Skip to main content
NCBI home page
Transboundary and Emerging Diseases logoLink to Transboundary and Emerging Diseases
. 2025 Aug 25;2025:5779652. doi: 10.1155/tbed/5779652

Streptococcus suis Serotype 14: A Nonnegligible Zoonotic Population

Liangliang Wu 1, Likuan Zhang 2, Xiaoqi Wang 2, Wei Huang 1, Stefan Schwarz 3,4, Andrea Brenciani 5, Chenglong Li 2,✉, Xiang-Dang Du 2,✉
PMCID: PMC12401614  PMID: 40901540

Abstract

Streptococcus suis is an important zoonotic pathogen that can cause severe infections in both humans and pigs. The prevalence of S. suis serotype 14 in sporadic cases in China has been gradually increasing during recent years. However, the current understanding of S. suis serotype 14 is limited. In this study, we investigated the population structure, phylogenetic relationships, antimicrobial resistance, and pathogenicity of 125 S. suis serotype 14 strains. These strains clustered into 12 sequence types (STs) and three clonal complexes (CCs), with ST7 accounting for the highest proportion (73.6%), which indicates significant pathogenic potential, given that ST1 and ST7 are well-known high-virulence STs in S. suis. Bioinformatic analysis showed that all serotype 14 strains carry the virulence genes sly and epf, while 74.4% of the strains carry the virulence gene mrp. In the pathogenicity test (n = 5), the human strain Ss2301, Ss2401, and the porcine strain L966, SC42 proved to be highly virulent strains. These data highlight the virulence potential of serotype 14 S. suis. Tetracycline resistance genes and macrolide, lincosamide, and streptogramin B (MLSB) resistance genes were most frequently detected in the population. The transmission of the former genes mainly depends on integrative and conjugative elements (ICEs), while the latter depends on both ICEs and prophages. This study not only confirmed the pathogenic potential of serotype 14 S. suis but also provided valuable information for improving prevention and control strategies for S. suis infections.

Keywords: antimicrobial resistance, integrative and conjugative elements, pathogenicity, population structure, prophage, Streptococcus suis serotype 14, zoonotic pathogens

1. Introduction

Streptococcus suis is a gram-positive zoonotic pathogen that usually colonizes the upper respiratory tract (especially tonsils and nasal cavity) of pigs, and occasionally also the reproductive tract and digestive tract [1]. Pigs are often represented as asymptomatic hosts for S. suis. However, S. suis infections in humans can cause purulent meningitis, sepsis, arthritis, endocarditis, and streptococcal toxic shock syndrome (STSS), of which the most common clinical manifestations are meningitis and sepsis [2, 3]. In 1968, a human case of S. suis infection was first reported in Denmark [4]. So far, S. suis has become the most common cause of adult meningitis in Vietnam and other Asian countries [5, 6].

Serotyping and multilocus sequence typing (MLST) of isolates are often used as predictors of the pathotype of S. suis [7]. Strains of the same sequence type (ST) can be assigned to different serovars and vice versa. To date, 29 serotypes of S. suis have been described [8]. It should be noted that in recent years, a new serotype designated serotype Chz and 33 new capsular polysaccharide loci (NCL) have been identified [9–12]. Serotype 2 is considered to be the most prevalent and virulent for infections of humans in most parts of the world [13]. Two outbreaks of S. suis in China that have attracted worldwide attention: Jiangsu in 1998 and Sichuan in 2005, respectively, both caused by strains assigned to serotype 2 and MLST type ST7 [3, 14, 15]. Therefore, most studies have focused on S. suis serotype 2. However, different serotypes of S. suis exhibit diverse characteristics in population structure and pathogenicity. Most often, human cases of S. suis infections are sporadic and associated with exposure to pigs or pork products. It has been reported that the prevalence of S. suis serotype 14 in sporadic cases in China has increased recently [16, 17]. At the same time, we also noticed that there were two cases of S. suis serotype 14 infection in the hospitals that we monitored. However, in the published literature, little is known about S. suis serotype 14 except for information from some epidemiological studies and a general study on 11 human strains of serotype 14 S. suis [18, 19].

The pathogenicity of S. suis is related to the virulence factors carried by the respective strains. The main virulence genes of S. suis include genes for capsular polysaccharide (cps), suilysin (sly), muramidinase-release protein (mrp), extracellular factor (epf), fibronectin-binding protein (fbps), and the virulence-related sequence (orf2). Among them, mrp, epf, and sly are virulence marker factors of S. suis [20].

In this study, a total of 125 S. suis serotype 14 genomes from seven different countries were analyzed, including those of two human patients and three porcine strains that we collected. The population structure, phylogenetic relationships, putative virulence-related genes, antimicrobial resistance genes, and mobile genetic elements (MGEs) were systematically analyzed by bioinformatics. In addition, animal infection experiments and antimicrobial susceptibility testing (AST) were performed on S. suis serotype 14 strains isolated from pigs and humans to evaluate their pathogenicity and resistance characteristics. This study is helpful to deepen the understanding of S. suis serotype 14 and provide valuable information for the monitoring and prevention of S. suis serotype 14 infections.

2. Materials and Methods

2.1. Case Descriptions

On March 1, 2023, a 46-year-old male patient who presented with fever, chills, nausea, vomiting, and weakness of one limb 2 days ago without any obvious cause was admitted the to hospital. One day earlier, the patient experienced extra frontal discomfort such as headache, body aches, and urinary incontinence. On the day of admission, the abovementioned symptoms worsened, with a maximum body temperature of 39.5°C. Contrast-enhanced computed tomography of the brain and transthoracic echocardiogram showed slight fibrotic lesions in both lungs. Further investigation revealed that the patient reported a history of right-hand finger injury 10 days ago and had a history of contact with live animals. The blood test showed an increase in white blood cells, an increase in neutrophil percentage, a decrease in lymphocyte percentage, and an increase in C-reactive protein (42.7 mg/L). Biochemical and routine findings of cerebrospinal fluid indicated low blood sugar, significant elevation of cerebrospinal fluid proteins and nucleated cells, suggesting meningitis. Subsequently, both cerebrospinal fluid and blood samples were cultured to produce α-hemolytic gray–white colonies, which were identified as S. suis Ss2301 by mass spectrometry and 16s rRNA analysis. According to the drug susceptibility results, intravenous infusion of vancomycin and penicillin was administered for anti-infective treatment. After 18 days of treatment, blood and cerebrospinal fluid cultures were negative, and the patient's clinical symptoms improved significantly. The patient was discharged from the hospital.

