Evaluating the potential of GSPT2 and CIRBP as biomarkers in endometrial cancer: Multicenter RT-PCR and IHC study

Abstract

Endometrial cancer (EC) is a prevalent gynecological malignancy that imposes significant health and economic burden on women worldwide. The aim of this study was to investigate the expression levels of G1 to S phase transition 2 (GSPT2) and cold-inducible RNA-binding protein (CIRBP) in endometrial cancer tissues relative to normal endometrial tissues and to evaluate their potential as biomarkers for diagnosis and prognosis. We conducted a prospective analysis involving RNA extraction, real-time polymerase chain reaction (RT-PCR), and immunohistochemistry (IHC) to assess gene expression and protein localization. Our findings revealed that GSPT2 was significantly overexpressed (t = 2.754, P = .008611), whereas CIRBP was underexpressed (t = 3.344, P = .001647) in EC tissues. Survival analysis demonstrated that high GSPT2 expression correlated with poor overall survival (OS) (P < .0001), in contrast to high CIRBP expression, which was associated with improved OS (P < .0001). Additionally, GSPT2 expression was positively correlated with aggressive pathological features, including higher tumor grading and International Federation of Gynecology and Obstetrics (FIGO) staging, Lymphovascular Space Invasion (LVSI) (P < .05), while CIRBP showed negative correlations with these characteristics (P < .05). These results underscored that high GSPT2 expression should be closely associated with EC progression and poor prognostic, while CIRBP exert a protective effect. The potential of GSPT2 as a poor prognostic marker and CIRBP as a favorable prognostic marker suggest their utility in guiding treatment decisions. Despite limitations such as a relatively small sample size and the lack of functional experiments, our study highlights GSPT2 and CIRBP as promising biomarkers for early diagnosis and targeted therapy in endometrial cancer. Future research should focus on larger cohorts and functional validations to further elucidate the roles of these biomarkers in clinical practice and personalized medicine approaches.

1. Introduction

The prognosis of early-stage endometrial cancer (EC) is favorable, but there is no significant improvement in the prognosis of patients with advanced or recurrent disease.^[1,2] The incidence and mortality rates of endometrial cancer are increasing globally, with a trend of younger patients being affected. The traditional pathological classification and risk stratification have limitations, while the emergence of molecular classification has addressed some of these shortcomings.^[2–5] However, there are still cases where the clinical classification does not align with the prognosis.^[6] Therefore, it is crucial to identify more prognosis-related molecules based on the molecular classification of endometrial cancer to develop individualized and precise treatment strategies.

In a previous study, GSPT2 and cold-inducible RNA-binding protein (CIRBP) were identified as key prognostic genes in EC through integrated analysis of many databases.^[7] GSPT2 is a GTP-binding protein that regulates the cell cycle and promotes tumor formation, and has been studied in various cancers such as liver cancer, gastric cancer, colorectal cancer, prostate cancer, and breast cancer, functioning as an oncogene,^[8–11] but its role in endometrial cancer is limited. CIRBP is a cold shock protein that is involved in various cellular processes and is linked to cancer progression. Investigating the expression levels of these proteins in endometrial tissues may provide valuable insights.^[12,13]

This study uses a prospective controlled and retrospective cohort clinical studies design, employing RNA extraction, real-time polymerase chain reaction (RT-PCR), and immunohistochemical (IHC) to compare the expression levels of GSPT2 and CIRBP in EC and normal endometrial tissues. The aim is to elucidate the potential prognostic significance of these biomarkers in endometrial cancer and their correlation with various clinical parameters.^[14,15]

This research has 2 main objectives: to evaluate the expression patterns of GSPT2 and CIRBP in endometrial cancer tissues and normal controls, and to assess their associations with key clinicopathological characteristics and patient prognosis. This study could lead to improved diagnostic and therapeutic strategies and enhance patient care and survival rates.^[16]

In summary, this study will provide new insights into the roles of GSPT2 and CIRBP in EC and may offer new biomarkers for improving patient prognosis, paving new directions for future research and treatment.

2. Materials and methods

2.1. Materials

We conducted a prospective study to collect 30 pairs of fresh frozen EC and normal endometrial tissues from Beijing Obstetrics and Gynecology Hospital and Beijing Tongren Hospital since April 2024. Additionally, for research purposes, we conducted both case–control study and retrospective cohort study involving 96 patients with normal endometrial tissue and 331 patients with EC, all surgically diagnosed between January 1, 2016, and December 30, 2018. The EC patients’ ages ranged from 34 to 72 years, with an average age of (56.73 ± 10.13) years. Clinical information and follow-up records, including pathological type, menopausal status, International Federation of Gynecology and Obstetrics (FIGO) stage, histological grade, depth of myometrial invasion, and lymph node metastasis, were collected. Using a random number table, samples of normal endometrial tissue were selected from patients who underwent diagnostic curettage during the same period. These patients’ ages ranged from 33 to 70 years, with an average age of (52.68 ± 10.13) years. There was no statistically significant difference in age between the EC patients and the control group (t = 1.478, P = .349). This research conformed to the Declaration of Helsinki. Written consent was obtained from all participants. And this experiment was approved by the ethics committee of the Beijing Obstetrics and Gynecology Hospital and Beijing Tongren Hospital, Capital Medical University (No. 2024-KY-037-01). The specific research approach for this topic is shown in Figure 1.

