NFATc4 Promotes Lung Adenocarcinoma Progression via the CCNB1/CDK1 Pathway and Is a Potential Prognostic Biomarker

ABSTRACT

Nuclear factor of activated T‐cells, cytoplasmic 4 (NFATc4), a transcription factor of the NFAT family, has been reported to participate in the tumorigenesis and progression of several cancers. However, the function and regulation of NFATc4 in lung adenocarcinoma (LUAD) remain poorly understood. Here, we report for the first time that NFATc4 is significantly overexpressed in LUAD tissues, and high NFATc4 expression correlates with lymphatic metastasis, advanced tumor stage, and poor prognosis in patients. Subsequent functional studies revealed that NFATc4 depletion inhibits LUAD cell viability, proliferation, and tumor growth by inducing cell cycle arrest in the G2/M phase and apoptosis. A mechanistic study shows that NFATc4 knockdown leads to significant enrichment of cellular process‐related pathways and differentially expressed genes, especially downregulated genes Cyclin B1 (CCNB1) and cyclin‐dependent kinase 1 (CDK1). NFATc4 directly binds to the CCNB1 promoter to regulate the CCNB1/CDK1 pathway, resulting in cell cycle arrest and inhibition of cell proliferation. This study identifies NFATc4/CCNB1/CDK1 as a novel regulatory pathway involved in LUAD development and provides a potential prognostic biomarker and molecular therapeutic target for LUAD.

NFATc4 is upregulated in LUAD, and its high expression correlates with the malignant progression of patients. NFATc4 enhances LUAD cell viability and proliferation by regulating the G2/M phase transition and apoptosis. Functionally, NFATc4 directly binds to the CCNB1 promoter, modulating the CCNB1/CDK1 pathway, which results in cell cycle arrest and inhibition of cell proliferation.

Abbreviations

CCNB1

cyclin B1

CDK1

cyclin‐dependent kinase 1

DEGs

differentially expressed genes

GO

Gene Ontology

HR

hazard ratios

IHC

immunohistochemistry

IRS

immunoreactive score

KEGG

Kyoto Encyclopedia of Genes and Genomes

K‐M

Kaplan–Meier

LUAD

lung adenocarcinoma

mIHC

multiplex immunohistochemistry staining

NFATc4

Nuclear factor of activated T‐cells, cytoplasmic 4

NSCLC

non‐small cell lung cancer

OS

overall survival

PFS

progression‐free survival

RNA‐seq

RNA sequencing

TCGA

The Cancer Genome Atlas

TNM

tumor node metastasis

1. Introduction

The global mortality rate of lung cancer, which accounts for 18.7% of all cancer‐related deaths, is the highest among all types of cancers [1]. Approximately 80%–85% of cases are classified as non‐small cell lung cancer (NSCLC), with LUAD being the most prevalent subtype within NSCLC [2]. Despite promising findings in the study of LUAD mechanisms and therapies, the overall cure and 5‐year survival rates remain poor, particularly in advanced‐stage LUAD [3]. More effective systemic therapies are urgently needed to improve long‐term survival outcomes. In line with the principles of precision medicine, the treatment landscape of LUAD is rapidly evolving toward biomarker‐driven targeted therapies and corresponding molecular diagnostic methods [4]. Consequently, the identification of effective molecular markers and therapeutic targets in LUAD is critical to advancing our understanding of disease biology, tumor progression mechanisms, and the development of early detection methods and novel therapies.

The proteins belonging to the nuclear factor of activated T cells (NFAT) protein family are transcription factors originally identified for their role in regulating the expression of proinflammatory cytokines during immune responses [5, 6]. As research progresses, it has become evident that the NFAT family serves a diverse range of functions, including in oncogenesis, cancer prognosis, and anti‐tumor drug resistance [7, 8, 9]. Extracellular vesicles from NFATc4‐overexpressing breast cancer cells were shown to inhibit cancer cell invasion [10], and NFATc4 (also known as NFAT3) can inhibit the proliferation of quiescent ovarian cancer stem‐like cells by downregulating MYC [11, 12]. However, NFATc4 is overexpressed in breast cancer patients, and bioinformatics analysis suggests it is a poor prognostic factor [7], and it reduces ERα‐positive cell migration through actin reorganization and transcriptional repression of LCN2 gene expression [13]. Additionally, NFATc4 is also required for CXCR4 expression and tumor formation in HeyA8 ovarian cancer cells [14]. These studies suggest that the function of NFATc4 in tumorigenesis and progression remains controversial, and the underlying mechanisms require further investigation.