The second patient was an 80-year-old man. The patient was admitted to the hospital on August 16, 2024, with a high fever for more than 10 days before admission. The main symptoms were low back pain and high fever. The vision and hearing were normal. The patient had a history of exposure to raw pork and ate uncooked meals, but no obvious traumatic wounds were found. On August 18, 2024, S. suis Ss2401 was isolated from the blood sample of the patient's right foot (verified by mass spectrometry and 16s rRNA analysis). Subsequently, the patient was treated with ceftazidime injection every 12 h for four consecutive days. After the fever subsided, the patient was discharged at the request of his family.

2.2. Bacterial Isolates

The experimental S. suis strains included three swine strains, L965, L966, and SC42 preserved in our laboratory, and two human strains, Ss2301 and Ss2401, mentioned above. All strains belonged to serotype 14. Of them, L965 and L966 were isolated from the heart and joint fluid of diseased pigs with sepsis and high fever symptoms, respectively, while SC42 was obtained from nasal swabs of a healthy pig. Both L965 and L966, isolated in 2018, belonged to ST1, while SC42, isolated in 2016, Ss2301, isolated in 2023, and Ss2401, isolated in 2024, belonged to ST7. In addition, we collected the genomic information of all S. suis serotype 14 strains (n = 120) deposited in the NCBI database, which were assembled well for subsequent analysis. Strain P1/7, which was isolated from the preslaughter blood culture of a pig that died of meningitis, was used as a positive control in the infection experiment. All S. suis strains were cultured in brain–heart infusion (BHI) broth (Hopebio, Qingdao, China) containing 5% fetal bovine serum at 37°C.

2.3. Whole-Genome Sequencing (WGS) and Analysis

The whole genome DNA of S. suis Ss2301 and Ss2401 was extracted using the QIAamp DNA Mini Kit (Qiagen, USA) and sequenced using the MiniION nanopore and Illumina MiSeq platforms (Shanghai Personal Biotechnology Co. Ltd., China). For strains L965, L966, and SC42, only raw Illumina reads were generated. The raw Illumina reads and raw nanopore reads of S. suis were assembled using Unicycler (v0.5.0) [21]. The assembled sequences were annotated using RAST (https://rast.nmpdr.org/). Antimicrobial resistance genes were identified using ResFinder [22]. MLST subtyping was carried out by the PubMLST database (https://pubmlst.org/). The global optimal eBURST (goeBURST) analysis was used to analyze the possible patterns of evolutionary descent. Serotype and virulence-related genes were determined by comparison analysis after establishing a serotype library or a virulence-related genes library of S. suis using AbRicate. The distribution of 55 putative virulence-associated genes (including mrp, sly, epf) of S. suis was investigated among the 125 S. suis serotype 14 genomes, as described in previous reports (listed in Supporting Information 1 Table S1) [23]. The genes having a global match region at <80% of the amino-acid sequence with an identity of <80% were determined to be absent. The integrative and conjugative elements (ICEs) and prophages were predicted by ICEberg (https://db-mml.sjtu.edu.cn/ICEberg/) and PHAST (http://phast.wishartlab.com/), respectively.

2.4. Minimum Spanning Tree of S. suis Serotype 14 Strains

All assembled genomes of S. suis strains stored in the Genbank database were downloaded (n = 6008). The serotypes of all strains were determined by analyzing their whole genome sequences. The background information of 125 strains of S. suis serotype 14 is shown in Supporting Information 2 Table S2 (including five isolates from this study and 120 strains downloaded from the GenBank public database). The minimum spanning tree was constructed by BioNumerics v.7.6.

2.5. Phylogenetic Tree of ST7 S. suis

A total of 315 strains of ST7 S. suis were extracted from the above 6008 strains stored in the Genbank database. The background information of 318 ST7 S. suis, including three isolates in this study, is shown in Supporting Information 3 Table S3. A phylogenetic tree was constructed based on single-nucleotide variations. The phylogenetic tree was constructed by FastTree 2.10 and visualized by FigTree and Chiplot (https://www.chiplot.online/circleTree.html) [24–26].

2.6. AST

Strains L965, L966, SC42, Ss2301, and Ss2401 were selected for AST, while Streptococcus pneumoniae ATCC49619 as quality control. AST was performed by broth microdilution according to the recommendations given by EUCAST [27], and the results were categorized according to the EUCAST breakpoint tables for interpretation of MICs and zone diameters, version 15.0. The antimicrobial agents tested were as follows: β-lactam antibiotics (penicillin, ceftiofur, and amoxicillin), rifamycin (rifampicin), glycopeptide (vancomycin), quinolones (enrofloxacin), oxazolidone (linezolid), phenicols (chloramphenicol and florfenicol), macrolides (azithromycin and erythromycin), aminoglycosides (gentamicin, kanamycin, and spectinomycin), lincosamides (clindamycin and lincomycin) and tetracyclines (doxycycline and tetracycline). The breakpoints of S. pneumoniae are used for penicillin, amoxicillin, rifampicin, vancomycin, linezolid, and chloramphenicol. The breakpoints of Staphylococcus aureus were used for azithromycin, ceftiofur, gentamicin, kanamycin, and spectinomycin. The breakpoints of Streptococcus dysgalactiae were used for enrofloxacin and lincomycin.