Figure 1.

The specific research approach for this topic (Graphic abstract).

2.2. Inclusion and exclusion criteria

Inclusion criteria included: Patients who underwent total hysterectomy. Patients confirmed as having EC by postoperative histopathological examination. Patients who were newly diagnosed and had not received prior treatment. Patients who actively cooperated with treatment and had complete follow-up data.

Exclusion criteria included: Patients with severe abnormalities in the function of organs such as the heart, liver, and kidneys. Patients with coagulation disorders, autoimmune diseases, acute or chronic infections, etc. Patients with other types of tumors. Patients who had received preoperative antineoplastic therapies including endocrine therapy, chemotherapy and radiotherapy. Patients with incomplete clinical and follow-up data or who were lost to follow-up.

2.3. The basis for determining the sample size

The basis for determining the sample size was based on the differential results of bioinformatics analysis of GSPT2 and CIRBP between EC and normal endometrial tissues, as well as the differential results between different stages of EC, across multiple databases. The sample size was calculated using the website: http://www.powerandsamplesize.com.

2.4. Observation indicators and follow-up plan

The content of assessment and follow-up mainly encompasses: survival status, patient complaints, age, gravida and parity, medical comorbidities, family history, tumor markers (serological CA125, CA199, CEA, etc), as well as pathological information (the grading, FIGO staging, muscle-invasive, cervical infiltration, accessory, cancer embolus, distant metastasis of endometrial carcinoma, etc). When recurrence is suspected, tumor markers and imaging examinations should be completed, and histopathological examination should be performed if necessary. In the event of recurrence or metastasis, the time of occurrence, as well as the specific site of uncontrolled disease, recurrence, or metastasis, and an accurate assessment of the condition should be clarified. If death occurs, the time and cause of death should be determined. The duration of follow-up is from the time of postoperative onset to the first imaging-confirmed disease progression, an increase in tumor markers compared to the previous level, or death, whichever occurs first.

2.5. Methods for controlling selection bias

Researchers should thoroughly understand the various potential sources of selection bias in their research work and strive to avoid them during the research design process. They should strictly adhere to the inclusion and exclusion criteria for study subjects to ensure that the study population can well represent the population from which they are drawn.

To avoid the influence of survival factors, when conducting case–control studies, if newly diagnosed patients are selected for the case group, the control group should not be composed of patients with chronic diseases. If the chronic diseases suffered by the controls severely affect exposure, they should not be used as controls.

2.6. RNA extraction and RT-PCR

We extracted total RNA from EC samples and corresponding adjacent normal samples using RNA Extraction Kit (Sangon, Shanghai, China) (Table 1). Added 1 mL of trizol in 5 to 10 × 10⁶ cells, then placed them at room temperature for 5 minutes. Later we added 0.2 mL of chloroform, mixed them for 15 seconds, and placed them at room temperature for 5 minutes. Followed by centrifugation at 12,000 rpm with low temperature for 15 minutes. After that, the supernatant was added to new tube followed by the addition of an equal volume of isopropanol and mixing for 3 to 5 minutes. Following the mixing for 10 to 20 minutes the mixture was centrifuged at 12,000 rpm with low temperature for 15 minutes. After the supernatant was discarded 75% ethanol was added to wash and centrifuged at 900 rpm at 4°C for 5 minutes. The supernatant was discarded and tube was air dried for 3 to 5 minutes and then 25 µL of DEPC was added. Then we used a spectrophotometer to measure the concentration and purity of the extracted RNA. The mRNA level was assessed following manufacturer’s (Bio-Rad) instructions. Primers are shown in Table 1. All reactions were conducted 3 times. Cycle conditions for the CIRBP gene and GSPT2 gene were as follows: 95°C for 2 minutes and 40 cycles at 95°C for 15 seconds, 60°C for 15 to 30 seconds and 72°C for 30 seconds. An endogenous gene GAPDH was taken as internal control, and the nucleotide sequences for primers are shown in Table 1. The relative mRNA levels were analyzed by the 2ΔΔCT method. Each experiment was performed in triplicate.

Table 1.

Primers for RT-PCR.

Primer	Sequence (5’ to 3’)	Nucleotide count
Homo GSPT2 FORWARD	CCGTTAGTGTCGCTTGAAGGT	21
Homo GSPT2 REVERSE	AGGGTACGATCACAGATTTGGAT	23
Homo CIRBP FORWARD	AGGGCTGAGTTTTGACACCAA	21
Homo CIRBP REVERSE	ACAAACCCAAATCCCCGAGAT	21
Homo GAPDH FORWARD	GGAGCGAGATCCCTCCAAAAT	21
Homo GAPDH REVERSE	GGCTGTTGTCATACTTCTCATGG	23

RT-PCR = real-time polymerase chain reaction.

