Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Sep 3.
Published in final edited form as: J Biol Rhythms. 2025 Aug 29;40(6):574–593. doi: 10.1177/07487304251361579

miR-124 acts during Drosophila development to determine the phase of adult circadian behavior

Yongliang Xia 1, Chenghao Chen 1, Patrick Emery 1,*
PMCID: PMC12404682  NIHMSID: NIHMS2096858  PMID: 40879142

Abstract

The circadian clock enables organisms to optimize their metabolism, physiology, and behavior with the time-of-day. However, circadian rhythms benefit organisms only if they are properly synchronized with the day/night cycle; circadian misalignment can have detrimental effects on animals’ wellbeing and survival. We previously showed that in Drosophila, loss of the microRNA miR-124 advances the phase of circadian evening locomotor activity by several hours under constant darkness conditions. Interestingly, we now report that loss of miR-124 also delays morning activity under a light/dark cycle with a short photoperiod. We recapitulated these opposite phase phenotypes by eliminating miR-124 during larval development, but not when this microRNA is lost during pupation to adulthood. The loss of miR-124 results in significant miswiring within the circadian neural network and severely alters neural activity rhythms in the ventral Lateral Neurons (s-LNvs) and the posterior Dorsal Neurons 1 (DN1ps), which control the timing of morning and evening activity. Silencing the s-LNvs in miR-124 mutant flies restores the phase of evening activity, while activating the DN1ps rescues the phases of both morning and evening activities. Our findings thus reveal the pivotal role of miR-124 in sculpting the Drosophila circadian neural network during development and its long-lasting impact on circuit activity and adult circadian behavior.

Keywords: Drosophila, miR-124, circadian behavior, circadian phase, neural network development

Introduction

Most living organisms, including bacteria, fungi, plants, insects, mammals, and humans, experience daily changes in their surrounding environment, such as variations in light and temperature (Panda et al., 2002; Bhadra et al., 2017). To adapt to and anticipate these environmental cycles, they have evolved an internal timekeeping system known as the circadian clock. This system helps organisms orchestrate their temporal relationship with the ever-changing environment, enhancing their efficiency in resource utilization and activity scheduling. However, circadian clocks remain rhythmic with a period of ca. 24-hour even under constant environmental conditions, such as constant darkness (DD). Thus, this intrinsic rhythm allows organisms to sustain biological processes that rely on timing, ensuring continuity in their behavioral patterns and physiological responses, even in the absence of external Zeitgebers (Pittendrigh and Minis, 1972; Sehgal, 2017; Patke et al., 2020). These circadian clocks consist of self-sustained transcriptional feedback loops that function as endogenous oscillators, driving the rhythmic expression of a wide range of genes involved in diverse biological processes, from metabolic pathways to physiology and complex behaviors (Young and Kay, 2001; Zhang et al., 2014). In Drosophila melanogaster, the molecular clock comprises three interconnected feedback loops (Somers et al., 2018). In the core loop, the transcriptional activators CLOCK (CLK) and CYCLE (CYC) dimerize via PAS domains to drive the transcription of two genes encoding transcriptional repressors, PERIOD (PER) and TIMELESS (TIM). These repressors form a complex that translocates into the nucleus and represses CLK/CYC activity (Benito et al., 2007; Allada and Chung, 2010). This molecular clockwork is found in approximately 240 neurons in the adult Drosophila brain, which can be classified into several subsets based on their anatomical localization and size (Nitabach and Taghert, 2008; Reinhard et al., 2024). Different groups of clock neurons display distinct gene expression patterns (Ma et al., 2021) and phases of neural activity, which regulate specific aspects of daily locomotor rhythms, such as the timing of morning and evening activities (Grima et al., 2004; Stoleru et al., 2004; Liang et al., 2016). Through communication via neuropeptides and neurotransmitters, the ca. 240 clock neurons form a plastic network that adapts to different environmental conditions (Muraro et al., 2013; Chatterjee et al., 2018).

The synchrony between intrinsic circadian clock and rhythmic environmental cues provides an adaptive advantage, while their misalignment has detrimental effects on survival and health, including in humans (Roenneberg and Merrow, 2016; Walker et al., 2020; Fishbein et al., 2021). Evidence from various species also shows that mutants with altered circadian periodicity, when placed in non-matching environmental cycles, experience a reduction in lifespan. In contrast, synchrony between the circadian clock and environmental cycles extends lifespan and improves fitness (Pittendrigh and Minis, 1972; Ouyang et al., 1998; Dodd et al., 2005; Wyse et al., 2010). Both in nature and in laboratory conditions, individuals with circadian periods closely matching environmental cycles are favored under competition (Kyriacou et al., 2008; Kannan et al., 2012). For human beings, besides circadian gene mutations, modern lifestyles significantly contribute to the disharmony between our body clocks and external time. Factors such as untimely eating, shift work, travel across different time zones, social jetlag, and extended artificial lighting disrupt the proper entrainment of our circadian systems to local environmental cycles (Roenneberg et al., 2012; Chang et al., 2015; Fishbein et al., 2021). This irregularity prevents our circadian clocks from functioning optimally, leading to various health issues. It is therefore essential to understand how the phase of various circadian rhythms is matched with the day/night cycle.

We now have a good understanding of the mechanisms underlying circadian molecular clocks and their entrainment to environmental cycles. However, the mechanisms by which these clocks generate properly phased circadian outputs, such as behavioral rhythms, is not well understood. Genetic screens conducted for example in Drosophila have been remarkably efficient at identifying circadian pacemaker genes. A great number of period altering mutants have been isolated. As expected, such mutants usually do not just affect the period of circadian rhythms under constant conditions, but also their phase when mutant animals are exposed to environmental cycles. Most famously perhaps, flies with long or short period mutations in the per gene display delayed and advanced circadian phases under Light:Dark (LD) cycles, respectively (Konopka et al., 1994; Horn et al., 2019). Gene mutants that exclusively affect the phase of a circadian rhythm, without impacting the period of the underlying circadian pacemaker, are rather rare. This explains why our knowledge of the mechanisms by which the circadian pacemaker determines the phase of overt circadian rhythms is quite limited.

Circadian behavior in Drosophila is characterized by two peaks of activity at dawn and dusk. These peaks are observed under both LD and DD conditions, although the morning peak of activity tends to progressively fade under constant darkness (Dubowy and Sehgal, 2017). We and others previously reported that the loss of miR-124 in Drosophila leads to an advanced evening phase under DD conditions, but importantly does not impact the period and phase of the molecular clock in the circadian neurons that controls rhythmic behavior (Garaulet et al., 2016; Zhang et al., 2016). miR-124 thus provides an entry point to elucidate the mechanism of circadian phase determination.

miR-124 is an evolutionarily conserved neuronal microRNA (Lagos-Quintana et al., 2002; Conaco et al., 2006). Its abundant expression in the CNS suggests an indispensable role in promoting and maintaining normal CNS function. In vertebrates, miR-124 is critical for various physiological processes, including neural stem cell proliferation, neuronal differentiation, neurite growth and neuron migration (Gu et al., 2023; Zhang et al., 2023). Abnormal expression of miR-124 or its target genes has been linked to numerous neurodevelopmental and neurodegenerative disorders (Sun et al., 2015; Xu et al., 2022). Interestingly, miR-124 appears to be less critical for the central nervous system of invertebrates. In C. elegans, miR-124 knockout mutants are viable and show no gross abnormalities, nor are there evident defects in the number or differentiation of sensory neurons, where miR-124 is predominantly expressed (Clark et al., 2010). In Drosophila, previous work indicated that loss of miR-124 leads only to mild neurodevelopmental defects. Specifically, the absence of miR-124 leads to a reduction in the branch length and bouton numbers of neuromuscular junctions (NMJ) 6/7, as well as a decrease in the branch numbers of dendritic arborization (DA) neuron ddaE in the third larvae (Wang et al., 2014). Additionally, it increases the variability in dendrite numbers of sensory neurons, particularly ddaD neurons, in larvae (Sun et al., 2012). Despite these subtle developmental abnormalities, mutant flies display a range of physiological and behavioral impairments, including deficits in locomotion, flight ability, reduced lifespan, and decreased fertility (Sun et al., 2012; Weng et al., 2013; Wang et al., 2014; Kong et al., 2015).

In this study, we utilized CRISPR/Cas9 to disrupt miR-124 in neurons. This approach revealed that miR-124 functions during development to regulate circadian phase. Additionally, the loss of miR-124 resulted in important miswiring of the circadian circuits, and abnormal activity of neurons controlling morning and evening activities. These findings suggest a critical role for miR-124 in the development and proper functioning of the circadian neural network.

Material and Methods

Drosophila strains and husbandry

All flies were reared on standard low yeast brown food at 25°C under 12:12 light/dark cycles unless otherwise specified. The following fly lines were used for this study: w1118; miR-124KO and rescued miR-124KO (39N16) were generated by Sun et al. (Sun et al., 2012), y w; Pdf-GAL4/CyO was described by Renn et al. (Renn et al., 1999), clk856-GAL4 and MB122B-GAL4 have been described previously (Gummadova et al., 2009; Guo et al., 2017), UAS-Kir2.1 was a gift from Dr. Michael Rosbash, UAS-dTrpA1 was from Dr. Paul Garrity. Clk4.1M-GAL4 was generated by Zhang et al (Zhang et al., 2010b). UAS-uMCas9 (VDRC 340009) and VT027231-GAL4 (VDRC 205530) were obtained from the Vienna Drosophila Resource Center (VDRC). The following strains were ordered from the Bloomington Stock Center: Clk856-GAL4 (BDSC 93198), R18H11-GAL4 (BDSC 48832), UAS-CaMPARI2 (BDSC 78316), elav-GAL4;tubP-GAL80ts (BDSC 67058), UAS-cas9 (BDSC 58985), UAS-myrGFP.QUAS-mtdTomato-3xHA;trans-Tango (BDSC 77124), w[*];trans-Tango (BDSC 77123), UAS-myrGFP P,QUAS-mtomato-3xHA (BDSC 77479), elav-GAL4;UAS-cas9.P2 (BDSC 67073), GMR56H10-GAL4 (BDSC 61644), GMR92G05-GAL4 (BDSC 48416), GMR57F07-GAL4 (BDSC 46389), Hug-GAL4.S3 (BDSC 58769), Dh44-GAL4.TH (BDSC 51987), GMR21A04-GAL4 (BDSC 49854), ple-2A-GAL4 (BDSC 86289).