2.7. Infection Experiments

The pathogenicity of strains L965, L966, SC42, Ss2301, and Ss2401 was determined by intraperitoneal injection of the tested strain into mice. 6-week-old female BALB/c mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd. Before infection, each strain was collected in the mid-log phase, washed twice with PBS, and adjusted to the appropriate doses in PBS for infection. Ten mice in each experimental group were intraperitoneally injected with 3 × 108 CFU per mouse. The final mortality of mice was calculated after 96 h of continuous observation after infection. Serotype 2 S. suis P1/7 served as a positive control due to its high pathogenicity and known characteristics, and the PBS group was used as a negative control [28, 29]. According to previous reports, strains with a mortality rate of ≥80% in mice are defined as highly virulent strains [16, 30–32]. The experiment was conducted independently at least three times for each strain. The survival curve of each strain and the survival curve of the highly virulent strain P1/7 were statistically analyzed using the Mantel–Cox test.

3. Results

3.1. Serotype and MLST Typing

In order to investigate the molecular characteristics of the serotype 14 strains, five strains in this study and all the assembled 6008 S. suis strains stored in the Genbank database were included in the statistics. Both serotypes and MLST types were determined. Among the 6013 S. suis strains, the prevalence of serotype 14 was 2.08% (125/6013): among them, 77.6% (97/125) were from China, followed by 10.4% (13/125) from the Netherlands. 23.2% of the serotype 14 isolates were from pigs (29/125), 76% of the serotype 14 isolates were from humans (95/125), and the source information of the remaining strains was lost. The time span was from 1960 to 2024. It is worth noting that the 125 serotype 14 strains can be divided into 12 STs, of which ST7 accounted for the highest proportion of 73.6% (92/125), followed by ST1, accounting for 9.6% (12/125), and ST13 accounting for 8% (10/125). The remaining STs were only detected in one or two strains (Supporting Information 2 Table S2). 12 different STs were assigned to three clonal complexes (CCs), including CC1 (ST7, ST1, ST6, ST1131, ST124, ST132, ST1642, ST2100), CC13 (ST13, ST149), and CC231 (ST231, ST1522) (Figure 1).

Figure 1.

Figure 1

Open in a new tab

The minimum spanning tree of MLST data of serotype 14 S. suis strains (five strains from this study and 120 strains extracted from GenBank) was constructed. Each node represents a unique ST, and the size of the circle is proportional to the number of strains with the same ST. Different ST types are represented by different colors; the difference of one allele was represented by a thick solid line, the difference of three alleles was indicated by dotted line, and the difference of more than three alleles was indicated by stippled line. Different ellipses represent different CC types, and different STs and numbers are marked inside the ellipses.

3.2. Minimum Spanning Tree and Phylogenetic Tree Analysis

A total of 6008 assembled genomes of S. suis were stored in the Genbank database, and all serotype 14 strains were extracted from the global 6008 assembled genomes of S. suis, which were used to construct the minimum spanning tree. From the perspective of the minimum spanning tree branch, ST1 occupies the core position and ST7 dominates in number, which accounts for 73.6% of all strains (Figure 1). The high detection rate of ST7 strains suggests significant pathogenic potential. In view of the large number of ST7 strains, subsequently a SNP-based phylogenetic tree of ST7 strains was constructed in order to understand the phylogeny of ST7 strains. All ST7 strains were extracted from the global 6008 assembled genomes of S. suis and the three genomes of this study. 318 nonrepetitive ST7 S. suis strains (5.29%; 318/6013) were selected to construct a phylogenetic tree. Among them, 317 strains were from China, isolated during 1998–2023, and only one strain was from Japan in 1986 (Figure 2). Among ST7 strains, serotype 2 accounted for the largest proportion (71.07%; 226/318), followed by serotype 14 (28.3%; 90/318).

Figure 2.

Figure 2

Open in a new tab

Phylogenetic tree of S. suis ST7 strains. The maximum likelihood phylogenetic tree was constructed using the core genomic SNPs of 318 S. suis ST7 strains (three strains from this study and 315 strains extracted from GenBank). The innermost circle indicates the different years of isolation of the strains, which are represented by different colors. The middle circle indicated the serotypes of all strains: blue represented serotype 2, orange represented serotype 14, red represented serotype 1, and green represented an unknown serotype. The outermost circle indicates the geographical isolation site of the strains: green asterisks represent China, and the purple square represents Japan.

3.3. Distribution of Putative S. suis Virulence-Related Genes

In order to identify the virulence genes carried by serotype 14 S. suis, 55 putative virulence factors, including three classic virulence genes sly, mrp, and epf, were scanned by the abricate software. The distribution of all virulence genes is shown in Supporting Information 1 Table S1, while only the distribution of the three classic virulence genes is shown in Figure 3. The results showed that different strains carry 45–50 putative virulence genes, with 68.8% of strains (86/125) carrying 50 virulence genes, followed by 28% of strains (35/125) carrying 49 virulence genes. We did not observe differences among the strains of different STs. It is worth noting that all serotype 14 strains carried the virulence genes sly and epf, while 74.4% (93/125) of the strains carried the virulence gene mrp. The high prevalence of the virulence genes in serotype 14 strains suggests that serotype 14 S. suis may have a substantial virulence potential.

Figure 3.

Figure 3

Open in a new tab

Distribution of resistance genes and three major virulence genes among S. suis serotype 14 strains. The vertical axis represents the strain names, and the horizontal axis represents the resistance genes or the three major virulence genes. The grid intersecting the horizontal and vertical axes is dark petrol, indicating that the strain carries the gene, and light petrol indicates that the strain does not carry the gene.