It is well‐established that cancer comprises a group of diseases characterized by continuous and excessive cell division. Aberration in cell proliferation and cell cycle progression is one of fundamental mechanisms underlying tumorigenesis [15]. CCNB1 is a crucial member of the cyclin family, and the formation of a complex between CCNB1 and CDK1 is essential for facilitating the transition of the cell cycle from the G2 phase to mitosis. Whereas CDK1 alone lacks intrinsic kinase activity, its functional activation through complex formation with the regulatory subunit CCNB1 enables CCNB1 to phosphorylate CDK1 substrates and regulate its enzymatic activity, thereby modulating CDK1's cyclic regulation [16, 17]. Accumulating evidence indicates that the dysfunction of CCNB1 in checkpoint regulation serve as an early hallmark of tumorigenesis, with its dysregulated expression being observed in lung cancer [18, 19]. The downregulation of CCNB1 expression mediates the G2 phase arrest in NSCLC cells induced by nagilactone E [20].

In this paper, we demonstrate that NFATc4 is significantly overexpressed in LUAD tissues compared to adjacent tissues, and this increased expression is strongly associated with an unfavorable prognosis for patients. The knockdown of NFATc4 in LUAD cell lines resulted in a reduction in cell viability and proliferation, accompanied by the induction of cell cycle arrest and an increase in apoptosis. Mechanistically, NFATc4 directly binds to CCNB1 to enhance its transcription, leading to excessive activation of CCNB1/CDK1 signaling and promoting LUAD progression. These findings prompt us to propose that the NFATc4/CCNB1/CDK1 axis may exert a crucial role in the regulation of cancer cell cycle and proliferation during tumorigenesis, making NFATc4 a potential therapeutic target and prognostic marker in LUAD.

2. Materials and Methods

2.1. Online Database Analysis

The study analyzed the transcriptome expression data from 576 samples (Tumor: 517; Normal: 59) from TCGA‐LUAD. The R package (version 3.4.3) was used for conducting differential expression analysis and mapping of NFATs. The hazard ratios (HRs) were computed along with their respective 95% confidence intervals and log‐rank p values. The online platform Kaplan–Meier plotter (http://kmplot.com/analysis/) was frequently employed to assess the prognostic significance of NFATs in LUAD patients.

2.2. Clinical Specimens

During the period from December 2017 to September 2019, specimens were obtained from a cohort of 100 LUAD patients who had undergone surgical resection at the Second Affiliated Hospital of Chongqing Medical University. Two wax blocks for tissue microarray were produced using a tissue microarrayer (Leica, Germany) from LUAD tissues and adjacent tissues, which possessed corresponding clinicopathological features and follow‐up data. The Ethics Committee of the Second Affiliated Hospital of Chongqing Medical University has thoroughly reviewed and approved this study (Approval No. 2021–647).

2.3. Immunohistochemistry

The IHC kit (PV‐9001, ZSBG‐BIO) was employed to perform pathological staining follow the guidelines provided by the manufacturer. Images were captured using an Evos FL Color Imaging System (Thermo Fisher Scientific, USA). Knowledgeable pathologists who had no access to the patient's information performed histopathological evaluation on the basis of the immunoreactive score (IRS). The patients were divided into the NFATc4 low‐expression group (IRS 0–6, n = 32) and high‐expression group (IRS 8–12, n = 68). Detailed information can be found in Doc S1.

2.4. Multiplex Immunohistochemistry Staining (mIHC)

The PANO Multiplex IHC kit (#10080100100, Panovue, China) was employed to perform mIHC staining in line with the guidelines provided by the manufacturer. Primary antibodies were used in the following manner: NFATc4 (1:200, ab99431, Abcam), CCNB1 (1:250, ab32053, Abcam), and CDK1 (1:250, ab133327, Abcam). The DAPI dye was used to stain the nuclei afterwards The Mantra System (PerkinElmer) was utilized for scanning each slide, and the analysis of multispectral images was performed using InForm software 2.4.8.

2.5. Cell Culture

The A549 and PC‐9 cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). PC‐9 and A549 were cultured in RPMI 1640 (Gibco, #31800022, Grand Island) and DMEM/F‐12 (Gibco, #11330032, Grand Island), respectively. All cultured media contained 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were maintained in a constant temperature incubator set at 37°C and 5% CO₂.

2.6. NFATc4‐shRNA Interference Experiment

NFATc4‐short hairpin RNA (shRNA) and negative control shRNA were synthesized by Hanbio Biotechnology Co. Ltd. (Shanghai, China). The sequences used were 5’‐CTTGCGAAACTCCTTACCTAT‐3′ for NFATc4‐shRNA and 5’‐TTCTCCGAACGTGTCACGTAA‐3′ for the negative control. Detailed information can be found in Doc S1.

2.7. Plasmid Transfection

The CCNB1 overexpression and empty control plasmids were constructed using the pcDNA3.1(+) plasmid from Shanghai Sangon Biotechnology Co., LTD. Cells were cultured in 6‐well plates and then transfected with Lipo3000. Each group was then treated with Lipo3000 and cultivated in a serum‐free basal medium.