Fly line generation

We constructed the UAS-miR-124-sgRNA plasmid by following the protocol published by F. Port and S. L. Bullock (Port and Bullock, 2016). Briefly, three gRNAs targeting pre-miR-124 were selected according to flyCRISPR (https://flycrispr.org/target-finder/). GAL4/UAS controlled gRNA-expressing pCFD6 vector (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. Two inserts carrying the three gRNAs were generated by PCR reactions using pCFD6 as the template. The resulting two PCR fragments and linearized pCFD6 were then assembled in a single reaction by NEBuilder HiFi DNA Assembly (NEB #E2621S). The construct was inserted into the third chromosome using phiC31 integrase (attP2, BL8622) by the BestGene Inc (Chino Hills, CA).

The following gRNA and primers sequences were used:

gRNA1: TTTCTCCTGGTATCCACTGTAGG

gRNA2: TATTTCCACCATAAGGCACGCGG

gRNA3: TGTAGAACTGCGTTCGCTCTTGG

gRNA1F: CGGCCCGGGTTCGATTCCCGGCCGATGCATTTCTCCTGGTATCCACTGTGTTTCAGAGCTATGCTGGAAAC

gRNA1R: CGTGCCTTATGGTGGAAATA TGCACCAGCCGGGAATCGAACC

gRNA2F: TATTTCCACCATAAGGCACGGTTTCAGAGCTATGCTGGAAAC

gRNA2R:ATTTTAACTTGCTATTTCTAGCTCTAAAACAGAGCGAACGCAGTTCTACATGCACCAGCCGGGAATCGAACC

RNA extraction and qRT-PCR

miR-124 expression was measured with the miScript PCR System (Qiagen). Small RNA including miRNA from fly heads was extracted using miRNeasy Micro Kit (QIAGEN, Cat No. 217084) following the manufacturer’s instructions. The cDNA was synthesized using miScript II RT kit (QIAGEN, Cat No. 218161) according to the supplier’s protocol. To quantify mature miR-124, qRT-PCR was performed by using miScript SYBR Green PCR Kit (QIAGEN, Cat No. 218073) and Bio-Rad thermocycler CFX96. Reaction mix contained a universal reverse primer and a miR-124-specific forward primer provided by QIAGEN.

Behavior recording and data analysis

Individual adult male flies (aged 2–7 days) were used to measure locomotor activity rhythms. In most experiments, flies were entrained to a 12:12 LD cycle for 3 days followed by at least 6 days of DD at 25°C, in Percival I36-LL incubators. To test flies under long or short photoperiod, 6h:18h LD or 16h:8h LD cycles at 25°C were used. The circadian locomotor activity of flies expressing UAS-TrpA1 was monitored at 27°C to induce moderate neuronal activity in DN1p neurons. Locomotor activity was recorded in Trikinetics Drosophila Activity Monitors (Waltham, MA). Group activity for each genotype was analyzed using the FaasX software (Grima et al., 2002). Under LD conditions, data from three days were analyzed. For DD conditions data from 4–5 days of activity were used to determine the evening activity phase, unless otherwise indicated. Morning anticipatory index under 12:12 LD cycles was determined with the dedicated FaasX routine, which divides the average activity 3h prior to lights-on with the activity 6h before lights-on.

Under 6:18 LD cycles, the phase of the M-peak was quantified as the highest average activity time point before ZT0. Similarly, the E-peak phase was calculated as the highest average activity time point before CT12. All phase quantifications were manually performed by an observer who was blinded to the genotypes, using FAAS graphic outputs.

The Morning/Evening (M/E) activity ratio (figure 3F”) was calculated by dividing the average morning activity (CT0–2) with the average activity over 2.5 hours centered around the evening peak of activity.

Fig. 3. Loss of miR-124 represses neuronal activity in DN1pEs and DN1pMs.

Fig. 3.

A-B, Confocal imaging of DN1pE (A) and DN1pM (B) calcium dynamics in WT and mutant brains dissected at different time points (circadian time, CT) during the first day of DD. C-D, Quantification of CaMPARI photoconversion efficiency across the indicated circadian time points in DN1pEs (C) and DN1pMs (D) (n = 6–8 hemispheres per time point). Error bars indicate SEM in C and D. Two-way ANOVA with Tukey’s post hoc test. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. These comparisons are between genotypes for each time point. ANOVA also revealed time-dependent differences for both DN1pEs and DN1pMs in wild-type flies, but not in mutant animals (# signs: comparison with peak ratio). E-G, Representative locomotor activity profiles of miR-124KO flies with activation of DN1ps (and their control) in 12:12 LD (E), first day of DD (F) and short photoperiods (G) (E-F, n ⩾ 16 per genotype; G, n ⩾ 9 per genotype). E’-G’, Quantification of morning anticipation index in 12:12 LD (E’), evening peak phase in DD (relative to the subjective end of the day) (F’) and morning peak phase under 6:18 LD (F’). Because behavioral rhythms degrade rapidly in DD upon DN1p activation in miR-124KO mutants, we used only the first day of DD to assess changes in evening phase. F”, Quantification of the ratio between morning and evening peak activity under DD1. G”, Since morning activity was quite flat in miR-124 mutant flies with re-activated DN1ps, we also measured the time at which 90% of morning peak activity was reached in 6:18 LD. This confirmed that activity phase was indeed advanced in these flies compared to control. Legends for E’-G’ and F”-G” are above the panels, next to panel D. Mean ± SEM is shown in E’-G’. One-way ANOVA with Tukey’s post hoc test. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. (N ⩾ 3 independent behavioral experiments).

Conditional miR-124 knock-out using the TARGET system

To induce miR-124 knock-outs in adult flies only with the TAGRET system, flies of experimental genotypes were maintained at 18°C (restrictive temperature, GAL80ts active, no gRNA expression) during their entire development, and moved to 29°C (permissive temperature, GAL80ts inactive, gRNA expression) three days prior to the beginning of the locomotor activity assays. Control flies were exposed to the same temperature conditions. To induce the knock-out early during development, flies were exposed to 29°C throughout their development and adulthood.

To induce miR-124 deletion at specific developmental stages, parental flies were kept at 25°C for 24 hours to allow for mating and egg laying. Eggs were then moved to 18°C to cause GAL80ts repression and thus block expression of the miR-124 gRNAs. At specific developmental stages, animals were transferred to 29°C until adulthood, to inactive GAL80ts and thus induce gRNA expression. Developmental stages were visually assessed, and genetic controls were raised alongside experimental flies to account for any temperature effects on development.

Immunohistochemistry and Image Analysis

Third instar larvae or adult fly heads were dissected in dissection buffer (KCl 13.6g, NaCl 2.7g, CaCl2 0.33g, Tris 1.21g in 1L water, pH 7.2) and immediately fixed in 4% paraformaldehyde diluted in PBS for 30 minutes at room temperature. Following two quick rinses, brains were washed three times with PBST (0.1% Triton X-100) for 10 minutes each. The brains were then blocked in 10% normal donkey serum in PBST for one hour at room temperature, followed by incubation with the primary antibodies at 4°C overnight. Afterward, the brains were washed six times in PBST (20 minutes each) at room temperature and incubated with the secondary antibodies at 4°C overnight. Finally, the brains were washed six times in PBST (20 minutes each) at room temperature and mounted on glass slides using Vectashield mounting medium (Vector Laboratories). Primary antibodies were: mouse anti-PDF (Developmental Studies Hybridoma Bank, PDF; 1:400), guinea pig anti-TIM (Rakshit et al., 2012) (1:400), rabbit anti-GFP (Thermo Fisher Scientific, A11122; 1:1000), mouse anti-HA (Covance, MMS-101P; 1:250). Secondary antibodies were diluted at 1:200–400 and were as follows: donkey anti-rabbit Alexa Fluor® 488, Goat anti-mouse Rhodamine Red, donkey anti-mouse Alexa Fluor® 546, donkey anti-guinea pig Alexa Fluor® 647. For TIM staining, flies were dissected at ZT 21, when TIM levels are high, after 3 days of LD entrainment to enhance signal detection.

All brains were imaged using a Zeiss LSM700 confocal microscope with ZEN software, or Zeiss LSM800 confocal microscope with ZEN blue software, keeping the laser settings constant within each experiment. Images were processed using Fiji software (http://fiji.sc). To count the number of DN1ps postsynaptically connected with the s-LNvs, an observer blind to genotypes counted the number of DN1s that showed postsynaptic trans-tango signal surrounding nuclear TIM signal.

CaMPARI imaging:

Flies expressing UAS-CaMPARI crossed with clk856-GAL4 (Gummadova et al., 2009) were used to monitor calcium dynamics in clock neurons. Male progenies were entrained to 12h:12h light-dark cycles at 25°C for 4–5 days before transitioning to constant darkness (DD) at the same temperature. Flies were collected at the indicated time points during the first day of DD.