3.4. Distribution of Antimicrobial Resistance Genes in S. suis Serotype 14 Genomes

In order to identify the antimicrobial resistance determinants carried by serotype 14 S. suis, ResFinder software was used to determine the drug resistance genes carried by all strains. Among the 125 strains, 10 strains did not carry drug resistance genes, accounting for 8%, while the remaining strains carried one to seven drug resistance genes. The distribution of antimicrobial resistance genes in 125 strains is shown in Figure 3. The resistance genes carried by S. suis serotype 14 mainly include seven types. A total of 41 strains carried aminoglycoside resistance genes, including ant(6′) encoding an aminoglycoside nucleotidyltransferase, aph(2″), aph(3′) encoding aminoglycoside phosphotransferases, and spw mediating spectinomycin resistance, accounting for 32% (40/125), 6.4% (8/125), 2.4% (3/125), and 20.8% (26/125), respectively. In total, 106 strains carried tetracycline resistance genes, mainly including tet(40) and tet(O), accounting for 73.6% (92/125) and 80.8% (101/125), respectively. The genes tet(O/W/32/O) and tet(S) were only detected in one strain, and tet(M) was detected in four strains. The macrolide, lincosamide, and streptogramin B (MLSB) resistance gene erm(B), encoding an rRNA methylase, was present in 41.6% (52/125) and the lincosamide resistance gene lnu(C), gene encoding a lincosamide nucleotidyltransferase, was detected in 1.6% (2/125) of the strains, respectively. Three and 10 strains carried the streptothricin resistance gene sat4 and the streptogramin A resistance gene vga(F), respectively. The detection rate of the oxazolidinone/phenicol resistance gene optrA was 3.2% (4/125). In addition, four strains carried the dihydrofolate reductase gene dfrG, which confers trimethoprim resistance. In summary, tetracycline resistance genes were most commonly found in serotype 14 S. suis, followed by the MLS resistance genes.

In order to further understand the potential spread of resistance genes in S. suis serotype 14 strains, the location of the resistance genes was analyzed by whole-genome sequence analysis. Tetracycline resistance genes tet(O) and tet(40) are co-localized on an ICE, which is frequently inserted into the 3-end of the rumA chromosome gene and produces imperfect target repeats of 20 bp at both ends (CACGTGGAGTGCGTAGTGTT [attL]; TTCTCAAGGAACAGACTACA [attR]). It is worth noting that almost all tet(O) and tet(40) genes are located on the integrative and mobilizable elements (IMEs) inserted into the SNF2 family protein, subsequently integrated onto ICEs. In addition, there are three kinds of vectors for the MLSB resistance gene erm(B): (i) the erm(B) gene alone is located on a prophage; (ii) the erm(B) gene may be co-localized with aminoglycoside resistance genes [ant(6′), aph(2″), etc.] on ICEs or prophages; (iii) the erm(B) gene may be co-localized with tetracycline resistance genes [tet(O), tet(40), etc.] on ICEs. Thus, in S. suis serotype 14, the main vehicles for the spread of tetracycline resistance genes are ICEs, while the spread of erm(B) genes is the result of the combined action of ICEs and prophages. These data reveal the potential reasons for the high prevalence of tetracycline resistance genes and the MLSB resistance gene erm(B).

3.5. Antimicrobial Susceptibility Profiles of Available Strains

In order to determine the antimicrobial susceptibility of S. suis serotype 14, AST was performed on available serotype 14 strains. The susceptibility of 18 antibiotics in 10 categories was detected, including β-lactam antibiotics (penicillin, ceftiofur and amoxicillin), rifamycin (rifampicin), glycopeptide (vancomycin), quinolones (enrofloxacin), oxazolidone (linezolid), phenicols (chloramphenicol and florfenicol), macrolides (azithromycin and erythromycin), aminoglycosides (gentamicin, kanamycin and spectinomycin), lincosamides (clindamycin and lincomycin) and tetracyclines (doxycycline and tetracycline). All tested strains were resistant to tetracycline, while Ss2401 was additionally resistant to erythromycin, azithromycin, and clindamycin (Table 1). The whole genome sequence analysis of the tested strains showed that L965 and L966 carried the resistance genes tet(M) and tet(40); SC42 and Ss2301 carried resistance genes tet(O) and tet(40); Ss2401 carried resistance genes erm(B), tet(O) and tet(40), which is in agreement with the results of phenotypic AST.

Table 1.

Susceptibility results of the test strains.

Strains MICs (mg/L)
PEN CEF AMO RIF VAN ENR LZD CHL FFC AZM ERY GEN KM SPC CLI LIN DOX TET
L965 0.25 <1 <1 <1 <0.25 <1 <1 2 <1 <1 <1 8 32 64 <0.25 <1 4 32
L966 0.25 <1 <1 <1 <0.25 <1 <1 2 <1 <1 <1 8 8 64 <0.25 2 4 32
SC42 0.25 <1 <1 <1 <0.25 <1 <1 <1 <1 <1 <1 2 4 16 <0.25 <1 2 16
Ss2301 0.25 <1 <1 <1 <0.25 <1 <1 2 <1 <1 <1 8 64 64 <0.25 <1 4 32
Ss2401 0.25 <1 <1 <1 <0.25 <1 <1 4 <1 64 >512 32 16 64 512 32 2 64
ATCC49619 0.25 <1 <1 <1 <0.25 <1 2 2 2 <1 <0.25 2 4 64 <0.25 <1 <1 <1
Open in a new tab

Abbreviations: AMO, amoxillin; AZM, azithromycin; CEF, ceftiofur; CHL, chloramphenicol; CLI, clindamycin; DOX, doxycycline; ENR, enrofloxacin; ERY, erythromycin; FFC, florfenicol; GEN, gentamicin; KM, kanamycin; LIN, lincomycin; LZD, linezolid; PEN, penicillin; RIF, rifampin; SPC, spectinomycin; TET, tetracycline; VAN, vancomycin.