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{\Delta }\mathrm{\Delta }\mathrm{C}\mathrm{t}=\mathrm{\Delta }\mathrm{C}\mathrm{t}\left(\mathrm{T}\mathrm{a}\mathrm{r}\mathrm{g}\mathrm{e}\mathrm{t}\right)\text{–}\mathrm{\Delta }\mathrm{C}\mathrm{t}\left(\mathrm{R}\mathrm{e}\mathrm{f}\mathrm{e}\mathrm{r}\mathrm{e}\mathrm{n}\mathrm{c}\mathrm{e}\right).}\end{array}}$$

The formula 2^−ΔΔCt was used to determine the relative expression of the CIRBP gene and GSPT2 gene to GAPDH gene.

2.7. Immunohistochemistry

The paraffin was applied to fix and embed EC and normal endometrium tissues. The tissues were into pieces (5 μm) and placed in glass slides. Then the glass slides were rehydrated and deparaffinized via xylene and graded alcohols, respectively. The target retrieval solution was used to immerse the slides for 30 minutes in a water bath. Endogenous peroxidase was neutralized with 6% hydrogen peroxide for 3 minutes. The slides were subjected to heat-induced antigen retrieval using a steamer. Then, they were washed and incubated for 30 minutes at 22°C with a antibody (D601037, Shanghai, China). The samples were then washed off and biotinylated secondary antibodies Anti-GSPT2 rabbit polyclonal antibody (D225946; Shanghai, China) and Anti- CIRBP rabbit polyclonal antibody (D124564; Shanghai, China) were applied to the slides for 25 minutes in a humidity chamber. The slides were again washed and incubated with streptavidin peroxidase for an additional 25 minutes, and then submerged into a 3,3′-diaminobenzidine-etrachloride bath for 5 minutes. Tissues were counterstained with hematoxylin. All slides were examined by light microscopy. Staining for GSPT2 was observed in the cell cytoplasm, in yellowish brown; whereas CIRBP staining was predominately localized to the cell nucleus, in yellowish brown. All sections were analyzed. Intensity of staining was quantified with regards to the ercentage of position marking at high magnification: no marking and <10% (±); 10% −30%(1+); 30 to 50% (2+); and more than 50% (3+). The immunohistochemical results were independently scored by 2 pathologists, and any controversial results were discussed with a third pathology expert to reach a consensus.

2.8. TCGA database

To analyze the expression levels of GSPT2 and CIRBP, as well as their relationship with prognosis, in EC samples from the TCGA using the UALCAN analysis tool (https://ualcan.path.uab.edu/), follow these steps.

2.9. Statistical analysis

Statistical Methods: Statistical analysis was conducted using SPSS 26 software, Image J software and GraphPad Prism software. Quantitative data that conformed to a normal distribution were expressed as mean ± standard deviation (x ± s), and comparisons between groups were performed using the t-test for 2 independent samples. Qualitative data were presented as number of cases (percentage), and comparisons between groups were conducted using the chi-square test or Pearson correlation. Perform multivariable Cox regression analysis and construct a forest plot using the regression coefficients to visualize hazard ratios (HR) with 95% confidence intervals. Survival analysis was performed with overall survival (OS) as the clinical outcome, and Kaplan–Meier survival curves were plotted. Comparisons of survival curves were conducted using the log-rank test. The distribution and expression of each index in EC were represented by chart and heat map. All tests were considered statistically significant at P < .05.

3. Results

3.1. Testing GSPT2 and CIRBP genes expression in fresh EC and normal endometrium tissue by RT-PCT

we collected samples from 30 pairs of fresh EC and normal endometrium tissue. We examined the mRNA expression of GSPT2 and CIRBP from cancerous and adjacent normal tissues using RT-PCR methods. Results showed that the expression of GSPT2 was higher in EC tissues than normal tissues (t = 2.754, P = .008611) (Fig. 2A). However, CIRBP is the opposite (t = 3.344, P = .001647) (Fig. 2B).

Figure 2.

Gene expression of GSPT2 and CIRBP from EC and normal endometrium tissues by RT-PCR. (A) Expression of GSPT2 in EC and normal endometrium tissues. (B) Expression of CIRBP in EC and normal endometrium tissues. Red is tumor; blue is normal endometrium. CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2, RT-PCR = real-time polymerase chain reaction.