Flies were mounted on Petri dishes and exposed to UV light (395 nm, 10mW/cm2) for 5 minutes to induce CaMPARI’s calcium-dependent photoconversion. Their brains were then immediately dissected in cold extracellular fly buffer (Chen et al., 2021) under dim red light. Brain tissues were then imaged using a Zeiss 800 confocal microscope.

Analysis involved processing images in ImageJ, with background subtraction to measure the green (F_green) and red (F_red) fluorescence intensities in target neurons. The CaMPARI photoconversion efficiency was calculated as the F_red/F_green ratio.

Statistical analysis;

Two-sample comparisons were performed using a two-tailed Student’s t-test. For multiple group comparisons, one-way or two-way ANOVA followed by Tukey’s post hoc test was used. Statistical significance was defined as P < 0.05. Error bars represent the standard error of the mean (SEM).

Results

Loss of miR-124 causes opposite shifts in morning and evening phases

Previous studies showed that loss of miR-124 results in an advanced phase of evening activity under DD, without affecting the free-running period of activity rhythms (Garaulet et al., 2016; Zhang et al., 2016). However, under a 12 h/12h LD cycle, miR-124KO flies display a completely normal evening peak phase, indicating that light input can correct the phase defect. This likely occurs through plastic recruitment of different evening neurons under LD and DD (Chatterjee et al., 2018).

To further investigate the effects of light on circadian phase, we examined the circadian locomotor activity of miR-124KO flies under different LD cycles. Consistent with previous studies (Garaulet et al., 2016; Zhang et al., 2016), under a regular LD cycle (LD12:12), the phase of evening activity was not affected in miR-124KO flies, although its amplitude was reduced (Fig. 1A). Also, both morning activity and the startle response resulting from the light-on transition were absent in the mutants (Fig. 1A and 1A’). Nocturnal activity was also elevated in these mutants. Following release into DD, miR-124 mutants displayed as previously observed (Garaulet et al., 2016; Zhang et al., 2016) a unimodal activity pattern with a markedly broad and ca. 5h advanced evening peak (Fig. 1B and 1B’). These defects were corrected with a transgene containing miR-124. Similar phenotypes were observed under long photoperiods (LD16:8; Fig. S1A). Both the morning anticipation and the light-on startle response were lost, but the evening activity phase was comparable to that of wild-type flies. In contrast, miR-124KO flies showed robust morning activity under short photoperiods (LD 6:18; Fig. 1C). However, its phase was severely delayed compared to wild-type controls and rescued miR-124 mutant flies (Fig. 1C1C’). Thus, while loss of miR-124 advances evening activity in DD, it delays the morning peak of activity under LD cycles. We note that a truncated, delayed morning peak of activity was actually also detectable in perS;miR-124KO double mutant flies in our previous study (Zhang et al., 2016). We thus conclude that miR-124 mutants can display a delayed morning peak of activity, as long as its onset falls within the dark period (Fig. 1E and S1B). Under LD12:12, it falls during the light period and is thus suppressed.

Fig. 1. Loss of miR-124 shifts morning and evening peak phases in opposite directions.

Fig. 1.

A-C, Panels depict behavior of w1118, miR-124KO, and rescued miR-124KO male flies. The rescued flies contain a 19 kb genomic transgene [39N16]. Open arrows indicate the morning peaks of activity, and regular arrows the evening peak of activity. This will be the case throughout this report.

A, Averaged locomotor activity profiles under 12:12 LD cycle. White bars indicate activity during day, black bars at night (n ⩾ 10 per genotype). A’, Quantification of morning anticipation index under 12:12 LD. B, Averaged locomotor activity profiles under DD (n ⩾ 8 per genotype). Gray shades represent the subjective night. B, Quantification of evening peak phase under DD, relative to the subjective light-off transition. C, Averaged locomotor activity profiles under short photoperiods (6:18 LD) (n ⩾ 10 per genotype). C’, Quantification of morning peak phase under short photoperiods is plotted, relative to the light-on transition. D, Quantification of free-running periods over five DD cycles. E, Schematic diagram summarizing the distinct locomotor activity patterns of miR-124KO mutants compared to WT flies under different environmental conditions. White bars indicate light phase (day), black bars indicate dark phase (night). Quantifications are mean ± SEM from at least 3 independent behavioral experiments, and behavioral panels are from a single representative experiment. This will be the case throughout this report. One-way ANOVA with Tukey’s post hoc test. ***, P<0.001; ****, P<0.0001; ns, not significant.

In summary, miR-124KO flies display specific behavioral phenotypes under various environmental conditions, due to changes in activity phase. In both normal LD cycles and long-day conditions, miR-124KO flies exhibit a unimodal activity pattern due to the absence of the morning peak and the lights-on startle response, while the evening phase remains normal. Strikingly, the loss of miR-124 advances the evening activity in DD, but delays morning activity under short-day conditions (Fig. 1E). It is possible that morning activity is also delayed under DD and merges with the higher amplitude advanced evening activity, thus contributing to the broad peak observed under these conditions in miR-124KO flies. Because neither the free-running period nor the phase of the neural molecular clocks are affected in miR-124KO mutants (Garaulet et al., 2016; Zhang et al., 2016) (Fig. 1D), this indicates that miR-124 specifically regulates the circadian phase of rhythmic behavior.

Loss of miR-124 disrupts the activity of circadian pacemaker neurons

Although the molecular clocks of various circadian pacemaker neurons are synchronized, their Ca2+ oscillations and thus their neural activity are asynchronous. These Ca2+ rhythms usually coincide with locomotor activity bouts mediated by the corresponding neural pacemakers (Liang et al., 2016). Since molecular clocks in all pacemaker groups function normally in miR-124KO flies (Garaulet et al., 2016; Zhang et al., 2016), we investigated whether neuronal activities in circadian clusters were altered in miR-124KO mutants. We expressed the photoconvertible protein CaMPARI (Fosque et al., 2015) (Calcium Modulated Photoactivatable Ratiometric Integrator) to monitor the integrated calcium activity of different pacemaker groups over distinct time points. These experiments were conducted under DD, to avoid acute effects of light on neuronal activity. We first detected calcium activity in s-LNvs, as they are responsible for rhythmicity in DD, and dominate under short photoperiods (Stoleru et al., 2007), conditions where miR-124KO flies show behavioral phase defects (Fig. 1B1C and 1B’1C’). The s-LNvs also control the morning peak of activity, which is phase-shifted in miR-124 mutant flies (Fig. 1C and 1C’). In wild-type flies, Ca2+ levels in the s-LNvs peaked near the end of the night (Fig. 2A2B), as previously reported, consistent with their role as morning anticipation-driving neurons (Grima et al., 2004; Stoleru et al., 2004; Liang et al., 2016). Intriguingly, in miR-124KO mutants, the Ca2+ peak of s-LNvs occurred during the subjective day under DD (Fig. 2A and 2B), coinciding with the broad peak of locomotor activity observed under these conditions (Fig. 1B and 1B’). To determine whether the shifted neuronal activity in s-LNvs is responsible for the evening phase advance of behavioral activity in miR-124KO flies under DD, we inhibited the s-LNvs by expressing the inwardly rectifying K+ channel Kir2.1 (Ho et al., 1993) in miR-124KO mutants. Indeed, repression of s-LNvs in the miR-124KO was able to correct the evening phase (Fig. 2C2D). Note that behavior was observed during the first day of DD only, and we could not assess morning activity phase under LD since inhibition of s-LNvs causes behavioral arrhythmicity under prolonged DD exposure and blunts morning activity (Nitabach et al., 2002; Depetris-Chauvin et al., 2011).

Fig. 2. Loss of miR-124 shifts the neuronal activity of s-LNvs.

Fig. 2.

A, Confocal imaging of s-LNv calcium dynamics in WT and mutant brains dissected at different time points (circadian time, CT) during the first day of DD. B, Quantification of CaMPARI photoconversion efficiency across the indicated circadian time points (n = 6–8 hemispheres per time point). Error bars indicate SEM. Two-way ANOVA with Tukey’s post hoc test. **p<0.01, #p<0.05. Comparisons are between genotypes for each time point. ANOVA also revealed statistically significant time-dependent differences in miR-124 mutants (# signs, comparison with trough ratio). Wild-type animals showed as expected (Liang et al., 2016; Liang et al., 2019) the highest CAMPARU ratio (i.e. highest neural activity) at ZT0, although statistical significance was not reached as variability was unusually high for this time point (P=0.09). C, Averaged locomotor behavior under three days of LD cycles (upper panel) and during the first day of DD (lower panel) for flies expressing Kir2.1 in M-cells, and their controls (n ⩾ 10 per genotype). D, Quantification of evening peak phase on the first day of DD (DD1; N ⩾ 3 independent experiments). Only the first day of DD was used, because behavioral rhythms of flies expressing Kir2.1 in M-cells degrade rapidly in DD. Error bars indicate SEM. One-way ANOVA with Tukey’s post hoc test. ***, P<0.001; ns, not significant.