3.6. Pathogenicity of the Serotype 14 Strains

To evaluate the virulence of the selected S. suis serotype 14 strains, we conducted mouse pathogenicity tests. As shown in Table 2, the mortality rate of all strains fluctuates between 60% and 100%, highlighting the significant threat posed by serotype 14 S. suis. Among the tested strains, except for strain L965, the other four strains had a mortality rate of over 80% in mice and were defined as highly virulent strains regardless of their origin, indicating that strains derived from healthy pigs also need to be investigated. There have been similar reports before [16, 30]. It is worth noting that L966, Ss2301, and Ss2401 exhibited virulence levels almost identical to P1/7 within 12 h after infecting mice. L965 and L966 belong to the ST1 type, while SC42, Ss2301, and Ss2401 belong to the ST7 type. However, no difference in mortality rate was observed among different ST strains.

Table 2.

The mortality rates of mice injected with S. suis.

Strains Source Death in each period Total deaths Mortality rate (%) p Significance
12 h 24 h 36 h 48 h 60 h 72 h 84 h 96 h
L965 Dp 4 1 1 0 0 0 0 0 6 60.00 0.0043 ⁣ ∗∗
L966 Dp 10 0 0 0 0 0 0 0 10 100.00 >0.999 ns
SC42 Hp 9 0 0 0 0 0 0 0 9 90.00 0.3173 ns
Ss2301 P 10 0 0 0 0 0 0 0 10 100.00 >0.999 ns
Ss2401 P 10 0 0 0 0 0 0 0 10 100.00 >0.999 ns
P1/7 — 10 0 0 0 0 0 0 0 10 100.00 — —
PBS — 0 0 0 0 0 0 0 0 0 0 <0.0001 ⁣ ∗∗∗∗
Open in a new tab

Note: The survival curves of S. suis serotype 14 strains were compared with that of the highly pathogenic strain P1/7 using the Mantel–Cox test for statistical analysis. P indicates that the source was patients, Hp indicates that the source was healthy pigs, and Dp indicates that the source was diseased pigs. ⁣∗∗, ⁣∗∗∗∗, and “ns” indicate p < 0.01, p < 0.0001, and no significant difference, respectively.

4. Discussion

Human cases of S. suis are mainly related to serotypes 2 and 14 [33]. Previous studies reported that serotype 14 is one of the most common serotypes in human infection cases, second only to serotype 2 [17, 34–36]. In a study of human isolates of ST7 S. suis in Shenzhen, China, from 2005 to 2021, serotype 14 isolates were isolated from a patient who subsequently died of STSS [8]. Thailand has reported the most cases of serotype 14 S. suis in humans or pigs. In 2020, a study on the carriage rates of S. suis in pigs in slaughterhouses in Phayao Province, Thailand, showed that the carriage rates of serotypes 2 and 14 were 6.7% and 2.6%, respectively [35]. Another study on the clonal transmission of human S. suis serotype 14 showed that 12 (6.8%) of 177 human isolates in Thailand were identified as serotype 14, which is becoming a more common cause of human infections in Thailand [17]. In addition, a recent study from Thailand revealed that the pathogenic potential of virulent serotype 14-ST105 strains, which reduced adhesion and invasion to two epithelial cell lines (A549 and HeLa) [19]. In this study, 125 strains of S. suis serotype 14 were divided into 12 STs, mainly ST7, accounting for 73.6% (92/125). Therefore, we constructed a phylogenetic tree of the global ST7 S. suis, and the data showed the evolutionary relationship and genetic differences of ST7 strains. As many of the confirmed infections involve humans, these data indicate that S. suis serotype 14 is a potential zoonotic pathogen.

S. suis is also a reservoir of clinically important antimicrobial resistance genes [37–39]. The prevalence of antimicrobial resistance genes in this study is consistent with related reports: tet(O) and erm(B) are the most common genes associated with tetracycline and MLSB resistance in S. suis [40, 41]. ICEs and prophages play a crucial role in the transmission of antimicrobial resistance genes in S. suis, but major vehicles may differ for different serotypes [42]. For example, in serotype 4 strains, prophages are the main vector for the spread of resistance genes and play a crucial role in the spread of the MLSB, tetracycline, aminoglycoside, and oxazolidinone resistance genes [32]. In S. suis serotype 14, ICEs and prophages are the carriers of tetracycline resistance genes, and the spread of erm(B) genes is the result of either ICEs or prophages. In view of the limitations of the available serotype 14 strains, AST of the five strains determined in this study showed that all the tested strains were resistant to tetracycline, while Ss2401 was also resistant to erythromycin and clindamycin. Due to the dependence of both humans and pigs on antimicrobial agents for the treatment of S. suis infections, monitoring antimicrobial susceptibility will provide valuable information for the clinical treatment of S. suis infections.

The pathogenicity of S. suis is related to the virulence factors it carries. There are a number of virulence factors of S. suis have been detected, including cps, sly, mrp, epf, fbps, orf2, etc. In this study, 55 putative virulence factors were detected, with a high detection rate in serotype 14 S. suis. Among them, mrp, epf, and sly, are virulence marker factors of S. suis [20]. Sly can utilize host cell polysaccharides as high-affinity cell receptors and may play an important role in immune escape [14, 43]. Mrp may have an impact on crossing the blood–brain barrier and attachment to host cells, and also helps S. suis to resist phagocytosis by phagocytes and the killing effect of polynuclear neutrophils [44]. Epf can enhance bacterial infection, invasion, and pathogenicity, thereby facilitating bacterial colonization [45]. In this study, these three classical virulence markers have a high prevalence in S. suis serotype 14, indicating that S. suis serotype 14 may have great virulence potential. It is worth noting that among the four strains defined as highly virulent strains in mouse pathogenicity experiments, three strains (human strains Ss2301, Ss2401, and healthy pig strain SC42) have virulence genotypes of mrp+epf+sly+. These data indicate that strains carrying virulence genes mrp, epf, and sly simultaneously may have stronger virulence. Further studies are needed to determine the virulence markers of serotype 14 strains. According to reports, healthy pigs are a reservoir of strains with high virulence potential for humans [46, 47]. Interestingly, in the pathogenicity test, the strain SC42 from healthy pigs was classified as a highly virulent strain, while the strain L965 from diseased pigs was classified as a strain with reduced virulence, indicating that there was no correlation between the virulence level of the strain and its source (diseased pigs or healthy pigs). Since the clinical symptoms of pigs may also depend on the co-infection with certain viral and bacterial pathogens, it may not be possible to accurately assess the public health significance of a strain based solely on the clinical information of its host.