2.8. Western‐Blot

The lysates were subsequently subjected to SDS‐PAGE for separation and then transferred onto PVDF membranes. Following this, the membranes were incubated with skim milk powder, then subjected to overnight incubation at 4°C with primary rabbit antibodies against NFATc4 (1:5000, ab99431, Abcam), CCNB1 (1:5000, ab32053, Abcam), CDK1 (1:5000, ab133327, Abcam), and β‐tubulin (1:5000, 10,094‐1‐AP, Proteintech). The membranes were then exposed to secondary rabbit antibodies (1:5000, SA00001‐2, Proteintech). The images were captured and analyzed utilizing a Vilber Fusion imaging system (Fusion FX5 Spectra, France).

2.9. DNA Synthesis Assay

The commercially available kits from Beyotime were used for conducting the EdU staining. Evos FL color Imaging system was used to capture images, whereas ImageJ was employed to quantify positively stained cells in three fields of view that were chosen at random per group across three independent experiments.

2.10. CCK‐8

The cell proliferation was measured using the CCK‐8 assay kit (Dojindo Laboratories, Kumamoto, Japan). The SpectraMax 190 microplate reader was used for measuring the absorbance (OD) value at 450 nm.

2.11. Apoptosis and Cell Cycle Assay

The technique of flow cytometry was employed to assess cellular apoptosis and cell cycle. Apoptosis was quantified using Annexin V‐APC/PIPC5.5 staining (Beckman Coulter #A23204). Cell suspensions were co‐stained with Annexin V‐APC (Ex/Em 633/660 nm) and PIPC5.5 (Ex/Em 488/695 nm) for 15 min at RT in the dark. Samples were immediately analyzed on a CytoFLEX LX flow cytometer (Beckman Coulter) equipped with 488 nm and 638 nm lasers, using FL1 (690/50 nm) for PIPC5.5 and FL6 (660/10 nm) for APC. Apoptotic populations were discriminated using Kaluza v2.1 software with fluorescence‐minus‐one controls. For cell cycle analysis, ethanol‐fixed cells were treated with RNase A (#EN0531, Thermo) and propidium iodide (#P4170, Sigma) before acquisition. Data processing utilized doublet discrimination and Watson pragmatic modeling (FlowJo v7.6.1, USA).

2.12. TUNEL

Paraffin‐embedded sections of subcutaneous tumors were dewaxed and rehydrated. The TUNEL assay (Beyotime Biotechnology, China) procedure was conducted according to the manufacturer's instructions. The slides were visualized using fluorescence microscopy (Olympus Corporation, Japan).

2.13. Luciferase Assay

The binding of NFATc4 to the CCNB1 promoter was assessed using a commercially available luciferase reporter assay kit (Promega, Madison, WI, USA). Detailed information can be found in Doc S1.

2.14. RNA‐Seq

The construction of the cDNA library and the sequencing process were carried out by Sinotech Genomics Co. Ltd. (Shanghai, China). The abundance of genes was quantified using the FPKM reads mapped metric. StringTie software was utilized to quantify gene fragments, and normalization was carried out using the TMM algorithm. The R package edgeR was employed for conducting the analysis of mRNA differential expression. Relevantly expressed RNAs that exhibit a |log2(FC)| value greater than 1 and a q value less than 0.05, indicating significant modulation, were chosen for subsequent analysis. The R package enrich (version 3.4.3) was utilized to conduct GO analysis while also conducting KEGG pathway analysis.

2.15. Subcutaneous Xenograft Model

The study utilized 6‐week‐old nude mice, which were obtained from Hunan SJA Laboratory Animal Co. Ltd. Two groups, each containing four mice, were subcutaneously injected with 2 × 10⁶ cells suspended in PBS. The tumor's length was measured as the longest diameter, its width as the shortest diameter perpendicular to the length, and the formula: 0.5 × width² × length was used to calculate its volume.

2.16. Statistical Analysis

All data are presented as mean ± SD for three independent experiments. The t‐test was used to compare the data between the two groups, whereas the one‐way ANOVA was employed for multiple comparisons. p < 0.05 was considered to be statistically significant. Detailed information can be found in Doc S1.