A subset of the posterior dorsal neurons 1 (DN1ps), which includes both morning- and evening-activity promoting cells, is directly targeted by the s-LNvs (Zhang et al., 2010a; Zhang et al., 2010b; Chatterjee et al., 2018). We thus also investigated the role of miR-124 in regulating neural activity in these neurons. In wild-type flies, DN1p-evening neurons (DN1pE) reach Ca2+ peak levels in the middle of the day (Fig. 3A and 3C), while DN1p-morning neurons (DN1pM) peak during the late night (Fig. 3B and 3D). This is consistent with their respective roles in morning and evening anticipatory activities. Surprisingly, in the miR-124KO mutants, neural activity was severely depressed at all time points in both DN1p subtypes (Fig. 3A3D). When we simultaneously activated both DN1pMs and DN1pEs using the Clk4.1M-GAL4 driver (Zhang et al., 2010b), the behavioral phenotypes of miR-124 mutants were partially corrected (Fig. 3E3G and 3E’3G’). In LD and DD conditions, miR-124KO flies now displayed bimodal activity patterns due to the re-emergence of morning anticipatory activity combined with reduction in nighttime activity (Fig. 3E3F and 3E’3G’). Evening and morning activity were of approximately equal amplitude on DD1 (Fig. 3F), and morning activity and evening phase were significantly improved (Fig. 3E’F’ and 3F”). Under short photoperiod conditions, miR-124KO mutants with activated DN1pMs and DN1pEs showed advanced morning activity phase compared to their controls (Fig. 3G, 3G’ and 3G”). However, the amplitude was not fully restored, presumably because of the constant activation of DN1ps. Notably also, miR-124KO flies, which are as mentioned above more nocturnal than control animals, switched to a wild-type-like diurnal activity pattern upon activation of DN1p neurons. As expected, the lights-on startle responses of miR-124KO mutants could not be restored by DN1p activation or s-LNv inhibition (Fig. 2C, 3E and 3G). Indeed, these responses are not controlled by the circadian clock (Allada et al., 1998).

Taken together, these results demonstrate that the loss of miR-124 either shifts or suppresses the neuronal activities of circadian clusters. Silencing s-LNvs or activating DN1ps in miR-124KO mutants can correct phase defects in morning and evening activities, indicating that miR-124 regulates circadian phases through these neurons and their activity.

Pan-neuronal CRISPR/Cas9-mediated disruption of miR-124 mimics miR-124KO

To study further the mechanisms by which miR-124 regulates circadian behavior phase, we turned to conditional CRISPR/Cas9-mediated gene knock-out. Indeed, this approach works efficiently in the Drosophila circadian neural network (Delventhal et al., 2019; Schlichting et al., 2019a). We followed the protocol provided by Port and Bullock (Port and Bullock, 2016), and designed three sgRNAs targeting three different regions of the miR-124 precursor (pre-miR-124) to ensure efficient gene disruption (Fig. 4A). One of the three gRNAs targeted the coding sequence for the mature miR-124. Given that miR-124 is a neuron-specific miRNA (Weng and Cohen, 2012), we expressed miR-124-sgRNAs and Cas9 pan-neuronally with the elav-GAL4 driver. This led to a substantial reduction of miR-124 level, which was barely detectable in head extracts (Fig. 4B). As expected, miR-124CRISPR flies showed very similar behavioral phenotypes to those of miR-124KO mutants under LD cycles with regular (Fig. 4C and 4C’) or short photoperiod (Fig. 4E and 4E’), and under DD (Fig. 4D and 4D’). Given that pan-neuronal CRISPR-mediated miR-124 deletion fully recapitulates the phenotypes observed in the constitutive KO mutants, we infer that the molecular clock is also unaffected in circadian neurons of the conditional KO flies, as observed in the constitutive mutants (Garaulet et al., 2016; Zhang et al., 2016).

Fig. 4. Pan–neuronal CRISPR-mediated disruption of miR-124 phenocopies miR-124KO.

Fig. 4.

A, Diagram showing three sgRNA target sites for pre-miR-124. B, Quantitative real-time PCR analysis of miR-124 abundance in deletion mutants and controls. elav indicates the elav-GAL4 driver, miR-124CRISPR refers to the genotype UAS-Cas9/+;UAS-tgRNA124/+. C-E, Averaged locomotor behavior of flies with elav-Gal4-driven disruption of miR-124 in 12:12 LD (C), DD (D) and 6:18 LD (E) (C-E, n ⩾ 10 per genotype). See also Figure S2 for additional data. C’-E’, Quantifications of morning anticipation index in 12:12 LD (C’), evening peak phase under DD (D’) and morning peak phase in short photoperiods (E’) (N = 3 independent behavioral experiments). The legends for C’-E’ are above the panels.

Error bars represent SEM. One-way ANOVA followed by a Tukey post-hoc test was performed. **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant.

Taken together, these data demonstrate that miR-124 acts in neurons to regulate circadian phase, consistent with its role as a conserved neuron-specific microRNA. Additionally, CRISPR/Cas9-mediated miR-124 deletion in neurons is highly efficient and can thus be used to study miR-124 temporal and spatial requirements.

Developmental miR-124 expression is essential for properly phased adult circadian behavior

Next, we attempted to narrow down the specific neurons required for miR-124-mediated circadian phase regulation by conducting a neuronal GAL4 screen. We crossed flies carrying both UAS-Cas9 and UAS-miR-124-sgRNA transgenes with various GAL4 lines, targeting clock neurons (Tataroglu and Emery, 2014) and non-clock neurons related to circadian output pathways (Cavanaugh et al., 2014; Cavey et al., 2016; King et al., 2017; Liang et al., 2019), to disrupt miR-124 in these neurons. However, none of these GAL4 lines recapitulated the behavioral defects observed in pan-neuronal miR-124CRISPR flies (Fig. S2). The elav-GAL4 line we used is an enhancer trap line that fully mirrors the expression pattern of endogenous elav (Berger et al., 2007), with expression first detected in the embryonic nervous system at stage 12. The absence of phenotype with the other GAL4 lines we tested might thus be because these lines are expressed too late during the development of the relevant neurons. To test whether miR-124 is indeed required early during development, we employed the temporal and regional gene expression targeting (TARGET) system (McGuire et al., 2004) to induce miR-124 deletion at different developmental stages. Pan-neuronal disruption during development advanced evening phase in DD (Fig. 5B and 5B’), delayed morning phase under short photoperiods (Fig. 5C and 5C’), and disrupted morning anticipation and light-on startle response under 12:12h LD cycles (Fig. 5A and 5A’), recapitulating the behaviors seen with constitutive miR-124 deletion (Fig. 1A1C). In contrast, disruption confined to the adult stage had no effect on circadian phase, with behaviors comparable to genetic controls (Fig. S3). miR-124 is therefore required during development to control the phase of adult circadian behavior.

Fig. 5. miR-124 acts during development to regulate circadian phase.

Fig. 5.

A-C, Averaged locomotor behavior of flies with embryonic miR-124 deletion in 12:12 LD (A), DD (B) and 6:18 LD (C) (A-B, n ⩾ 8 per genotype; C, n ⩾ 9 per genotype). A’-C’, The quantification of morning anticipation index in 12:12 LD (A’), evening peak phase (hours) under constant darkness (B’) and morning peak phase (hours) in 6:18 LD (C’). D, Quantification of morning anticipation index (left), evening phase (middle) and morning phase (right) under 12:12 LD, DD and 6:18 LD for control flies and flies with 1st instar larval and 2nd instar larval deletion of miR-124. E, Quantification of morning anticipation index (left), evening phase (middle) and morning phase (right) under 12:12 LD, DD and 6:18 LD for control flies and flies with 3rd instar larval and pupae stage deletion off miR-124. The legends for A’-C’ and D-E are on the right side of panel D. See also Figure S3S5 for additional data. Quantifications are means ± SEM in A’-C’ and D-E (N = 3 independent behavioral experiments). One-way ANOVA with Tukey’s post hoc test. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant.

To determine more precisely when miR-124 is required, we induced miR-124 disruption at different developmental stages. Pan-neuronal miR-124 deletion induced during the first or second instar larvae resulted in the same circadian phase defects as those observed with constitutive loss of miR-124 (Fig. 5D and Fig. S4A4B). In contrast, miR-124 disruption induced during the third instar larvae or at the pupal stages had no effects on circadian behavior (Fig. 5E and Fig. S5A5B). Thus miR-124 is required around the second instar larval stage to determine adult behavior phase.

Loss of miR-124 leads to defective circadian network wiring

Given that miR-124 functions during larval development and alters the activity of circadian neurons in miR-124 mutants, we hypothesized that the loss of miR-124 affects the wiring of the circadian neural network. To test this, we employed the unbiased anterograde trans-synaptic tracing system, trans-Tango, to map synaptically connected neurons within circadian circuits (Talay et al., 2017).

The trans-Tango signal is known to be both temperature- and age-dependent. It increases with age and decreases with higher temperature (Talay et al., 2017). Therefore, to assess robust synaptic connectivity within the circadian neural network of miR-124KO mutants, we raised and entrained 5–7 days old flies at the stringent 25°C temperature. We first traced and defined circuits downstream of the s-LNvs by co-expressing the trans-Tango ligand and myrGFP using pdf-GAL4. In both WT and miR-124KO brains, we observed the typical innervation of the posterior dorsal protocerebrum by GFP-expressing s-LNvs (Fig. 6A and Fig. S6), along with optic lobe and contralateral projections from l-LNvs. However, in miR-124KO brains, the dorsal projections of the s-LNvs appeared to be less fasciculated (Fig. 6A and S6B), with projection branching out of the main bundle more frequently ventrally. Similar observations had been made previously (Zhang et al., 2016), although projection defects seemed more pronounced in the present study, perhaps because of improved imaging. These projection abnormalities were more clearly observed in larvae (Fig. S7). In WT larval brains, all s-LNv axons projected medially and terminated in the anterior region of the central brain (Fig. S7A). However, in miR-124KO brains, some s-LNv axons displayed aberrant wandering near the somas in the posterior brain region and even formed loop-like structures (Fig. S7B). Interestingly, these axonal projection defects were usually more pronounced in one hemisphere compared to the other (Fig. S7B7C). Overall, these observations indicate that miR-124 plays an important role in s-LNv projection development, possibly impacting axon guidance, pruning or retraction.