In summary, this study clarified the population structure, antimicrobial resistance, pathogenicity, and MGEs of S. suis serotype 14 by the construction of a phylogenetic tree, WGS, AST, and pathogenicity tests. The results showed that the S. suis serotype 14 had an obvious population structure, which consisted of a variety of ST types, of which ST7 dominated. The tetracycline and MLSB resistance genes-carrying ICEs and prophages jointly promoted the circulation of these resistance genes within the S. suis serotype 14 population. This population has a variable pathogenicity potential, with the virulence genes mrp, epf, and sly simultaneously harbored by more virulent strains. Since the virulence of S. suis is multifactorial, involving various virulence factors and their interactions, further studies are needed to determine the virulence markers of serotype 14 strains. Our data confirmed that S. suis serotype 14 is a nonnegligible pathogen, deepened the understanding of the S. suis serotype 14 population, and provided valuable information for improving the prevention and control strategies for S. suis infections.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant U23A20241) and the Outstanding Foreign Scientist Studio in Henan Province (Grant GZS2022010).

Contributor Information

Chenglong Li, Email: mylichenglong@126.com.

Xiang-Dang Du, Email: xddu@henau.edu.cn.

Data Availability Statement

The data are available upon request from the authors.

Ethics Statement

This study was carried out in accordance with the guidelines of the Henan Agricultural University Animal Ethics Committee.

Conflicts of Interest

The authors declare no conflicts of interest.

Author Contributions

Liangliang Wu and Likuan Zhang contributed equally to this work.

Funding

This work was supported by the National Natural Science Foundation of China (Grant U23A20241) and the Outstanding Foreign Scientist Studio in Henan Province (Grant GZS2022010).

Supporting Information

Additional supporting information can be found online in the Supporting Information section.

Supporting Information 1

Table S1: The distribution of 55 putative virulence factors in serotype 14 S. suis.

5779652.f1.xlsx (27.5KB, xlsx)
Supporting Information 2

Table S2: The background information of 125 serotype 14 S. suis strains.

5779652.f2.xlsx (19.3KB, xlsx)
Supporting Information 3

Table S3: The background information of 318 ST7 S. suis strains.

5779652.f3.xlsx (8.4MB, xlsx)