3.2. The expression of GSPT2, CIRBP in EC and normal endometrial tissues by IHC

3.2.1. Differences between the expression of GSPT2, CIRBP in EC and normal endometrial tissues

Staining for GSPT2 was observed in the cell cytoplasm, in yellowish brown; whereas CIRBP staining was predominately localized to the cell nucleus, in yellowish brown (Fig. 3A and B). It is evident that the positive expression rate of GSPT2 in EC was significantly higher than that in normal endometrial tissues, but on the contrary, the positive expression rate of CIRBP in EC was significantly lower than that in normal endometrial tissues, the difference were statistically significant (P < .001) (Fig. 3C and D). The staining of GSPT2 were negative in 23 cases EC tissues and 78 cases normal endometrium tissues, however, the expression GSPT2 in 308 cases EC tissues and 18 cases normal endometrium tissues were 1+ to 3+ positive. and the differences were statistically significant (95.05% vs 18%, χ² = 234.2, P < .0001). The staining of CIRBP were negative in 79 cases EC tissues, however, the expression of CIRBP is generally positive in normal endometrium tissues. Additionally, the expression CIRBP in 252 cases EC tissues were 1+ to 3+ positive and 96 cases normal endometrium tissues 2+ to 3+ positive, and the differences were statistically significant (76.13% vs 100%, χ² = 261.5, P < .0001) (Table 2). Finally, receiver operating characteristic (ROC) curve analysis was performed to assess the ability of GSPT2 and CIRBP to distinguish EC from normal tissues and the differences were all statistically significant (P < .001)(Fig. 4A). Their areas under the curve (AUC) are respectively: GSPT2 0.8172 (0.7848–0.8496), sensitivity 0.9305, specificity 0.6754 and CIRBP 0.6895 (0.6486–0.7304), sensitivity 0.7644, specificity 0.6254.

Figure 3.

The expression of GSPT2, CIRBP in EC and normal endometrial tissues by IHC. (A and B) Intensity of GSPT2 and CIRBP expression between EC and normal endometrium tissues in miscoscope. Staining for GSPT2 was observed in the cell cytoplasm, in yellowish brown; CIRBP staining was predominately localized to the cellnucleus, in yellowish brown. GSPT2 In normal endometrium tissue (weakly positive); GSPT2 in EC (strongly positive); CIRBP in normal endometrium tissues (strongly ositive); CIRBP in EC (weakly positive). (C) Expression difference of GSPT2 in between EC and normal endometrium tissues (P < .001); (D) expression difference of GSPT2 in between EC and normal endometrium tissues (P < .001). CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2, IHC = immunohistochemistry.

Table 2.

Expression of GSPT2 and CIRBP in EC and normal endometrium.

	N	GSPT2				Positive rate (%)	CIRBP				Positive rate (%)
		-	1+	2+	3+		-	1+	2+	3+
EC	331	23	105	99	104	95.05	79	122	107	23	76.13
Normal endometrium	96	78	16	2	0	18.75	0	0	12	84	100
χ 2		234.2					261.5
P		<.0001					<.0001

CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2.

Figure 4.

The relation of expression of GSPT2, CIRBP and clinicopathological characteristics of EC. (A) ROC curve analysis and AUC statistics of GSPT2 and CIRBP; (B) correlation of GSPT2 and CIRBP expression in EC tissues; (C) heat map of GSPT2, CIRBP expression and clinicopathological characteristics of EC. CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2.

3.2.2. Correlation of GSPT2 and CIRBP in EC

The expression of GSPT2 and CIRBP in EC tissues exhibits a negative correlation (r = −0.838. P < .001) (Table 3, Fig. 4B).

Table 3.

Correlation of GSPT2 and CIRBP in EC.

GSPT2	N	CIRBP
	331	–	1+	2+	3+
−	23	0	0	11	12
1+	105	0	12	84	9
2+	99	3	86	9	1
3+	104	76	24	3	1
r		−0.838
P		<.001

CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2.

3.2.3. The relation of expression of GSPT2 and CIRBP and clinicopathological characteristics of EC

The relation between the expression of GSPT2, CIRBP and the clinicopathological characteristics of EC is presented in Fig. 4C and Table 4. It was found that the expression level of GSPT2 genes was positively correlated with the grading, FIGO staging, muscle-invasive, cervical infiltration, accessory, Cancer embolus in vessel, LVSI, and distant metastasis of endometrial carcinoma, and the difference was statistically significant (P < .05). Conversely, a high expression of CIRBP protein was negatively correlated with these factors respectively, and the difference was statistically significant (P < .05). However, the patient age, Parametrial metastasis and Abdominal Cavity Metastasis (ACM) had no statistical association with the expression levels of GSPT2 and CIRBP (P > .05).

Table 4.

The relation of expression of GSPT2, CIRBP and clinicopathological characteristics of EC.