Fig. 6. Loss of miR-124 causes excessive synaptic connections in the circadian network.

Fig. 6.

A, Postsynaptic partners of s-LNvs in WT and miR-124KO mutants revealed with trans-Tango. From left to right: Presynaptic s-LNvs (anti-GFP, green), postsynaptic trans-Tango signal (anti-HA, red), and merged images. Genotypes are indicated on the left side of the panels. The scale bars represent 40 μm. See also Figure S6S7 for additional data. B, Direct synaptic contacts between s-LNvs and DN1ps in A revealed by co-staining with anti-TIM (blue). Brains were dissected at ZT21, when TIM expression peaks, to facilitate optimal identification of clock neurons. White open arrowheads indicate the DN1ps directly targeted by s-LNvs. See also Figure S8. C, Quantification of the numbers of DN1ps contacted by s-LNvs per hemisphere. Error bars indicate SEM. An unpaired two-tailed Student’s t-test was used. ****, P<0.0001. D-E, Postsynaptic partners of DN1pEs (D, scale bar, 50um) and DN1pMs (E) in WT and miR-124KO mutants revealed with trans-Tango. White arrows represent DN1pM, white diamond arrows indicate non-DN1pMs in E. See also Figure S9S11 for additional data.

In addition to projection defects, adult miR-124KO brains displayed significantly increased Tomato signal in neurons postsynaptic to the s-LNvs relative to WT controls (Fig. 6A and Fig. S6), suggesting that s-LNvs target a greater number of neurons in miR-124KO flies. This increased signal was observed in both the dorsal part of the brain, and near the midline. Since the DN1ps are downstream of the s-LNvs and project fibers into the dorsal protocerebrum, we investigated whether the loss of miR-124 affected their connections. By confirming their identity as clock neuron through TIMELESS (TIM) protein staining (Fig. 6B and S8), we observed that in WT, 1.9±0.1 (mean±SEM) DN1ps per hemisphere were postsynaptic to the s-LNvs. However, in miR-124KO brains, 4.6± 0.2 DN1ps per hemisphere were targeted by the s-LNvs (Fig. 6C). This indicates that the loss of miR-124 leads to increased synaptic connectivity between the s-LNvs and DN1ps.

Next, we sought to trace postsynaptic partners of both DN1p subtypes in wild-type and mutant flies. First, we co-expressed the trans-Tango ligand and myrGFP with the R18H11-GAL4, which specifically labels DN1pEs. In WT brains, most projections from R18H11-positive DN1ps are located in the dorsal brain, innervating the anterior optic tubercle (AOTU) and the pars intercerebralis (PI) (Guo et al., 2018; Lamaze et al., 2018) (Fig. 6D and Fig. S9A). However, in miR-124KO brains, in addition to these dorsal projections, numerous projections terminated more ventrally, near the antennal lobe (AL), and there were even sparse projections in the suboesophageal ganglion (SOG) (Fig. 6D and Fig. S9B). This extensive branching of DN1pEs in miR-124KO brains correlated with much broader and denser postsynaptic mtdTomato labeling. In WT brains, mtdTomato-positive projections were mainly restricted to the lateral and dorsal protocerebrum (Fig. 6D and Fig. S9A), whereas in miR-124KO brains, robust mtdTomato-positive projections were found throughout a large area of the central brain (Fig. 6D and Fig. S9B). As a result, it was challenging to accurately identify specific synaptic connections. However, using TIM staining, we observed that some DN1pEs form synapses with each other (Fig. S10A). The loss of miR-124 did not appear to affect this connectivity, as 4 out of 7–8 R18H11-GAL4-labelled DN1p neurons (Kunst et al., 2014) made contact with each other in both WT and miR-124KO flies (Fig. S10B).

We then turned our attention to the DN1pMs. VT027231-Gal4 labels the DN1ps which are sufficient to drive morning anticipation (Chatterjee et al., 2018), so we used this driver to express the trans-Tango ligand and myrGFP in the DN1pMs. Note that this driver is also expressed in a few non-DN1ps neurons. In WT brains, GFP-expressing fibers from the DN1ps are primarily concentrated in the lateral and dorsal brain (Fig. 6E and Fig. S11A). However, in miR-124KO brains, these fibers spread extensively throughout the entire central brain (Fig. 6E and Fig. S11B). This widespread and dense arborization was associated with highly dense trans-Tango-dependent signal. (Fig. 6E and Fig. S11). This robust mtdTomato labeling surrounding the DN1pMs strongly indicates that these circadian neurons form additional synaptic connections in the absence of miR-124, although we cannot entirely exclude that this dorsal signal is at least in part due to non-DN1p neurons labeled by VT027231-Gal4. However, this possibility seems unlikely, because these extra neurons are located much more ventrally than the DN1pMs. They are more likely to contribute to the trans-Tango signal observed in the central ventral brain. Taken together, these observations indicate that both DN1pEs and DN1pMs are similarly affected by the loss of miR-124, exhibiting broader and denser projections in miR-124KO brains, as well as increased connectivity.

Collectively, these results suggest that the absence of miR-124 leads to developmental miswiring within circadian circuits, likely disrupting neuronal activities in the circadian network and causing shifts in circadian phase.

Discussion

We demonstrate here that miR-124 plays a crucial role in the proper development and neuronal wiring of the Drosophila circadian neural network. Its absence leads to excessive synaptic connections within the circadian neural circuit, and between circadian and non-clock neurons. Since previously reported neural defects, observed in the larvae, were quite subtle, we were surprised by the extent of the wiring defects in the adult circadian neural network. Synaptic defects related to miR-124 loss have been observed in other species. In Aplysia californica, miR-124 modulates synaptic plasticity through CREB (Rajasethupathy et al., 2009), while in rat hippocampal neurons, miR-124 controls input-specific synaptic plasticity via synaptopodin (SP) (Dubes et al., 2022). In mice, miR-124 regulates dendritic morphogenesis and increases spine density in the olfactory bulb, highlighting its role in synaptic formation and plasticity (Li and Ling, 2017). Collectively, these data suggest that regulating synapse function is an ancient and conserved function of miR-124 across the animal kingdom.

The precise formation of synaptic connections between neurons is critical for proper information perception, processing, and transmission, which underpins all central nervous system functions (Luo, 2021). Despite their distinct roles, the various clock neuron groups in the Drosophila brain are highly interconnected, allowing the flies to adapt to ever-changing environmental conditions (Muraro et al., 2013; Chatterjee et al., 2018; Ahmad et al., 2021). The s-LNvs, the master pacemakers in Drosophila, maintain free-running rhythms under DD and are essential for anticipating dawn under LD conditions (Renn et al., 1999; Grima et al., 2004; Stoleru et al., 2004). They also modulate the timing of the evening peak of locomotor activity (Schlichting et al., 2019b). Meanwhile, the DN1ps consist of subgroups that promote either morning or evening activity (Chatterjee et al., 2018). We focused on the neuronal connectivity of these two clock neuron subgroups, as the loss of miR-124 affected both morning and evening phases in miR-124KO flies (Fig. 1). Our trans-Tango analysis revealed that in WT flies, only two DN1ps are postsynaptic to the s-LNvs (Fig. 6B6C), which aligns with findings from the electron microscopy (EM) hemibrain connectome (Scheffer et al., 2020), where s-LNvs are seen to form very few synaptic connections with other clock neuron groups (Shafer et al., 2022). This is consistent with previous studies showing that s-LNvs primarily communicate with DN1ps and other circadian groups through volumetric neuropeptide PDF secretion to set their pace (Liang et al., 2017; Fernandez et al., 2020; Ahmad et al., 2021). In WT flies, the s-LNvs differentially activate the DN1pMs and inhibit the DN1pEs through PDF signaling (Chatterjee et al., 2018). Additionally, sNPF from both s-LNvs and LNds also contributes to shaping Ca2+ activity pattern in DN1ps (Liang et al., 2017). Interestingly, the s-LNvs apparently use glycine, which usually inhibits neuronal activity, as its sole fast synaptic neurotransmitter (Frenkel et al., 2017). In miR-124KO brains, we observed that the s-LNvs connect to 2–3 additional DN1ps. These additional glycinergic synaptic connections may thus constantly inhibit both DN1pMs and DN1pEs, since these neurons are connected to each other through electric synapses (Tabuchi et al., 2018). Increased sNPF signaling, and for the DN1pEs, increased PDF signaling, could also contribute to DN1 inhibition (Shang et al., 2013; Vecsey et al., 2014; Chatterjee et al., 2018).

Interestingly, the phase of s-LNv activity was altered in miR-124 knockout animals, with activity shifted toward the middle of the day, rather than at the end of the night. This could be the result of altered neural input onto the s-LNvs, or miR-124 could modulate the expression of circadian output genes that determine neural activity rhythms. It is noteworthy that although the loss of miR-124 results in an increase in synaptic connections made by the s-LNvs and the DN1ps and drastically alters their activity pattern, only the phase of circadian rhythms is affected, not its period, nor the oscillations of neuronal molecular pacemakers (Garaulet et al., 2016; Zhang et al., 2016). For the s-LNvs, this fits with the observation that their neural activity can be eliminated without major consequences on the oscillation and phase of their circadian pacemaker (Depetris-Chauvin et al., 2011). However, in the case of miR-124 mutants, the s-LNvs are rhythmically active, with an abnormal phase. Thus, the circadian molecular pacemaker of the s-LNvs is quite resistant to (or protected from) changes in neural activity, both in terms of period and phase. Since the s-LNvs function as the main circadian pacemaker neurons, this insulation might be needed to avoid overreaction to environmental inputs such as temperature changes (Busza et al., 2007).