References

  • 1.Nghia H. D., Hoa N. T., le Linh D., et al. Human Case of Streptococcus suis Serotype 16 Infection. Emerging Infectious Diseases . 2008;14(1):155–157. doi: 10.3201/eid1401.070534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kay R., Cheng A. F., Tse C. Y. Streptococcus suis Infection in Hong Kong. QJM: Monthly Journal of the Association of Physicians . 1995;88(1):39–47. [PubMed] [Google Scholar]
  • 3.Yu H., Jing H., Chen Z., et al. Human Streptococcus suis Outbreak, Sichuan, China. Emerging Infectious Diseases . 2006;12(6):914–920. doi: 10.3201/eid1206.051194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wertheim H. F., Nghia H. D., Taylor W., Schultsz C. Streptococcus suis: An Emerging Human Pathogen. Clinical Infectious Diseases . 2009;48(5):617–625. doi: 10.1086/596763. [DOI] [PubMed] [Google Scholar]
  • 5.Suankratay C., Intalapaporn P., Nunthapisud P., Arunyingmongkol K., Wilde H. Streptococcus suis Meningitis in Thailand. The Southeast Asian Journal of Tropical Medicine and Public Health . 2004;35(4):868–876. [PubMed] [Google Scholar]
  • 6.Wertheim H. F., Nguyen H. N., Taylor W., et al. Streptococcus suis, an Important Cause of Adult Bacterial Meningitis in Northern Vietnam. PLoS One . 2009;4(6) doi: 10.1371/journal.pone.0005973.e5973 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Estrada A. A., Gottschalk M., Rossow S., Rendahl A., Gebhart C., Marthaler D. G. Serotype and Genotype (Multilocus Sequence Type) of Streptococcus suis Isolates from the United States Serve as Predictors of Pathotype. Journal of Clinical Microbiology . 2019;57(9):e00377–e00319. doi: 10.1128/JCM.00377-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ji L., Chen Z., Li F., et al. Epidemiological and Genomic Analyses of Human Isolates of Streptococcus suis Between 2005 and 2021 in Shenzhen, China. Frontiers in Microbiology . 2023;14 doi: 10.3389/fmicb.2023.1118056.1118056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pan Z., Ma J., Dong W., et al. Novel Variant Serotype of Streptococcus suis Isolated From Piglets With Meningitis. Applied and Environmental Microbiology . 2015;81(3):976–985. doi: 10.1128/AEM.02962-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Huang J., Liu X., Chen H., et al. Identification of Six Novel Capsular Polysaccharide Loci (NCL) From Streptococcus suis Multidrug Resistant Non-Typeable Strains and the Pathogenic Characteristic of Strains Carrying New NCLs. Transboundary and Emerging Diseases . 2019;66(2):995–1003. doi: 10.1111/tbed.13123. [DOI] [PubMed] [Google Scholar]
  • 11.Bojarska A., Janas K., Pejsak Z., et al. Diversity of Serotypes and New Cps Loci Variants Among Streptococcus suis Isolates From Pigs in Poland and Belarus. Veterinary Microbiology . 2020;240 doi: 10.1016/j.vetmic.2019.108534.108534 [DOI] [PubMed] [Google Scholar]
  • 12.Králová N., Fittipaldi N., Zouharová M., et al. Streptococcus suis Strains With Novel and Previously Undescribed Capsular Loci Circulate in Europe. Veterinary Microbiology . 2024;298 doi: 10.1016/j.vetmic.2024.110265.110265 [DOI] [PubMed] [Google Scholar]
  • 13.Kerdsin A., Dejsirilert S., Puangpatra P., et al. Genotypic Profile of Streptococcus suis Serotype 2 and Clinical Features of Infection in Humans, Thailand. Emerging Infectious Diseases . 2011;17(5):835–842. doi: 10.3201/eid1705.100754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Goyette-Desjardins G., Auger J. P., Xu J., Segura M., Gottschalk M. Streptococcus suis, an Important Pig Pathogen and Emerging Zoonotic Agent-an Update on the Worldwide Distribution Based on Serotyping and Sequence Typing. Emerging Microbes and Infections . 2014;3(1):e45–20. doi: 10.1038/emi.2014.45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ye C., Zhu X., Jing H., et al. Streptococcus suis Sequence Type 7 Outbreak. Emerging Infectious Diseases . 2006;12:1203–1208. doi: 10.3201/eid1208.060232. Sichuan, China. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liang P., Wang M., Gottschalk M., et al. Genomic and Pathogenic Investigations of Streptococcus suis Serotype 7 Population Derived From a Human Patient and Pigs. Emerging Microbes and Infections . 2021;10(1):1960–1974. doi: 10.1080/22221751.2021.1988725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kerdsin A., Oishi K., Sripakdee S., et al. Clonal Dissemination of Human Isolates of Streptococcus suis Serotype 14 in Thailand. Journal of Medical Microbiology . 2009;58(11):1508–1513. doi: 10.1099/jmm.0.013656-0. [DOI] [PubMed] [Google Scholar]
  • 18.Wang M., Du P., Wang J., et al. Genomic Epidemiology of Streptococcus suis Sequence Type 7 sporadic Infections in the Guangxi Zhuang Autonomous Region of China. Pathogens . 2019;8(4):p. 187. doi: 10.3390/pathogens8040187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Boueroy P., Brizuela J., Roodsant T. J., et al. Genomic Analysis and Virulence of Human Streptococcus suis Serotype 14. European Journal of Clinical Microbiology and Infectious Diseases . 2025;44(3):639–651. doi: 10.1007/s10096-024-05029-w. [DOI] [PubMed] [Google Scholar]
  • 20.Zhang C., Zhang Z., Song L., et al. Antimicrobial Resistance Profile and Genotypic Characteristics of Streptococcus suis Capsular Type 2 Isolated From Clinical Carrier Sows and Diseased Pigs in China. BioMed Research International . 2015 doi: 10.1155/2015/284303.284303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wick R. R., Judd L. M., Gorrie C. L., Holt K. E. Unicycler: Resolving Bacterial Genome Assemblies From Short and Long Sequencing Reads. Plos Computational Biology . 2017;13(6) doi: 10.1371/journal.pcbi.1005595.e1005595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bortolaia V., Kaas R. S., Ruppe E., et al. ResFinder 4.0 for Predictions of Phenotypes From Genotypes. Journal of Antimicrobial Chemotherapy . 2020;75(12):3491–3500. doi: 10.1093/jac/dkaa345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Roodsant T. J., Van Der Putten B. C. L., Tamminga S. M., Schultsz C., Van Der Ark K. C. H. Identification of Streptococcus suis Putative Zoonotic Virulence Factors: A Systematic Review and Genomic Meta-Analysis. Virulence . 2021;12(1):2787–2797. doi: 10.1080/21505594.2021.1985760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Price M. N., Dehal P. S., Arkin A. P. FastTree 2-Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE . 2010;5(3) doi: 10.1371/journal.pone.0009490.e9490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Letunic I., Bork P. Interactive Tree of Life (iTOL) v3: An Online Tool for the Display and Annotation of Phylogenetic and Other Trees. Nucleic Acids Research . 2016;44(W1):W242–245. doi: 10.1093/nar/gkw290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Xie J., Chen Y., Cai G., Cai R., Hu Z., Wang H. Tree Visualization By One Table (tvBOT): A Web Application for Visualizing, Modifying and Annotating Phylogenetic Trees. Nucleic Acids Research . 2023;51(W1):W587–w592. doi: 10.1093/nar/gkad359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.EUCAST. Breakpoint Tables for in Interpretation of MICs and Zone Diameters. 2025. version 15.0 https://eucast.org/clinical_breakpoints/