3. Results

3.1. NFATc4 Is Upregulated in LUAD and Related to Negative Prognosis

We first analyzed gene expression using the LUAD dataset from TCGA. The expression level of NFATc4 was significantly upregulated in tumor tissues compared to normal tissues (Figure 1A ), whereas other NFAT family members showed downregulation (Figure S1A–D). We then used Kaplan–Meier analysis to evaluated the prognostic significance of NFATs expression. The results showed that high NFATc4 expression correlated with reduced overall survival (OS) and progression‐free survival (PFS), whereas elevated NFATc1/NFAT5 levels predicted better prognosis. NFATc2/c3 showed no significant OS association (Figure 1B,C; S1E–H). These results establish NFATc4's distinct pro‐tumorigenic role in LUAD compared to other family members. To further substantiate our findings, we performed IHC using a tissue microarray of 100 paired LUAD tissues and their adjacent nontumorous tissues, and then conducted a correlational analysis between NFATc4 expression and OS in samples. The findings indicated that the high expression of LUAD patients showed a strong association with a decreased OS (HR = 2.917; 95% CI, 1.537–5.538; p = 0.0036) (Figure 1D). As depicted in Figure 1E, the expression of NFATc4 in tumor tissues exhibited a significantly elevated magnitude compared to that observed in corresponding adjacent tissues (Figure 1E,F). Furthermore, immunofluorescence localized NFATc4 in both cytoplasmic and nuclear compartments within tumor transition zones, indicating active nuclear translocation (Figure 1G).

FIGURE 1.

NFATc4 is upregulated in LUAD and related to poor prognosis. (A) NFATc4 expression levels in normal lung tissues (left, n = 59) and LUAD tissues (right, n = 517) on the basis of TCGA data. Statistical analysis (one‐way ANOVA). (B‐C) The K‐M analysis of OS and PFS for LUAD patients according to NFATc4 levels. The K‐M plots were generated by Kaplan–Meier Plotter. (D) K‐M curves indicating the OS of LUAD patients with high or low NFATc4 expression (n = 100, p = 0.0036, log‐rank test). (E) Representative images of IHC of NFATc4 expression in LUAD and corresponding adjacent tissues. Original magnification, 100× (up) or 200× (down). (F) The IRS of NFATc4 expression in LUAD tumorous tissues (T) and adjacent nontumorous tissues (N) (n = 100, student's t‐test). (G) Representative immunofluorescence localization image of NFATc4 in tumor cells in the transition zone. (***p < 0.001, **p < 0.01, ns p > 0.05 non‐significant).

3.2. NFATc4 Is an Unfavorable Prognostic Indicator and Correlated With the Advanced Pathological Stages of LUAD

The classification and clinical staging of tumor node metastasis (TNM) provides a crucial assessment of cancer severity and malignancy [21]. To determine the significance of NFATc4 overexpression in the malignant progression of LUAD, the correlation between NFATc4 levels and clinicopathological characteristics was assessed in 100 samples. Statistical analysis indicated that high NFATc4 levels were closely related to lymph node metastasis (LNM) (p = 0.016) and advanced clinical stage (p = 0.035) (Table 1). The level of NFATc4 protein was increased in tumor tissues compared to normal tissues, and it exhibited a gradual increase with the progression of tumor stage (Figure 2A,B). Furthermore, in patients without LNM or with clinical stage I and II, high NFATc4 expression was significantly related to poor prognosis (p = 0.0282, p = 0.0157). The difference, however, did not reach statistical significance in individuals who present with LNM (p = 0.4665) (Figure S2A–C). To further confirm the predictive potential of NFATc4 for OS in patients with LUAD, we conducted univariate Cox analysis, which showed that NFATc4 expression (HR = 0.444; 95% CI = 0.204–0.970; p = 0.042), M classification (HR = 0.121; 95% CI = 0.041–0.351; p < 0.001), and LNM (HR = 0.425; 95% CI = 0.225–0.805; p = 0.009) were considered significant prognostic factors associated with poor OS in LUAD patients. (Figure 2C). However, multivariate Cox analysis demonstrated that clinical stage (HR = 0.428; 95% CI = 0.190–0.962; p = 0.040) and M classification (HR = 0.158; 95% CI = 0.045–0.557; p = 0.004) were independent prognostic factors in LUAD patients, whereas NFATc4 expression was not (Figure 2D). These results imply that NFATc4 facilitates the LUAD malignant progression and has the potential to predict patient prognosis.

TABLE 1.

The relationship between NFATc4 expression and clinicopathological features of LUAD patients.

Characteristics	n	NFATc4 expression		χ2	p
		High	Low
Age
< 60	44	26	18	2.866	0.091
≥ 60	56	42	14
Gender
Male	49	36	13	1.321	0.250
Female	51	32	19
Lymph node metastasis
Negative	68	41	27	5.799	0.016
Positive	32	27	5
T stage
T1	47	29	18	5.064	0.167
T2	29	19	10
T3	16	12	4
T4	8	8	0
N stage
N0	68	41	27	6.627	0.036
N1	26	21	5
N2	6	6	0
M stage
M0	96	64	32	1.961	0.161
M1	4	4	0
Clinical staging
I	64	42	22	8.584	0.035
II	22	12	10
III	9	9	0
IV	5	5	0

Note: The correlation analysis between NFATc4 expression and clinicopathological characteristics of patients in LUAD. The tumor TNM stage was on the basis of American Joint Committee on Cancer. The bold values highlight statistically significant associations (P < 0.05).