The DN1ps are controlled by the s-LNvs through PDF signaling, which maintain their rhythmicity and clock speed (Zhang et al., 2010a; Yao et al., 2016; Chatterjee et al., 2018). Altering the molecular clock in either s-LNvs or DN1ps readily shifts behavioral phase under DD, whereas similar molecular manipulations in LNds do not (Chatterjee et al., 2018), emphasizing the pivotal role of the s-LNv-DN1p axis in circadian phase regulation. The simultaneous re-activation of both morning and evening DN1ps significantly rescued circadian behavior in miR-124KO mutants (Fig. 3E3G), indicating that neuronal activity and likely communication within DN1ps are essential for maintaining normal behavioral phases. Indeed, we (Fig. S10) and others observed interconnections between DN1ps (Tabuchi et al., 2018). Interestingly, in miR-124 mutants, DN1p activity is very low in both the E and M subtypes, and behavior phase correlated quite closely with s-LNv activity under DD: both showed a broad peak in the middle of the subjective day. This suggests that the s-LNvs can bypass the DN1ps to control behavior. The DN1ps respond to both light and temperature inputs (Zhang et al., 2010b), and might thus be at time acutely inhibited. This could allow the s-LNvs to control behavior directly under specific environmental conditions.

Synapse formation requires a complex set of genes, including genes encoding cell-surface proteins, which differ among neuron types to specify their unique connectivity (Xie et al., 2022). miR-124 is predicted to directly regulates hundreds of genes, and the loss of miR-124 affects the expression of thousands, particularly those involved in central nervous system (CNS) functions (Sun et al., 2012). It is therefore likely that the wiring defects we observed is the result of the combined misregulation of multiple genes. Supporting this idea, reduction in BMP signaling - which impact multiple aspects of Drosophila development including synapse formation and function (Berke et al., 2013; Sulkowski et al., 2014; Heo et al., 2017; Furusawa et al., 2023; Kaneko et al., 2024) - only partially rescued the evening miR-124KO phase phenotype, and this only under DD (Garaulet et al., 2016). Clearly, miR-124 is required quite early during development. Conditional knock-out indicates that miR-124 is required during mid or early larval development, and larval s-LNvs show frequent axonal projection defects when miR-124 is missing. It is however curious that in adults, these striking defects have been largely corrected, with at best a minor increase in aberrant axonal projections (Fig. 6A and S6) (Zhang et al., 2016). It is therefore likely that the aberrant projections observed in larvae are pruned during pupation, or perhaps even earlier since we usually observed axonal projection defects in only one of two brain hemispheres. The main defect of adult s-LNvs thus appear to be the excess connectivity with DN1ps and other unidentified neurons. The origin of this hyper-connectivity, also present in DN1ps, is presently unclear. It could be the result of more subtle axon projection defects than those observed at the larval stages, or insufficient pruning. Neuronal projection and their development is controlled by a complex interplay of biological processes (de la Torre-Ubieta and Bonni, 2011), including neuronal polarization, axon outgrowth and guidance, cell adhesion, transcriptional control, and activity-dependent plasticity. These processes are tightly regulated and coordinated during development to ensure the establishment of accurate and functional neural circuits. The loss of miR-124 may disrupt one or more of these mechanisms, or coordination among them, ultimately leading to the projection defects we observed.

Our results suggest that miR-124 functions non-cell-autonomously. Indeed, pan-neuronal conditional knock-out during the 2nd instar larvae recapitulates all the phenotypes observed in miR-124KO mutants, but circadian GAL4 drivers (clk856-GAL4, pdf-GAL4, tim-GAL4) which are already active in the 1st instar larvae, do not. Moreover, unlike the s-LNvs and four dorsal neurons which differentiate during the first instar larval stage, the DN1ps emerge and develop much later, during the third instar larval and pupal stages (Liu et al., 2015; Poe et al., 2022). The development, morphology and connectivity defects observed in DN1ps of miR-124KO mutants thus likely arise through non-autonomous mechanisms, perhaps induced by defects in early-developing neurons such as the s-LNvs. However, we cannot exclude that miR-124 regulates DN1p neuronal projections in a cell-autonomous manner at later developmental stages without leading to detectable behavioral alterations.

Our findings demonstrate that miR-124 regulates circadian phase of rhythmic behavior by coordinating the development of circadian neural circuits. They reveal the importance of proper circuit wiring in the control of behavior phase. Defective neural connectivity may also help explain other physiological and behavioral abnormalities caused by the loss of miR-124, not only in Drosophila but potentially also in other animals, given that miR-124’s mature sequence and brain-enriched expression are conserved from worms to humans.

Supplementary Material

1

Acknowledgments

We thank Dr. Eric Lai for the miR-124KO and genomic rescue flies, and Dr. Maria de la Paz Fernandez for helpful discussions. We also thank Dr. Michael Rosbash, the Bloomington Drosophila Stock Center, and the Vienna Drosophila Resource Center for Drosophila stocks and reagents. This work was supported by MIRA award 1R35GM145253 from the National Institute of General Medical Sciences (NIGMS) to P.E.

Footnotes

Declaration of Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article

Declaration of generative AI and AI-assisted technologies in the writing process During the preparation of this work the authors used ChatGPT in order to ensure grammatical accuracy and improve clarify. After using this tool/service, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication.

Data and material availability

Any additional information and materials reported in this paper are available from the corresponding authors upon request.