	N	GSPT2				r/ P	CRIRBP				r/ P
		−	+	++	+++		−	+	++	+++
Age	331
<45	45	7	18	8	12	0.0389 .4806	10	13	14	8	−0.0317 .5648
45–65	189	11	52	61	65		49	70	57	13
>65	97	5	35	30	27		20	39	36	2
Grading
G1	90	17	46	18	9	0.3764 <.0001	7	22	46	15	−0.3282 .0014
G2	173	6	57	56	54		41	72	54	6
G3	68	0	2	25	41		31	28	7	2
FIGO
I	207	23	96	66	22	0.6573 <.0001	15	70	100	22	−0.6523 <.0001
II	57	0	9	29	19		13	38	6	0
III	53	0	0	4	49		37	14	1	1
IV	14	0	0	0	14		14	0	0	0
Muscle-invasive
0	19	7	12	0	0	0.452 <.0001	0	3	10	6	−0.3917 <.0001
<1/2	210	15	83	66	46		32	75	89	14
>1/2	86	1	10	33	42		35	41	8	2
1	16	0	0	2	16		12	3	0	1
Cervical infiltration
No	215	22	94	60	39	0.458 <.0001	27	68	98	22	−0.4513 <.0001
Yes	116	1	11	39	65		52	54	9	1
Parametrial metastasis
No	298	22	101	94	81	0.0921 .0943	63	112	102	21	−0.1298 .0181
Yes	33	1	4	5	23		16	10	5	2
Accessory
No	303	23	105	97	78	0.3683 <.0001	57	116	107	23	−0.3752 <.0001
Yes	28	0	0	2	26		22	6	0	0
Cancer embolus in vessel
No	249	22	99	76	52	0.4192 <.0001	40	88	101	20	−0.3603
Yes	82	1	6	23	52		39	34	6	3
LVSI
No	293	23	105	94	71	0.4203 <.0001	52	112	107	22	−0.3882 <.0001
Yes	38	0	0	6	32		27	9	1	1
ACM
No	306	21	99	94	92	0.0703 .2029	73	109	102	22	−0.0486 .3781
Yes	25	2	6	5	12		6	12	6	1
Distant metastasis
No	310	23	104	98	85	0.3687 <.0001	60	120	107	23	−0.371 <.0001
Yes	21	0	1	1	19		19	2	0	0

ACM = abdominal cavity metastasis, CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, FIGO = Federation of Gynecology and Obstetrics, G = grading, GSPT2 = G1 to S phase transition 2, LVSI = lymphovascular space invasion.

3.2.4. The relationship between the expression of GSPT2 and CIRBP proteins and prognosis of EC

We performed a multivariable COX regression analysis on the correlation between the patient’s overall survival and the clinical features, GSPT2, and CIRBP. The forest plot shows that GSPT2, cancer embolus in vessels, and FIGO staging are significantly associated with a poor prognosis in patients with EC (P < .05). Their hazard ratios (HR) are all >1. This implies that these factors may accelerate the progression of EC or increase the risk of death. CIRBP showed a trend towards a reduced risk hazard ratio (HR < 1); however, this finding was not statistically significant (P > .05). Its protective role requires further verification through larger sample sizes or more functional studies (Fig. 5). We further analyzed the correlation between the patient’s overall survival and several factors, including GSPT2, CIRBP, FIGO, cancer embolus in the vessel, clinical stage, and LVSI, using survival analysis and the log-rank test. The results indicated that all features were significantly correlated with the patient’s survival, as evidenced by a P value of .05 (Fig. 6A–F).

Figure 5.

Cox regression analysis forest plot.

Figure 6.

The relationship between the expression of GSPT2 and CIRBP proteins and prognosis of EC. (A) Survival curve of GSPT2 in EC patients; (B) survival curve of CIRBP in EC patients; (C) survival curve of FIGO in EC patients; (D) Survival curve of cancer embolus in EC patients; (E) survival curve of grading in EC patients; (F) survival curve of LVSI in EC patients. CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2.

3.3. Analysis of GSPT2 and CIRBP gene expression and prognosis in EC patients within the TCGA database

3.3.1. The expression of GSPT2 and CIRBP in pan-cancer Plots

The TCGA database shows that GSPT2 is expressed in most tumor tissues and its expression is higher than that in normal tissues, including in endometrial cancer. This difference in expression is statistically significant (P = .000). Conversely, CIRBP expression is reduced in most tumor tissues, and its expression in endometrial cancer is lower than that in normal endometrial tissue, with a statistically significant difference (P = .00072) (Fig. 7A–D).

Figure 7.

Analysis of GSPT2 and CIRBP gene expression and prognosis in EC patients within the TCGA database. (A) Expression of GSPT2 in human body tumor and normal samples; (B) expression of CIRBP in human body tumor and normal samples. (C and D) Protein expression of GSPT2 and CIRBP from EC and normal endometrium tissues; (E) effect of GSPT2 expression on EC patient survival; (F) effect of CIRBP expression on EC patient survival. CIRBP = cold-inducible RNA-binding protein, EC = endometrial cancer, GSPT2 = G1 to S phase transition 2, TCGA = The Cancer Genome Atlas. The supplementary figures are Figures 4B and 5, and additional data can be found in the supplementary materials.