FIGURE 2.

The clinical relevance and prognostic value of NFATc4 expression in LUAD samples. (A) Representative IHC staining images of NFATc4 expression in different TNM stages and normal tissues of LUAD. Original magnification, 100× (left) or 200× (right). (B) The IRS of NFATc4 expression in different TNM stages and normal tissues of LUAD one‐way ANOVA and Tukey's multiple comparison correction were used for statistical analysis. (C) Univariate and (D) multivariate Cox analyses of NFATc4 in LUAD patients. (***p < 0.001, **p < 0.01, *p < 0.05, ns p > 0.05 non‐significant).

3.3. Knocking Down NFATc4 Had Negative Effects on the Viability and Proliferation of LUAD Cells

To further evaluate whether the elevated expression of NFATc4 is linked to the development of LUAD, we transfected A549 and PC‐9 cells with Lv‐shNFATc4 or Lv‐shNC to generate NFATc4 knockdown A549‐KD and PC9‐KD cell lines, as well as negative control A549‐NC and PC9‐NC cell lines. The infection efficiency was subsequently verified the efficiency through WB and cytofluorometry (Figure 3A,B; S3A). We then examined the impact of NFATc4 on the in vitro proliferation of LUAD cells. The CCK‐8 assay revealed that knockdown of NFATc4 led to a notable inhibition of proliferation in both cell lines compared to the Lv‐shNC cells (Figure 3C), and the EdU staining demonstrated that NFATc4 knockdown weakened the proliferation ability of LUAD cell lines (Figure 3D,E). Moreover, the biological function of NFATc4 in vivo was validated using a subcutaneous xenograft model. Reaffirming the findings from in vitro experiments, NFATc4 knockdown resulted in a remarkable reduction in tumor growth compared to the control group (Figure 3F–HS,3B). Additionally, IHC assays confirmed that knockdown of NFATc4 led to decreased Ki67 and PCNA expression, indicating inhibited cell proliferation (Figure 3I). These observations suggest that NFATc4 contributes to the viability and proliferation of LUAD cells both in vitro and in vivo, which is essential for the development of LUAD.

FIGURE 3.

NFATc4 depletion had negative effects on the viability and proliferation of LUAD cells. (A) The efficacy of Lv‐shNFATc4 for knock‐down in A549 and PC‐9 was determined via western‐blot. (B) B‐tublin was used as a loading control (n = 3). (C) CCK‐8 assay was performed to determine the proliferation of A549 and PC‐9 transfected with scramble (sh‐NC) or shRNA NFATc4 (n = 3). (D) EdU assays were used to detect the proliferation rate of A549 and PC‐9 after Lv‐shNFATc4 knockdown. (E) Columns are the average of three independent experiments (n = 5). (F) A549‐shNFATc4 and A549‐shNC cells were injected subcutaneously into nude mice according to groups and animals were continued to feed for 4 weeks. (G) Tumor weights and (H) tumor volumes in each group were shown. The tumor volumes were measured by caliper and estimated (0.5 × width² × length) (n = 4). (I) Representative images of PCNA and Ki67 staining in the subcutaneous tumors. (J) Statistical analysis of PCNA and Ki67 IHC scores (n = 3). The data represent the mean ± SD from three independent experiments. (student's t‐test, ***p < 0.001, **p < 0.01, *p < 0.05, ns p > 0.05 non‐significant).

3.4. NFATc4 Knockdown Induced LUAD Cells Apoptosis and G2/M Arrest

The results of flow cytometry showed that the inhibition of NFATc4 resulted in a significant arrest of the cell cycle at the G2/M phase (Figure 4A,B). Notably, we found that cells successfully infected with Lv‐shNFATc4 exhibited proliferation inhibition as early as the second day and gradually died over a week during the culture of LUAD cells. Therefore, flow cytometry was also used to evaluate its effect on apoptosis. The proportion of apoptotic cells in NFATc4 knockdown A549 and PC‐9 cells was higher than in the Lv‐shNC group (Figure 4C,D). Apoptosis in subcutaneous tumors was measured using the TUNEL assay, which labels apoptotic nuclei with a fluorescent dye. Consistent with the findings observed above, there was an increased number of apoptotic cells in the NFATc4 knockdown group, highlighting the involvement of NFATc4 in pro‐tumorigenic effects in vivo (Figure 4E,F). Our results demonstrate that downregulating NFATc4 suppresses G2/M transition and induces apoptosis in LUAD cells.

FIGURE 4.

NFATc4 knockdown induced apoptosis and G2/M arrest.