References

  1. Ahmad M, Li W, and Top D (2021) Integration of Circadian Clock Information in the Drosophila Circadian Neuronal Network. J Biol Rhythms 36:203–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Allada R, and Chung BY (2010) Circadian organization of behavior and physiology in Drosophila. Annu Rev Physiol 72:605–624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Allada R, White NE, So WV, Hall JC, and Rosbash M (1998) A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless. Cell 93:791–804. [DOI] [PubMed] [Google Scholar]
  4. Benito J, Zheng H, Ng FS, and Hardin PE (2007) Transcriptional feedback loop regulation, function, and ontogeny in Drosophila. Cold Spring Harb Symp Quant Biol 72:437–444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Berger C, Renner S, Lüer K, and Technau GM (2007) The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the Drosophila embryonic CNS. Dev Dyn 236:3562–3568. [DOI] [PubMed] [Google Scholar]
  6. Berke B, Wittnam J, McNeill E, Van Vactor DL, and Keshishian H (2013) Retrograde BMP signaling at the synapse: a permissive signal for synapse maturation and activity-dependent plasticity. J Neurosci 33:17937–17950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bhadra U, Thakkar N, Das P, and Pal Bhadra M (2017) Evolution of circadian rhythms: from bacteria to human. Sleep Med 35:49–61. [DOI] [PubMed] [Google Scholar]
  8. Busza A, Murad A, and Emery P (2007) Interactions between circadian neurons control temperature synchronization of Drosophila behavior. J Neurosci 27:10722–10733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cavanaugh DJ, Geratowski JD, Wooltorton JR, Spaethling JM, Hector CE, Zheng X, Johnson EC, Eberwine JH, and Sehgal A (2014) Identification of a circadian output circuit for rest:activity rhythms in Drosophila. Cell 157:689–701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cavey M, Collins B, Bertet C, and Blau J (2016) Circadian rhythms in neuronal activity propagate through output circuits. Nat Neurosci 19:587–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chang AM, Aeschbach D, Duffy JF, and Czeisler CA (2015) Evening use of light-emitting eReaders negatively affects sleep, circadian timing, and next-morning alertness. Proc Natl Acad Sci U S A 112:1232–1237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chatterjee A, Lamaze A, De J, Mena W, Chélot E, Martin B, Hardin P, Kadener S, Emery P, and Rouyer F (2018) Reconfiguration of a Multi-oscillator Network by Light in the Drosophila Circadian Clock. Curr Biol 28:2007–2017.e2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen C, Agrawal S, Mark B, Mamiya A, Sustar A, Phelps JS, Lee WA, Dickson BJ, Card GM, and Tuthill JC (2021) Functional architecture of neural circuits for leg proprioception in Drosophila. Curr Biol 31:5163–5175.e5167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Clark AM, Goldstein LD, Tevlin M, Tavaré S, Shaham S, and Miska EA (2010) The microRNA miR-124 controls gene expression in the sensory nervous system of Caenorhabditis elegans. Nucleic Acids Res 38:3780–3793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Conaco C, Otto S, Han JJ, and Mandel G (2006) Reciprocal actions of REST and a microRNA promote neuronal identity. Proc Natl Acad Sci U S A 103:2422–2427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. de la Torre-Ubieta L, and Bonni A (2011) Transcriptional regulation of neuronal polarity and morphogenesis in the mammalian brain. Neuron 72:22–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Delventhal R, O'Connor RM, Pantalia MM, Ulgherait M, Kim HX, Basturk MK, Canman JC, and Shirasu-Hiza M (2019) Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption. Elife 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Depetris-Chauvin A, Berni J, Aranovich EJ, Muraro NI, Beckwith EJ, and Ceriani MF (2011) Adult-specific electrical silencing of pacemaker neurons uncouples molecular clock from circadian outputs. Curr Biol 21:1783–1793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dodd AN, Salathia N, Hall A, Kévei E, Tóth R, Nagy F, Hibberd JM, Millar AJ, and Webb AA (2005) Plant circadian clocks increase photosynthesis, growth, survival, and competitive advantage. Science 309:630–633. [DOI] [PubMed] [Google Scholar]
  20. Dubes S, Soula A, Benquet S, Tessier B, Poujol C, Favereaux A, Thoumine O, and Letellier M (2022) miR-124-dependent tagging of synapses by synaptopodin enables input-specific homeostatic plasticity. Embo j 41:e109012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Dubowy C, and Sehgal A (2017) Circadian Rhythms and Sleep in Drosophila melanogaster. Genetics 205:1373–1397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fernandez MP, Pettibone HL, Bogart JT, Roell CJ, Davey CE, Pranevicius A, Huynh KV, Lennox SM, Kostadinov BS, and Shafer OT (2020) Sites of Circadian Clock Neuron Plasticity Mediate Sensory Integration and Entrainment. Curr Biol 30:2225–2237.e2225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fishbein AB, Knutson KL, and Zee PC (2021) Circadian disruption and human health. J Clin Invest 131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Fosque BF, Sun Y, Dana H, Yang CT, Ohyama T, Tadross MR, Patel R, Zlatic M, Kim DS, Ahrens MB, Jayaraman V, Looger LL, and Schreiter ER (2015) Neural circuits. Labeling of active neural circuits in vivo with designed calcium integrators. Science 347:755–760. [DOI] [PubMed] [Google Scholar]
  25. Frenkel L, Muraro NI, Beltrán González AN, Marcora MS, Bernabó G, Hermann-Luibl C, Romero JI, Helfrich-Förster C, Castaño EM, Marino-Busjle C, Calvo DJ, and Ceriani MF (2017) Organization of Circadian Behavior Relies on Glycinergic Transmission. Cell Rep 19:72–85. [DOI] [PubMed] [Google Scholar]
  26. Furusawa K, Ishii K, Tsuji M, Tokumitsu N, Hasegawa E, and Emoto K (2023) Presynaptic Ube3a E3 ligase promotes synapse elimination through down-regulation of BMP signaling. Science 381:1197–1205. [DOI] [PubMed] [Google Scholar]
  27. Garaulet DL, Sun K, Li W, Wen J, Panzarino AM, O'Neil JL, Hiesinger PR, Young MW, and Lai EC (2016) miR-124 Regulates Diverse Aspects of Rhythmic Behavior in Drosophila. J Neurosci 36:3414–3421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Grima B, Chélot E, Xia R, and Rouyer F (2004) Morning and evening peaks of activity rely on different clock neurons of the Drosophila brain. Nature 431:869–873. [DOI] [PubMed] [Google Scholar]
  29. Gu X, Xu X, Jia C, Wang J, Zhang J, Gao Q, and Chen J (2023) Molecular Mechanisms Involved in the Regulation of Neurodevelopment by miR-124. Mol Neurobiol 60:3569–3583. [DOI] [PubMed] [Google Scholar]
  30. Gummadova JO, Coutts GA, and Glossop NR (2009) Analysis of the Drosophila Clock promoter reveals heterogeneity in expression between subgroups of central oscillator cells and identifies a novel enhancer region. J Biol Rhythms 24:353–367. [DOI] [PubMed] [Google Scholar]
  31. Guo F, Chen X, and Rosbash M (2017) Temporal calcium profiling of specific circadian neurons in freely moving flies. Proc Natl Acad Sci U S A 114:E8780–e8787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Guo F, Holla M, Díaz MM, and Rosbash M (2018) A Circadian Output Circuit Controls Sleep-Wake Arousal in Drosophila. Neuron 100:624–635.e624. [DOI] [PubMed] [Google Scholar]
  33. Heo K, Nahm M, Lee MJ, Kim YE, Ki CS, Kim SH, and Lee S (2017) The Rap activator Gef26 regulates synaptic growth and neuronal survival via inhibition of BMP signaling. Mol Brain 10:62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ho K, Nichols CG, Lederer WJ, Lytton J, Vassilev PM, Kanazirska MV, and Hebert SC (1993) Cloning and expression of an inwardly rectifying ATP-regulated potassium channel. Nature 362:31–38. [DOI] [PubMed] [Google Scholar]
  35. Horn M, Mitesser O, Hovestadt T, Yoshii T, Rieger D, and Helfrich-Förster C (2019) The Circadian Clock Improves Fitness in the Fruit Fly, Drosophila melanogaster. Front Physiol 10:1374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kaneko T, Li R, He Q, Yang L, and Ye B (2024) Transsynaptic BMP Signaling Regulates Fine-Scale Topography between Adjacent Sensory Neurons. eNeuro 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kannan NN, Vaze KM, and Sharma VK (2012) Clock accuracy and precision evolve as a consequence of selection for adult emergence in a narrow window of time in fruit flies Drosophila melanogaster. J Exp Biol 215:3527–3534. [DOI] [PubMed] [Google Scholar]
  38. King AN, Barber AF, Smith AE, Dreyer AP, Sitaraman D, Nitabach MN, Cavanaugh DJ, and Sehgal A (2017) A Peptidergic Circuit Links the Circadian Clock to Locomotor Activity. Curr Biol 27:1915–1927.e1915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Kong Y, Wu J, Zhang D, Wan C, and Yuan L (2015) The Role of miR-124 in Drosophila Alzheimer's Disease Model by Targeting Delta in Notch Signaling Pathway. Curr Mol Med 15:980–989. [DOI] [PubMed] [Google Scholar]
  40. Konopka RJ, Hamblen-Coyle MJ, Jamison CF, and Hall JC (1994) An ultrashort clock mutation at the period locus of Drosophila melanogaster that reveals some new features of the fly's circadian system. J Biol Rhythms 9:189–216. [DOI] [PubMed] [Google Scholar]
  41. Kunst M, Hughes ME, Raccuglia D, Felix M, Li M, Barnett G, Duah J, and Nitabach MN (2014) Calcitonin gene-related peptide neurons mediate sleep-specific circadian output in Drosophila. Curr Biol 24:2652–2664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Kyriacou CP, Peixoto AA, Sandrelli F, Costa R, and Tauber E (2008) Clines in clock genes: fine-tuning circadian rhythms to the environment. Trends Genet 24:124–132. [DOI] [PubMed] [Google Scholar]
  43. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, and Tuschl T (2002) Identification of tissue-specific microRNAs from mouse. Curr Biol 12:735–739. [DOI] [PubMed] [Google Scholar]
  44. Lamaze A, Krätschmer P, Chen KF, Lowe S, and Jepson JEC (2018) A Wake-Promoting Circadian Output Circuit in Drosophila. Curr Biol 28:3098–3105.e3093. [DOI] [PubMed] [Google Scholar]
  45. Li G, and Ling S (2017) MiR-124 Promotes Newborn Olfactory Bulb Neuron Dendritic Morphogenesis and Spine Density. J Mol Neurosci 61:159–168. [DOI] [PubMed] [Google Scholar]
  46. Liang X, Ho MCW, Zhang Y, Li Y, Wu MN, Holy TE, and Taghert PH (2019) Morning and Evening Circadian Pacemakers Independently Drive Premotor Centers via a Specific Dopamine Relay. Neuron 102:843–857.e844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Liang X, Holy TE, and Taghert PH (2016) Synchronous Drosophila circadian pacemakers display nonsynchronous Ca(2)(+) rhythms in vivo. Science 351:976–981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Liang X, Holy TE, and Taghert PH (2017) A Series of Suppressive Signals within the Drosophila Circadian Neural Circuit Generates Sequential Daily Outputs. Neuron 94:1173–1189.e1174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Liu T, Mahesh G, Houl JH, and Hardin PE (2015) Circadian Activators Are Expressed Days before They Initiate Clock Function in Late Pacemaker Neurons from Drosophila. J Neurosci 35:8662–8671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Luo L (2021) Architectures of neuronal circuits. Science 373:eabg7285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ma D, Przybylski D, Abruzzi KC, Schlichting M, Li Q, Long X, and Rosbash M (2021) A transcriptomic taxonomy of Drosophila circadian neurons around the clock. Elife 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. McGuire SE, Mao Z, and Davis RL (2004) Spatiotemporal gene expression targeting with the TARGET and gene-switch systems in Drosophila. Sci STKE 2004:pl6. [DOI] [PubMed] [Google Scholar]