  • 28.Lachance C., Gottschalk M., Gerber P. P., Lemire P., Xu J., Segura M. Exacerbated Type II Interferon Response Drives Hypervirulence and Toxic Shock by an Emergent Epidemic Strain of Streptococcus suis. Infection and Immunity . 2013;81(6):1928–1939. doi: 10.1128/IAI.01317-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lachance C., Segura M., Gerber P. P., Xu J., Gottschalk M. Toll-Like Receptor 2-Independent Host Innate Immune Response against an Epidemic Strain of Streptococcus suis That Causes a Toxic Shock-Like Syndrome in Humans. PLoS One . 2013;8(5) doi: 10.1371/journal.pone.0065031.e65031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu Z., Xu Q., Liang P., et al. The Characteristics of Population Structure and Antimicrobial Resistance of Streptococcus suis Serotype 8, a Non-Negligible Pathotype. Transboundary and Emerging Diseases . 2022;69(5):e2495–e2505. doi: 10.1111/tbed.14592. [DOI] [PubMed] [Google Scholar]
  • 31.Wang X., Sun J., Bian C., et al. The Population Structure, Antimicrobial Resistance, and Pathogenicity of Streptococcus suis Cps31. Veterinary Microbiology . 2021;259 doi: 10.1016/j.vetmic.2021.109149.109149 [DOI] [PubMed] [Google Scholar]
  • 32.Zhu J., Wang J., Kang W., et al. Streptococcus suis Serotype 4: A Population With the Potential Pathogenicity in Humans and Pigs. Emerging Microbes and Infections . 2024;13(1) doi: 10.1080/22221751.2024.2352435.2352435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thu I. S. L., Tragoolpua K., Intorasoot S., et al. Direct Detection of Streptococcus suis From Cerebrospinal Fluid, Positive Hemoculture, and Simultaneous Differentiation of Serotypes 1, 1/2, 2, and 14 Within Single Reaction. Pathogens . 2021;10(8):p. 996. doi: 10.3390/pathogens10080996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kerdsin A., Dejsirilert S., Sawanpanyalert P., et al. Sepsis and Spontaneous Bacterial Peritonitis in Thailand. The Lancet . 2011;378(9794):p. 960. doi: 10.1016/S0140-6736(11)60923-9. [DOI] [PubMed] [Google Scholar]
  • 35.Kerdsin A., Takeuchi D., Nuangmek A., Akeda Y., Gottschalk M., Oishi K. Genotypic Comparison Between Streptococcus suis Isolated From Pigs and Humans in Thailand. Pathogens . 2020;9(1):p. 50. doi: 10.3390/pathogens9010050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kerdsin A., Akeda Y., Takeuchi D., Dejsirilert S., Gottschalk M., Oishi K. Genotypic Diversity of Streptococcus suis Strains Isolated From Humans in Thailand. European Journal of Clinical Microbiology and Infectious Diseases . 2018;37(5):917–925. doi: 10.1007/s10096-018-3208-8. [DOI] [PubMed] [Google Scholar]
  • 37.Huang J., Ma J., Shang K., et al. Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci. Frontiers in Cellular and Infection Microbiology . 2016;6:p. 118. doi: 10.3389/fcimb.2016.00118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Haenni M., Lupo A., Madec J. Y. Antimicrobial Resistance in Streptococcus Spp. Microbiology spectrum . 2018;6(2) doi: 10.1128/microbiolspec.arba-0008-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Palmieri C., Varaldo P. E., Facinelli B. Streptococcus suis, an Emerging Drug-Resistant Animal and Human Pathogen. Frontiers in Microbiology . 2011;2:p. 235. doi: 10.3389/fmicb.2011.00235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Princivalli M. S., Palmieri C., Magi G., et al. Genetic Diversity of Streptococcus suis Clinical Isolates from Pigs and Humans in Italy (2003-2007. Eurosurveillance . 2009;14(33) doi: 10.2807/ese.14.33.19310-en.19310 [DOI] [PubMed] [Google Scholar]
  • 41.Chen L., Song Y., Wei Z., He H., Zhang A., Jin M. Antimicrobial Susceptibility, Tetracycline and Erythromycin Resistance Genes, and Multilocus Sequence Typing of Streptococcus suis Isolates From Diseased Pigs in China. Journal of Veterinary Medical Science . 2013;75(5):583–587. doi: 10.1292/jvms.12-0279. [DOI] [PubMed] [Google Scholar]
  • 42.Libante V., Nombre Y., Coluzzi C., et al. Chromosomal Conjugative and Mobilizable Elements in Streptococcus suis: Major Actors in the Spreading of Antimicrobial Resistance and Bacteriocin Synthesis Genes. Pathogens . 2020;9(1):p. 22. doi: 10.3390/pathogens9010022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Shewell L. K., Day C. J., Jen F. E., et al. All Major Cholesterol-Dependent Cytolysins use Glycans as Cellular Receptors. Science Advances . 2020;6(21) doi: 10.1126/sciadv.aaz4926.eaaz4926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li Q., Liu H., Du D., et al. Corrigendum: Identification of Novel Laminin- and Fibronectin-Binding Proteins by Far-Western Blot: Capturing the Adhesins of Streptococcus suis Type 2. Frontiers in Cellular and Infection Microbiology . 2020;10 doi: 10.3389/fcimb.2020.593413.593413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Scherrer S., Rosato G., Spoerry Serrano N., et al. Population Structure, Genetic Diversity and Pathotypes of Streptococcus suis Isolated During the Last 13 Years From Diseased Pigs in Switzerland. Veterinary Research . 2020;51(1):p. 85. doi: 10.1186/s13567-020-00813-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Dong X., Chao Y., Zhou Y., et al. The Global Emergence of a Novel Streptococcus suis Clade Associated With Human Infections. EMBO Molecular Medicine . 2021;13(7) doi: 10.15252/emmm.202013810.e13810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Obradovic M. R., Segura M., Segalés J., Gottschalk M. Review of the Speculative Role of Co-Infections in Streptococcus suis-Associated Diseases in Pigs. Veterinary Research . 2021;52(1):p. 49. doi: 10.1186/s13567-021-00918-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information 1

Table S1: The distribution of 55 putative virulence factors in serotype 14 S. suis.

5779652.f1.xlsx (27.5KB, xlsx)
Supporting Information 2

Table S2: The background information of 125 serotype 14 S. suis strains.

5779652.f2.xlsx (19.3KB, xlsx)
Supporting Information 3

Table S3: The background information of 318 ST7 S. suis strains.

5779652.f3.xlsx (8.4MB, xlsx)

Data Availability Statement

The data are available upon request from the authors.

Articles from Transboundary and Emerging Diseases are provided here courtesy of Wiley

RESOURCES