3.3.2. Effect of GSPT2 and CIRBP expression on EC and patient survival

The results of the survival analysis reveal that a high expression of GSPT2 genes is negatively correlated with the overall survival rate of endometrial cancer patients (P = .00087; n = 175), whereas a high expression of CIRBP protein is positively associated with the overall survival rate of endometrial cancer patients (P = .00011; n = 175). Both differences are statistically significant (Fig. 7E and F).

4. Discussion

EC is a common malignant tumor in the female reproductive system, and its incidence is increasing every year, especially among younger women. The prognosis of early-stage EC is relatively good, but there has been no significant improvement in the prognosis of patients with advanced or recurrent disease.^[1,2] The current treatment methods mainly include surgery, chemotherapy, and radiotherapy, but these methods often encounter limitations such as drug resistance and late-stage diagnosis. Therefore, there is an urgent need to explore new molecular targets.^[17,18]

The advantage of this study lies in the integration of clinical sample experiments with large database analyses, systematically verifying the differential expression of GSPT2 and CIRBP and their clinical significance at both mRNA and protein levels. Preliminary studies have shown the significance of these 2 proteins in cancer biology, indicating their potential as biomarkers for diagnosis and prognosis.^[18,19] The ultimate aim is to screen young female patients for fertility preservation and improve the prognosis of advanced- stage patients.

This study discovered that the expression of GSPT2 is increased and the expression of CIRBP is decreased in EC, which is correlated with aggressive characteristics such as tumor grade, stage, and myometrial invasion. Elevated GSPT2 predicts a poor prognosis, while CIRBP shows tumor-suppressive functions. ROC analysis indicated that both GSPT2 and CIRBP exhibit high diagnostic sensitivity and specificity for EC. These results suggest that GSPT2 and CIRBP are promising biomarkers for the diagnosis and prognosis of EC. Moreover, they may assist in molecular subtyping and therapeutic targeting, providing new directions for precision medicine approaches.

GSPT2 is a crucial protein that plays an indispensable role in diverse cellular processes, especially in the regulation of the cell cycle. It serves as a translation termination factor and is implicated in the maintenance of mRNA stability, which is vital for appropriate protein synthesis during cell division. GSPT2 has been demonstrated to interact with several key cell cycle regulators, thereby influencing the transition from the G1 phase to the S phase of the cell cycle, a crucial point that determines cellular proliferation and growth.^[20,21] Simultaneously, the regulation of GSPT2 is influenced by various cellular signals, and its dysregulation can result in Aberrant protein synthesis, contributing to oncogenesis. Furthermore, GSPT2 has been involved in the modulation of cellular responses to stress, making it a significant player in cancer biology and a potential therapeutic target.^[21] CIRBP belongs to the glycine-rich RNA-binding protein family, which encompasses an RNA recognition motif (RRM) and a carboxyl-terminal domain with several RGG motifs. These structures facilitate the interaction with target RNA molecules, thereby influencing gene expression and stability.^[13,22] Recent studies have revealed that CIRBP plays a dual regulatory role in tumorigenesis and development. In liver cancer, it acts as an oncogene, promoting tumor cell growth, whereas in colorectal cancer, it functions as a tumor suppressor gene, inhibiting cell proliferation and thereby exerting tumor-suppressive effects.^[23,24] This indicates that CIRBP may act as an oncogene or tumor suppressor depending on the context. Additionally, CIRBP’s role in cellular responses to ionizing radiation further demonstrates its significance in cancer biology, as it can sensitize cancer cells to treatment by modulating cell cycle checkpoints.^[13] Consequently, CIRBP is not only crucial for normal cellular function but also plays a pivotal role in cancer cell proliferation and treatment resistance.

In this study, we explored the expression levels of GSPT2 and CIRBP in endometrial cancer tissues in comparison to normal endometrial tissues by RT-PCR and IHC method, with the aim of clarifying their potential roles as biomarkers in this malignancy. Both at the gene and protein levels, our findings suggest that GSPT2 is overexpressed while CIRBP is under expressed in EC tissues. Meanwhile, based on the ROC curve and AUC statistics, it was discovered that both GSPT2 and CIRBP can effectively predict EC. Both exhibited a negative correlation. These research findings indeed further validate the carcinogenic role of GSPT2 and the tumor-suppressing role of CIRBP, which are in line with previous research conclusions. Previous studies have found that GSPT2 Overexpression promotes the development of breast tumors and acute lymphoblastic leukemia (ALL).^[9,25,26] Polymorphisms in the GSPT2 gene have been associated with diverse outcomes in patients with liver cancer, further highlighting its significance in various cancer scenarios.^[27] This provides new clues and evidence for a deeper understanding of the mechanisms of action of this gene in the initiation and progression of EC. These all elucidated that the overexpression of GSPT2 has been associated with increased proliferation and metastasis of endometrial cancer cells, indicating its potential as a biomarker for aggressive disease.^[28] Research has demonstrated that downregulation of GSPT2 can inhibit tumor cell growth and promote apoptosis, suggesting that targeting GSPT2 could be a viable therapeutic strategy.^[29] Moreover, alterations in GSPT2 expression have been linked to various oncogenic pathways, further establishing its relevance in cancer biology. Understanding the mechanistic role of GSPT2 in endometrial cancer could provide insights into novel treatment approaches and improve patient management strategies. In cancer cells, elevated levels of GSPT2 have been associated with increased proliferation rates, highlighting its potential as a biomarker for aggressive tumors.^[30]