(A) The cell cycle distribution was analyzed by flow cytometry and (B) bar charts showed below depicted the percentages of cell cycle distribution. (C‐D) Apoptosis assay was performed by flow cytometry to determine the effect of NFATc4 downregulation on apoptosis. (E) The apoptosis of subcutaneous tumors was detected by tunel assay. (F) Statistical analysis of subcutaneous tumors apoptosis (400×). The data represent the mean ± SD from three independent experiments. (n = 3, student's t‐test, **p < 0.01, *p < 0.05, ns p > 0.05 non‐significant).

3.5. NFATc4 Promotes LUAD Development by Regulating CCNB1

To clarify the molecular mechanisms underlying the advancement of LUAD via NFATc4, we conducted gene expression profiling using RNA‐seq in four groups (A549‐NC, A549‐KD, PC9‐NC and PC9‐KD) to assess its impact on the transcriptome. As a result, in A549 and PC‐9 cells, a total of 1338 and 2431 genes were differentially expressed, respectively. The Venn diagrams reveal that among the 244 overlapping target genes in the four groups, 56 genes were downregulated, whereas 188 genes were upregulated in both A549 and PC‐9 (Figure 5A). Gene Ontology (GO) analysis of differentially expressed genes (DEGs) unveiled that cellular processes were significantly enriched in biological processes, consistent with the in vitro effects of NFATc4 (Figure S4). On the basis of these findings, we focused on DEGs crucial for the cell cycle and apoptosis, such as CDK1, CCNB1, BUB1B, RAMP1, and TRAF1 (Figure 5B). As shown in the heatmap, CCNB1 and CDK1 were downregulated DEGs in both A549 and PC‐9 cells with NFATc4 knockdown and had the highest gene expression values among the aforementioned genes (Figure 5C). Additionally, the KEGG analysis of DEGs shared by both cell lines identified the top 10 enriched pathways, with the p53 pathway having the highest enrichment score, and three other pathways were all closely related to cell proliferation and apoptosis (Figure 5D). It has been reported that CCNB1 regulates the activity of CDK1 to affect the cell cycle, and CCNB1 depletion leads to cell apoptosis [16, 22]. Therefore, the expression of CCNB1 and CDK1 was examined to further investigate their association with NFATc4. The mIHC results indicated that the levels of CCNB1 and CDK1 in LUAD tissues exhibited a positive correlation with the expression of NFATc4, and the localization of NFATc4 expression was more obvious in the nucleus, suggesting a more pronounced role in this area (Figure 5E). Furthermore, as a transcription factor, NFATc4 may regulate CCNB1 expression through its binding potential to the CCNB1 promoter. The direct regulation of CCNB1 by NFATc4 was confirmed through a luciferase reporter assay. The findings indicated that the activity of the CCNB1 promoter luciferase reporter was significantly enhanced by NFATc4 (Figure 5F). Combined with these results, we identified that NFATc4 may promote LUAD progression by directly regulating CCNB1 transcription, thereby influencing the cell cycle.

FIGURE 5.

NFATc4 promotes LUAD development by regulating CCNB1. (A) Venn diagram representing RNA‐seq results. Four groups were established according to whether downregulated by Lv‐shNFATc4 or not and they are A549‐NC, A549‐KD, PC9‐NC, and PC9‐KD. 3464 genes were spotted among them. (B) Volcano plot of DEGs following NFATc4 knockdown in LUAD A549 and PC‐9 cells (false discovery rate [FDR] < 0.05). The cell cycle genes (blue) and apoptosis genes (red) were highlighted. (C) Heatmap illustration of common cell cycle genes involved in G2/M phases following NFATc4 knockdown in LUAD A549 and PC‐9. Downregulated genes were shown in blue and upregulated genes in red. The genes were ranked by fold change. (D) Enriched KEGG pathway analysis of common DEGs in A549 and PC‐9 showed the top 10 pathways. The pathways closely related to cell cycle and apoptosis were highlighted. (E) MIHC of LUAD sections of the low‐ (upper panel) or high‐ (lower panel) NFATc4 group. NFATc4+ (yellow), CCNB1+ (green), and CDK1+ (red). (F) Histograms displaying the quantitative data of CCNB1+ and CDK1+ cells in NFATc4‐low and NFATc4‐high group (n = 3, student's t‐test). (G) Activity of CCNB1 promoter luciferase reporter was significantly enhanced by NFATc4. One‐way ANOVA and Tukey's multiple comparison correction were used for statistical analysis. All the experiments were repeated 3 times (n = 3). (mean ± SD, ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05, ns p > 0.05, not significant).