  53. Muraro NI, Pírez N, and Ceriani MF (2013) The circadian system: plasticity at many levels. Neuroscience 247:280–293. [DOI] [PubMed] [Google Scholar]
  54. Nitabach MN, Blau J, and Holmes TC (2002) Electrical silencing of Drosophila pacemaker neurons stops the free-running circadian clock. Cell 109:485–495. [DOI] [PubMed] [Google Scholar]
  55. Nitabach MN, and Taghert PH (2008) Organization of the Drosophila circadian control circuit. Curr Biol 18:R84–93. [DOI] [PubMed] [Google Scholar]
  56. Ouyang Y, Andersson CR, Kondo T, Golden SS, and Johnson CH (1998) Resonating circadian clocks enhance fitness in cyanobacteria. Proc Natl Acad Sci U S A 95:8660–8664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Panda S, Hogenesch JB, and Kay SA (2002) Circadian rhythms from flies to human. Nature 417:329–335. [DOI] [PubMed] [Google Scholar]
  58. Patke A, Young MW, and Axelrod S (2020) Molecular mechanisms and physiological importance of circadian rhythms. Nat Rev Mol Cell Biol 21:67–84. [DOI] [PubMed] [Google Scholar]
  59. Pittendrigh CS, and Minis DH (1972) Circadian systems: longevity as a function of circadian resonance in Drosophila melanogaster. Proc Natl Acad Sci U S A 69:1537–1539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Poe AR, Mace KD, and Kayser MS (2022) Getting into rhythm: developmental emergence of circadian clocks and behaviors. Febs j 289:6576–6588. [DOI] [PubMed] [Google Scholar]
  61. Port F, and Bullock SL (2016) Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nat Methods 13:852–854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rajasethupathy P, Fiumara F, Sheridan R, Betel D, Puthanveettil SV, Russo JJ, Sander C, Tuschl T, and Kandel E (2009) Characterization of small RNAs in Aplysia reveals a role for miR-124 in constraining synaptic plasticity through CREB. Neuron 63:803–817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rakshit K, Krishnan N, Guzik EM, Pyza E, and Giebultowicz JM (2012) Effects of aging on the molecular circadian oscillations in Drosophila. Chronobiol Int 29:5–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Reinhard N, Fukuda A, Manoli G, Derksen E, Saito A, Möller G, Sekiguchi M, Rieger D, Helfrich-Förster C, Yoshii T, and Zandawala M (2024) Synaptic connectome of the Drosophila circadian clock. Nat Commun 15:10392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Renn SC, Park JH, Rosbash M, Hall JC, and Taghert PH (1999) A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila. Cell 99:791–802. [DOI] [PubMed] [Google Scholar]
  66. Roenneberg T, Allebrandt KV, Merrow M, and Vetter C (2012) Social jetlag and obesity. Curr Biol 22:939–943. [DOI] [PubMed] [Google Scholar]
  67. Roenneberg T, and Merrow M (2016) The Circadian Clock and Human Health. Curr Biol 26:R432–443. [DOI] [PubMed] [Google Scholar]
  68. Scheffer LK, Xu CS, Januszewski M, Lu Z, Takemura SY, Hayworth KJ, Huang GB, Shinomiya K, Maitlin-Shepard J, Berg S, Clements J, Hubbard PM, Katz WT, Umayam L, Zhao T, Ackerman D, Blakely T, Bogovic J, Dolafi T, Kainmueller D, Kawase T, Khairy KA, Leavitt L, Li PH, Lindsey L, Neubarth N, Olbris DJ, Otsuna H, Trautman ET, Ito M, Bates AS, Goldammer J, Wolff T, Svirskas R, Schlegel P, Neace E, Knecht CJ, Alvarado CX, Bailey DA, Ballinger S, Borycz JA, Canino BS, Cheatham N, Cook M, Dreher M, Duclos O, Eubanks B, Fairbanks K, Finley S, Forknall N, Francis A, Hopkins GP, Joyce EM, Kim S, Kirk NA, Kovalyak J, Lauchie SA, Lohff A, Maldonado C, Manley EA, McLin S, Mooney C, Ndama M, Ogundeyi O, Okeoma N, Ordish C, Padilla N, Patrick CM, Paterson T, Phillips EE, Phillips EM, Rampally N, Ribeiro C, Robertson MK, Rymer JT, Ryan SM, Sammons M, Scott AK, Scott AL, Shinomiya A, Smith C, Smith K, Smith NL, Sobeski MA, Suleiman A, Swift J, Takemura S, Talebi I, Tarnogorska D, Tenshaw E, Tokhi T, Walsh JJ, Yang T, Horne JA, Li F, Parekh R, Rivlin PK, Jayaraman V, Costa M, Jefferis GS, Ito K, Saalfeld S, George R, Meinertzhagen IA, Rubin GM, Hess HF, Jain V, and Plaza SM (2020) A connectome and analysis of the adult Drosophila central brain. Elife 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Schlichting M, Diaz MM, Xin J, and Rosbash M (2019a) Neuron-specific knockouts indicate the importance of network communication to Drosophila rhythmicity. Elife 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Schlichting M, Menegazzi P, Rosbash M, and Helfrich-Förster C (2019b) A Distinct Visual Pathway Mediates High-Intensity Light Adaptation of the Circadian Clock in Drosophila. J Neurosci 39:1621–1630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Sehgal A (2017) Physiology Flies with Time. Cell 171:1232–1235. [DOI] [PubMed] [Google Scholar]
  72. Shafer OT, Gutierrez GJ, Li K, Mildenhall A, Spira D, Marty J, Lazar AA, and Fernandez MP (2022) Connectomic analysis of the Drosophila lateral neuron clock cells reveals the synaptic basis of functional pacemaker classes. Elife 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Shang Y, Donelson NC, Vecsey CG, Guo F, Rosbash M, and Griffith LC (2013) Short neuropeptide F is a sleep-promoting inhibitory modulator. Neuron 80:171–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Somers J, Harper REF, and Albert JT (2018) How Many Clocks, How Many Times? On the Sensory Basis and Computational Challenges of Circadian Systems. Front Behav Neurosci 12:211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Stoleru D, Nawathean P, Fernández MP, Menet JS, Ceriani MF, and Rosbash M (2007) The Drosophila circadian network is a seasonal timer. Cell 129:207–219. [DOI] [PubMed] [Google Scholar]
  76. Stoleru D, Peng Y, Agosto J, and Rosbash M (2004) Coupled oscillators control morning and evening locomotor behaviour of Drosophila. Nature 431:862–868. [DOI] [PubMed] [Google Scholar]
  77. Sulkowski M, Kim YJ, and Serpe M (2014) Postsynaptic glutamate receptors regulate local BMP signaling at the Drosophila neuromuscular junction. Development 141:436–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Sun K, Westholm JO, Tsurudome K, Hagen JW, Lu Y, Kohwi M, Betel D, Gao FB, Haghighi AP, Doe CQ, and Lai EC (2012) Neurophysiological defects and neuronal gene deregulation in Drosophila mir-124 mutants. PLoS Genet 8:e1002515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Sun Y, Luo ZM, Guo XM, Su DF, and Liu X (2015) An updated role of microRNA-124 in central nervous system disorders: a review. Front Cell Neurosci 9:193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Tabuchi M, Monaco JD, Duan G, Bell B, Liu S, Liu Q, Zhang K, and Wu MN (2018) Clock-Generated Temporal Codes Determine Synaptic Plasticity to Control Sleep. Cell 175:1213–1227.e1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Talay M, Richman EB, Snell NJ, Hartmann GG, Fisher JD, Sorkaç A, Santoyo JF, Chou-Freed C, Nair N, Johnson M, Szymanski JR, and Barnea G (2017) Transsynaptic Mapping of Second-Order Taste Neurons in Flies by trans-Tango. Neuron 96:783–795.e784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Tataroglu O, and Emery P (2014) Studying circadian rhythms in Drosophila melanogaster. Methods 68:140–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Vecsey CG, Pírez N, and Griffith LC (2014) The Drosophila neuropeptides PDF and sNPF have opposing electrophysiological and molecular effects on central neurons. J Neurophysiol 111:1033–1045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Walker WH 2nd, Walton JC, DeVries AC, and Nelson RJ (2020) Circadian rhythm disruption and mental health. Transl Psychiatry 10:28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Wang C, Feng T, Wan Q, Kong Y, and Yuan L (2014) miR-124 controls Drosophila behavior and is required for neural development. Int J Dev Neurosci 38:105–112. [DOI] [PubMed] [Google Scholar]
  86. Weng R, Chin JS, Yew JY, Bushati N, and Cohen SM (2013) miR-124 controls male reproductive success in Drosophila. Elife 2:e00640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Weng R, and Cohen SM (2012) Drosophila miR-124 regulates neuroblast proliferation through its target anachronism. Development 139:1427–1434. [DOI] [PubMed] [Google Scholar]
  88. Wyse CA, Coogan AN, Selman C, Hazlerigg DG, and Speakman JR (2010) Association between mammalian lifespan and circadian free-running period: the circadian resonance hypothesis revisited. Biol Lett 6:696–698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Xie Q, Li J, Li H, Udeshi ND, Svinkina T, Orlin D, Kohani S, Guajardo R, Mani DR, Xu C, Li T, Han S, Wei W, Shuster SA, Luginbuhl DJ, Quake SR, Murthy SE, Ting AY, Carr SA, and Luo L (2022) Transcription factor Acj6 controls dendrite targeting via a combinatorial cell-surface code. Neuron 110:2299–2314.e2298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Xu J, Zheng Y, Wang L, Liu Y, Wang X, Li Y, and Chi G (2022) miR-124: A Promising Therapeutic Target for Central Nervous System Injuries and Diseases. Cell Mol Neurobiol 42:2031–2053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Yao Z, Bennett AJ, Clem JL, and Shafer OT (2016) The Drosophila Clock Neuron Network Features Diverse Coupling Modes and Requires Network-wide Coherence for Robust Circadian Rhythms. Cell Rep 17:2873–2881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Young MW, and Kay SA (2001) Time zones: a comparative genetics of circadian clocks. Nat Rev Genet 2:702–715. [DOI] [PubMed] [Google Scholar]
  93. Zhang L, Chung BY, Lear BC, Kilman VL, Liu Y, Mahesh G, Meissner RA, Hardin PE, and Allada R (2010a) DN1(p) circadian neurons coordinate acute light and PDF inputs to produce robust daily behavior in Drosophila. Curr Biol 20:591–599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Zhang R, Lahens NF, Ballance HI, Hughes ME, and Hogenesch JB (2014) A circadian gene expression atlas in mammals: implications for biology and medicine. Proc Natl Acad Sci U S A 111:16219–16224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Zhang WH, Jiang L, Li M, and Liu J (2023) MicroRNA-124: an emerging therapeutic target in central nervous system disorders. Exp Brain Res 241:1215–1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Zhang Y, Lamba P, Guo P, and Emery P (2016) miR-124 Regulates the Phase of Drosophila Circadian Locomotor Behavior. J Neurosci 36:2007–2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Zhang Y, Liu Y, Bilodeau-Wentworth D, Hardin PE, and Emery P (2010b) Light and temperature control the contribution of specific DN1 neurons to Drosophila circadian behavior. Curr Biol 20:600–605. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Data Availability Statement

Any additional information and materials reported in this paper are available from the corresponding authors upon request.

RESOURCES