In various studies, CIRBP expression has been found to differ significantly between tumor tissues and adjacent normal tissues, indicating its potential role as a biomarker for tumorigenesis. For instance, Lujan et al^[31] found in mouse experiments that overexpression of CIRBP in the mammary gland inhibits mammary proliferation, suggesting that CIRBP may suppress tumor proliferation by inhibiting cell growth, potentially through its role in the DNA damage response. This is consistent with the results of the present study. Downregulation of CIRBP in EC has been correlated with malignant progression and poor prognosis, suggesting that CIRBP may act as a tumor suppressor in the context of endometrial cancer. The loss of CIRBP expression has been linked to increased cellular proliferation and reduced apoptosis in cancer cells, which contributes to tumor growth and metastasis.^[32] This indicates that CIRBP might play a critical role in maintaining cellular homeostasis and preventing tumorigenesis in the endometrium. Furthermore, the differential expression of CIRBP could potentially serve as a biomarker for early detection and prognosis of endometrial cancer, emphasizing the need for further research into its regulatory mechanisms and functional roles within the tumor microenvironment.^[17]

At the same time, the study results demonstrated that the level of GSPT2 protein expression was positively correlated with the grading, FIGO staging, muscle-invasive, cervical infiltration, accessory, Cancer embolus, and distant metastasis of endometrial carcinoma. Meanwhile, the high expression of CIRBP protein was negatively associated with them respectively. However, the patient’s age, Parametrial metastasis and ACM showed no statistically significant connection with the expression levels of GSPT2 and CIRBP. It can be argued that both are indeed not related to age, but they should be associated with Parametrial metastasis and ACM. The disparity in these results might be related to the small sample size.

It is widely recognized that the ability of cancer cells to infiltrate adjacent tissues and develop secondary tumors is a complex process involving several stages, such as epithelial-mesenchymal transition (EMT), migration, and invasion. GSPT2 is not only involved in the proliferation of tumor cells but also plays a crucial role in the metastatic process. Research indicates that GSPT2 might accelerate these processes by regulating the expression of genes related to cell motility and invasion.^[15,33] For example, GSPT2 has been linked to the regulation of matrix metalloproteinases (MMPs), which are enzymes that break down extracellular matrix components, enabling cancer cells to infiltrate adjacent tissues. Furthermore, GSPT2’s participation in signaling pathways, like the PI3K/Akt and MAPK pathways, can enhance the migratory and invasive capabilities of tumor cells. The expression of GSPT2 has been associated with an increased metastatic potential in various cancer types, suggesting that it might act as a prognostic marker for metastasis. Inhibiting the function of GSPT2 could potentially reduce the metastatic spread of tumors, making it an interesting target for therapeutic intervention in advanced cancer stages. Understanding the exact mechanisms through which GSPT2 contributes to metastasis will be essential for developing effective strategies to combat cancer spread.^[33–35] This also suggested that GSPT2 serves as an independent prognostic factor in EC, providing valuable information beyond traditional clinicopathological variables.

In contrast, CIRBP acts as a protective factor to a certain extent in EC cancer, inhibiting the metastasis and invasion of cancer cells. This is also in line with previous research findings. In pancreatic cancer, lower levels of CIRBP were associated with poorer survival outcomes, suggesting that a high expression of CIRBP could be protective against tumor progression.^[30] CIRBP has been shown to interact with various components of the TME, including immune cells, stromal cells, and extracellular matrix components. By influencing the expression of key proteins in the TME, CIRBP can alter the dynamics of immune cell infiltration and the overall tumorigenic process. Moreover, the interaction of CIRBP with signaling pathways, such as the PI3K/Akt pathway, further highlights its role in shaping the TME and its influence on cancer cell behavior.^[36] Furthermore, the role of CIRBP varies in different microenvironments.

This study aimed to investigate the prognostic significance of GSPT2 and CIRBP in EC. Multivariate Cox regression analysis revealed that high expression of GSPT2, tumor thrombus formation, and FIGO staging were independent risk factors for poor prognosis in EC patients. In contrast, high expression of CIRBP was associated with a lower risk of mortality. Survival analysis demonstrated that high expression of GSPT2 correlated with worse overall survival, while high expression of CIRBP was linked to better survival. The survival analysis of EC was also found to be associated with FIGO staging, grading, LVSI, and tumor thrombus formation. This further indicates that GSPT2 and CIRBP can be used as markers of endometrial cancer prognosis.