3.6. Downregulating NFATc4 Suppresses G2/M Transition in LUAD Cells via the CCNB1/CDK1 Pathway

In view of the above results, we further investigated whether overexpression of CCNB1 in LUAD cells could rescue the cell cycle arrest and apoptosis caused by the depletion of NFATc4. Compared to the NFATc4 knockdown group, the expressions of CCNB1 and CDK1 were markedly increased in pcDNA3.1‐CCNB1 transfected cells, whereas the NFATc4 expression remained significantly downregulated. NFATc4 knockdown markedly suppressed the phosphorylation of CDK1. Subsequent CCNB1 overexpression partially restored CDK1 phosphorylation; however, this effect lacked statistical significance (Figure 6A,B). Similarly, flow cytometry analysis showed that the G2/M phase arrest induced by NFATc4 knockdown was largely alleviated when CCNB1 was overexpressed in LUAD cells (Figure 6C,D). However, the apoptosis rate in the NFATc4‐knockdown + CCNB1 overexpression group was not rescued (Figure 6E,F). These data indicate that NFATc4 has a significant impact on LUAD cell cycle regulation and that downregulating NFATc4 suppresses G2/M transition in LUAD cells via the CCNB1/CDK1 pathway.

FIGURE 6.

Downregulating NFATc4 suppresses G2/M transition in LUAD cells via the CCNB1/CDK1 pathway. (A) WB analysis of CDK1, CyclinB1 in NFATc4 knockdown cells, and NFATc4 knockdown + CCNB1 overexpression cells. (B) Statistical analysis of results in A. (C) The cell cycle distribution was analyzed by flow cytometry. G2/M arrest was presented when NFATc4 was downregulated. However, when we overexpress CCNB1 at this basis G2/M arrest was rescued. (D) Bar charts showed depicted the percentages of cell cycle distribution. (E) Flow cytometry was performed to determine the effect of shNFATc4 and shNFATc4‐CCNB1 on apoptosis. The apoptosis rates in both shNFATc4 cell lines were increased but overexpress CCNB1 at this basis failed to rescue the apoptosis status. One‐way ANOVA and Tukey's multiple comparison correction were used for statistical analysis. The data represent the mean ± SD from three independent experiments. (n = 3, ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05, ns p > 0.05, not significant).

4. Discussion

Transcription factors play a crucial role in LUAD proliferation, invasion, migration, trans‐differentiation, and drug resistance because of their pivotal positions in multiple signal transduction pathways, which coordinate gene expression programs and ultimately lead to changes in cellular behavior [23]. Increasing studies have focused on the role of the transcription factor NFATc4 in tumor development and drug resistance [7]. When intracellular calcium levels rise, activated calcineurin dephosphorylates NFATc4 and promotes its nuclear translocation, leading to changes in cellular behavior by regulating the transcription of target genes [24]. Although bioinformatics analyses suggest that NFATc4 is highly expressed in lung cancer and related to the radioprotective effect on lung cancer cells, its specific role in tumorigenesis and progression remains largely unexplored [25, 26]. In this study, we first present an analysis of both public databases and our 100 samples regarding the relationship between NFATc4 and LUAD. The results showed that NFATc4 expression was significantly higher in LUAD tissues compared to normal tissues, and the NFATc4 expression level was negatively correlated with prognosis and OS. Similar to observations in breast cancer and skin‐derived malignancies, NFATc4 was found to be overexpressed, and high NFATc4 levels indicated poor outcomes in patients [7, 8]. Notably, NFATc4 levels were significantly associated with clinical stage, showing a gradual increase as the stage progressed in our clinical cohort, indicating a tumor‐promoting role in LUAD.

Emerging evidence suggests that NFATc4 has a dual function, acting either as an oncogene or a tumor suppressor during tumor progression, depending on the specific cell and tissue types evaluated [7]. Our results showed that NFATc4 contributes to the viability and proliferation of LUAD cells both in vitro and in vivo. Inhibition of NFATc4 expression significantly promoted G2/M phase arrest in LUAD cells in vitro. Consistent with our findings, previous studies have demonstrated that NFATc4 regulates cell proliferation and tumor growth in breast cancer, ovarian cancer, and schwannoma [7]. Specifically, NFATc4 inhibited cell growth by arresting cells in the G0 phase in quiescent ovarian cancer stem‐like cells [12]. Other NFAT proteins have also been shown to regulate genes associated with the cell cycle, differentiation, and apoptosis in various cell types [27]. These results implicate the NFAT family of transcription factors as regulators of tumorigenesis and tumor growth, supporting a critical role for NFATc4 in promoting LUAD progression.

In addition to inhibiting proliferation, apoptosis was also observed in LUAD cells following NFATc4 knockdown. This result was further confirmed by RNA‐seq that KEGG analysis of DEGs revealed significant enrichment in cell cycle‐related and apoptosis pathways, in which the P53 and TNF signaling pathways have been shown to orchestrate numerous cellular responses in various tumors, particularly in cell cycle arrest and cell death [28, 29]. Additionally, we observed that downregulated CCNB1 and CDK1 had the highest gene expression values among the genes critical for cell cycle regulation and apoptosis. MIHC and luciferase reporter assay further confirmed that NFATc4 was positively correlated with CCNB1 and CDK1 expression, and that NFATc4 could directly bind to the promoter region of CCNB1. CCNB1 plays a crucial role in regulating the transition from G2 to mitosis in the cell cycle by forming a complex with CDK1, and it regulates the enzymatic activity of CDK1, thereby influencing the cyclic regulation of CDK1 [16, 17].

