Rodriguez-Nunez, I., Yoder, J. A. and Kim, C. H. (2015). Neutralization of mitochondrial superoxide by superoxide dismutase 2 promotes bacterial clearance and regulates phagocyte numbers in zebrafish. Infect. Immun. 83, 430-440. 10.1128/IAI.02245-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rossi, A., Pizzo, P. and Filadi, R. (2019). Calcium, mitochondria and cell metabolism: a functional triangle in bioenergetics. Biochim. Biophys. Acta Mol. Cell Res. 1866, 1068-1078. 10.1016/j.bbamcr.2018.10.016 [DOI] [PubMed] [Google Scholar]
  48. Santhakumar, K., Judson, E. C., Elks, P. M., McKee, S., Elworthy, S., Van Rooijen, E., Walmsley, S. S., Renshaw, S. A., Cross, S. S. and Van Eeden, F. J. M. (2012). A zebrafish model to study and therapeutically manipulate hypoxia signaling in tumorigenesis. Cancer Res. 72, 4017-4027. 10.1158/0008-5472.CAN-11-3148 [DOI] [PubMed] [Google Scholar]
  49. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B.et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676-682. 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Takeda, K., Ichiki, T., Narabayashi, E., Inanaga, K., Miyazaki, R., Hashimoto, T., Matsuura, H., Ikeda, J., Miyata, T. and Sunagawa, K. (2009). Inhibition of prolyl hydroxylase domain-containing protein suppressed lipopolysaccharide-induced TNF-alpha expression. Arterioscler. Thromb. Vasc. Biol. 29, 2132-2137. 10.1161/ATVBAHA.109.196071 [DOI] [PubMed] [Google Scholar]
  51. Thisse, C. and Thisse, B. (2008). High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59-69. 10.1038/nprot.2007.514 [DOI] [PubMed] [Google Scholar]
  52. Watanabe, M. and Kondo, S. (2012). Changing clothes easily: connexin41.8 regulates skin pattern variation. Pigment Cell Melanoma Res. 25, 326-330. 10.1111/j.1755-148X.2012.00984.x [DOI] [PubMed] [Google Scholar]
  53. Watanabe, M., Iwashita, M., Ishii, M., Kurachi, Y., Kawakami, A., Kondo, S. and Okada, N. (2006). Spot pattern of leopard Danio is caused by mutation in the zebrafish connexin41.8 gene. EMBO Rep. 7, 893-897. 10.1038/sj.embor.7400757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Watanabe, M., Sawada, R., Aramaki, T., Skerrett, I. M. and Kondo, S. (2016). The physiological characterization of connexin41.8 and connexin39.4, which are involved in the striped pattern formation of Zebrafish. J. Biol. Chem. 291, 1053-1063. 10.1074/jbc.M115.673129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Westerfield, M. (2000). The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), 4th edn. Eugene, Oregon: University of Oregon Press. [Google Scholar]
  56. Wild, R., Klems, A., Takamiya, M., Hayashi, Y., Strähle, U., Ando, K., Mochizuki, N., Van Impel, A., Schulte-Merker, S., Krueger, J.et al. (2017). Neuronal sFlt1 and Vegfaa determine venous sprouting and spinal cord vascularization. Nat. Commun. 8, 13991. 10.1038/ncomms13991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yuan, Y., Hilliard, G., Ferguson, T. and Millhorn, D. E. (2003). Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J. Biol. Chem. 278, 15911-15916. 10.1074/jbc.M300463200 [DOI] [PubMed] [Google Scholar]
  58. Zorov, D. B., Juhaszova, M. and Sollott, S. J. (2014). Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 94, 909-950. 10.1152/physrev.00026.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

biolopen-14-062118_review_history.pdf (755.2KB, pdf)
Supplementary information
biolopen-14-062118-s1.pdf (8.9MB, pdf)
DOI: 10.1242/biolopen.062118_sup1

Articles from Biology Open are provided here courtesy of Company of Biologists

RESOURCES