GSPT2 may act as an oncogene, promoting tumor aggressiveness and reducing patient survival. This is consistent with findings in other cancers where GSPT2 is upregulated. Previous research has shown that high GSPT2 expression was linked to advanced disease stages and reduced overall survival rates in breast cancer, suggesting its potential as an independent prognostic factor.^[9] This is also supported by findings in gastrointestinal cancer,^[35] where GSPT2 expression levels correlate with tumor progression and patient outcomes, indicating its potential utility in stratifying patients based on risk. In conclusion, these findings suggest that GSPT2 serves as an independent prognostic biomarker and is a potential therapeutic target worthy of further investigation.

The protective role of CIRBP could be attributed to its involvement in cellular stress responses and apoptosis regulation, which are crucial in tumor development and progression. Therapies aimed at enhancing CIRBP expression may improve patient outcomes.^[17] Furthermore, CIRBP’s role in modulating immune responses within the tumor microenvironment may also contribute to its prognostic significance, as immune infiltration patterns are increasingly recognized as key determinants of cancer outcomes.^[36,37] Overall, CIRBP not only serves as a potential prognostic biomarker but also as a mediator of tumor biology, making it an interesting target for further research into therapeutic interventions in endometrial cancer.

Although the aforementioned research findings align with relevant studies in the TCGA database, their specific functional mechanisms and signaling pathways of both in the occurrence and development of EC are still unclear and require further research.

The innovative aspects of this study lie in the identification of GSPT2 and CIRBP as potential biomarkers for endometrial cancer (EC), filling a critical gap in the current understanding of the molecular mechanisms underlying this malignancy. Previous research has primarily focused on individual biomarkers or specific pathways, leaving a need for comprehensive studies examining the interplay of multiple proteins in the context of EC. For instance, while Chen et al^[25] discussed GSPT2 in relation to breast cancer, our research is the first to provide evidence of its role in EC, highlighting its overexpression as a poor prognostic marker. Additionally, this study underscores the under expression of CIRBP, which contrasts with earlier findings in other cancer types. The unique expression patterns of these proteins in EC tissues suggest that they could serve as novel therapeutic targets, paving the way for future research aimed at developing targeted therapies for this disease.^[12,37–39]

This study still has some limitations. Foremost, it was based solely on the analysis of clinical samples without conducting in vivo and in vitro experimental validation or investigating the mechanism of action of related genes. Additionally, the relatively small sample size of fresh tissue may limit the generalizability of the results. The study’s reliance on retrospective data further complicates the interpretation of the findings, as biases inherent in such analyses may influence clinical correlations. Moreover, the lack of clinical validation analyses restricts the application of these biomarkers in routine practice. Future research should address these limitations by incorporating larger, well-defined cohorts and conducting functional studies to elucidate the biological implications of GSPT2 and CIRBP in endometrial cancer.

5. Conclusion

In conclusion, this study highlights the potential of GSPT2 and CIRBP as significant biomarkers with prognostic implications in endometrial cancer. The findings revealed that high GSPT2 expression was closely associated with EC progression and poor prognosis, while CIRBP may exert a protective effect. These results underscore the importance of integrating these markers into clinical evaluations to enhance patient stratification and inform therapeutic decisions. As the field moves toward personalized medicine, further exploration into the functional roles of these biomarkers, along with validation in larger cohorts, will be essential for translating these findings into clinical practice, ultimately aiming to improve patient outcomes and optimize treatment strategies in endometrial cancer.

Acknowledgments

The author, Yu Cai, conveys profound appreciation to her doctoral supervisor, Professor Wu Yumei, for her invaluable mentorship. She also expresses gratitude to her brother, senior colleagues, and peers for their unwavering support. Additionally, heartfelt thanks are extended to the founders and maintainers of the TCGA databases.

Author contributions

Conceptualization: Yu Cai, Ming Wang, Yue He, Yu-Mei Wu.

Data curation: Yu Cai, Ming Wang, Jiao Wang, Li Xing, Qi Han, Yuan-Hui He.

Formal analysis: Yu Cai, Ming Wang, Jiao Wang.

Funding acquisition: Yu-Mei Wu.

Investigation: Yu Cai, Ming Wang.

Methodology: Yu Cai, Li Xing, Yuan-Hui He.

Project administration: Yu Cai, Ming Wang, Yue He, Yu-Mei Wu.

Resources: Yu Cai, Jiao Wang, Qi Han, Yuan-Hui He.

Software: Yu Cai, Jiao Wang.

Supervision: Ming Wang, Yue He, Yu-Mei Wu.

Validation: Yu Cai, Li Xing.

Visualization: Yu Cai.

Writing – original draft: Yu Cai.

Writing – review & editing: Yu Cai, Ming Wang, Yu-Mei Wu.