The regulation of mitotic events is associated with the formation and activity of the nuclear CCNB1‐CDK1 complex, which requires the regulation of multiple transcription factors at various levels [30]. We performed a functional rescue experiment to verify NFATc4's role in modulating cell growth and found that CCNB1 and CDK1 expression increased in NFATc4‐knockdown+CCNB1‐overexpression cells, whereas NFATc4 protein expression remained inhibited. Moreover, the G2/M phase arrest caused by NFATc4 downregulation was partially rescued by CCNB1 overexpression in LUAD cells. In contrast, CCNB1 overexpression failed to reverse the apoptosis induced by NFATc4 knockdown. Apoptosis is a complex process regulated by various factors, including apoptosis‐related proteins. Studies have shown that the nuclear translocation of NFAT, particularly NFATc3/4, regulates the expression of downstream apoptosis‐related proteins such as caspase3 and Bax through the FasL/Fas apoptosis pathway or other mechanisms, thereby inducing or preventing apoptosis [31, 32, 33]. The enrichment pathway analysis of the present study indicated that the P53 signaling pathway exhibited the highest enrichment score after NFATc4 knockdown, which is known to play a crucial role in apoptosis regulation. This may contribute to the failure of overexpression of CCNB1 to rescue apoptosis under knockdown of NFATc4 [34]. Additionally, the G2/M transition requires CDK1 phosphorylation of a wide variety of proteins, but the induction of apoptosis requires lower levels of CDK1 activity and a more rapid response [35]. These findings may explain the inability of CCNB1 upregulation to reverse apoptosis. Notably, the apoptosis rate of A549 showed little change after CCNB1 overexpression, whereas apoptosis increased in PC‐9. This may be because of their differing genetic backgrounds, as A549 harbors a KRAS mutation, whereas PC‐9 carries an EGFR mutation. Previous studies have reported higher rates of apoptosis in EGFR‐mutant LUAD patients [36]. Knocking down NFATc4 may further amplify this distinction. Nevertheless, the correlation between NFATc4 and gene mutations in LUAD requires further investigation.

Despite the present study confirming that NFATc4 is a key regulator of the cell cycle and apoptosis in LUAD, several limitations should be noted. First, additional advanced clinical samples are needed to verify the predictive value of NFATc4 as a prognostic indicator in LUAD and reduce bias. Second, the specific molecular mechanism by which NFATc4 directly binds to CCNB1 to regulate the CCNB1/CDK1 pathway requires further in‐depth exploration. Finally, whereas this study focused on the direct regulation of cell viability and proliferation in LUAD, NFATc4, positioned at the center of multiple signal transduction cascades leading to changes in cell behavior, warrants more comprehensive investigation.

In conclusion, by combining clinical and experimental aspects, we demonstrate that LUAD with high NFATc4 expression tends to exhibit malignant pathological features and poor prognosis. Moreover, we identify NFATc4 as an oncogene in LUAD, and it promotes the viability and proliferation of LUAD cells by regulating the CCNB1/CDK1 pathway. These general phenotypes provide a basis for further studies.

Author Contributions

Wendi Yang: data curation, formal analysis, methodology, writing – original draft, writing – review and editing. Xue Wu: formal analysis, investigation, writing – original draft. Fanghao Cai: investigation, software. Zhengjun Guo: resources, validation. Zaicheng Xu: investigation, visualization. Yuan Peng: resources, validation. Zhenzhou Yang: conceptualization, funding acquisition, supervision. Xiaoyue Zhang: conceptualization, funding acquisition, project administration, writing – review and editing.

Ethics Statement

The animal experiments received approval from Animal experimental ethical inspection of the Second Affiliated Hospital of Chongqing Medical University. The research procedures involving human participants have adhered to the ethical standards of the institution and/or the National Research Council, as well as those outlined in the 1964 Declaration of Helsinki and its subsequent amendments or similar ethical guidelines. Informed consent has been obtained from all individuals participating in the study.

Approval of the research protocol by an Institutional Review Board: N/A.

Informed Consent: N/A.

Registry and the Registration No. of the study/trial: N/A.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Appendix S1. Materials and methods.

Figure S1. Gene expression analysis and Kaplan–Meier survival analysis of NFATs in LUAD.

Figure S2. The effect of NFATc4 expression on the prognosis of LUAD patients.

Figure S3. Depletion of NFATc4 inhibits proliferation of LUAD cells.

Figure S4. GO classification of common DEGs in A549 and PC‐9.