Skip to main content
NCBI home page
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2025 Aug 6;33(5):842–851. doi: 10.4062/biomolther.2025.062

An Endolichenic Fungi-Derived Fatty Acid, cis-10-Nonadecenoic acid, Suppresses Colorectal Cancer Stemness

Mücahit Varlı 1,†, Eun-Young Lee 2,†, So-Yeon Park 1, Yi Yang 1, Prima F Hillman 3, Rui Zhou 1, Jae-Seoun Hur 4, Sang-Jip Nam 2,5,*, Hangun Kim 1,*
PMCID: PMC12408206  PMID: 40765264

Abstract

Endolichenic fungi (ELF), symbionts of lichens, have been reported to produce diverse bioactive secondary metabolites with promising pharmaceutical potential. In this study, we isolated and identified an ELF, EL001668 (KACC 83020BP), from Cetraria laevigata Rass., and assessed its crude extract and bioactive compounds against colorectal cancer (CRC) stem cell activity. cis-10-nonadecenoic acid (c-NDA), isolated through bioactivity-guided fractionation exerted substantial inhibitory effects on CRC stemness, such as the suppression of spheroid formation and the downregulation of the key stem cell markers ALDH1, CD44, and CD133. Comparative analysis with the omega-3 fatty acids EPA and DHA, with well-established properties, showed that c-NDA exerted comparable or superior inhibitory effects against the markers and phenotypic traits of stemness. Besides, the crude extract of EL001668 exhibited greater suppression of certain markers in comparison to the individual compounds. These findings suggest that c-NDA, in conjunction with ELF-derived compounds, holds potential as a novel therapeutic candidate targeting CRC stem cells. Taken together, the current study demonstrated that c-NDA, similar to EPA and DHA, may possess adjunct or complementary effects in cancer treatment and other diseases.

Keywords: Endolichenic fungi, cis-10-nonadecenoic acid, Fatty acids, Colorectal cancer stem cells, Bioactivity-guided fractionation, Natural products

INTRODUCTION

Endolichenic fungi are symbionts that are capable of forming a symbiotic relationship with lichens. Lichens provide a stable habitat and essential nutrients that enable the inhabitation by such fungi (de Vera et al., 2002; Nguyen et al., 2013). In return, ELF produce a diverse array of secondary metabolites that confer environmental stress resistance to lichens, including extreme temperatures or nutrient deficiencies. The potential of endolichenic fungi in pharmaceutical research and drug development has been increasingly recognized. They have been extensively screened for their bioactive compounds due to their ability to produce diverse secondary metabolites, including polyketides, terpenoids, alkaloids, steroids, and fatty acids (Varlı et al., 2023; Zhang et al., 2024). These compounds demonstrate diverse biological activities, including cytotoxic, antioxidant, anti-inflammatory, antiviral, and antifungal, as well as properties against Alzheimer’s disease, and cancer (Kellogg and Raja, 2017; Yang et al., 2018b; Xie et al., 2020; Hamida et al., 2021; Maduranga et al., 2021). Several such novel compounds have been identified that may serve as lead compounds in drug development; therefore, endolichenic fungi represent a promising resource in medicine (Zhang et al., 2024).

CRC is a heterogeneous condition influenced by genetic and epigenetic factors (Migliore et al., 2011). Colorectal stem cells, influenced by the tumor microenvironment and genetic factors, exhibit a high regenerative capacity and plasticity (Jahanafrooz et al., 2020). Consequently, CRC stem cells exhibit resistance to treatments such as chemotherapy or radiation therapy and play an important role in the development of metastases (Das et al., 2020; Lei et al., 2021). Therefore, the discovery of new treatments and the advancement of existing treatments are of critical importance.

In this study, we discovered, following a series of screenings, that the crude extract of EL001668 (KACC 83020BP), an endolichenic fungus isolated from Cetraria laevigata Rass., was effective against CRC stemness. To our knowledge, this is the first investigation of the inhibitory activity of c-NDA, isolated by bioactivity-guided fractionation of a crude extract, on CRC stem cells. We also demonstrated the effects of c-NDA on CRC stemness in comparison with the extensively characterized fatty acids, DHA, and EPA. Our results collectively demonstrate that c-NDA, docosahexaenoic acid (DHA), and eicosapentaenoic acid (EPA) exhibit potential inhibitory activity on phenotypic CRC stem cell formation and stem cell markers.

MATERIALS AND METHODS

General experimental procedures

NMR spectra were acquired using a JNM-ECZ500R Console 500 MHz spectrometer (JEOL Ltd., Tokyo, Japan) and chloroform-d (Cambridge Isotope Laboratories (CIL), Inc., Tewksbury, MA, USA). Low-resolution LC-MS analyses were conducted using an Agilent Technology 1260 quadrupole (Agilent Technologies, Santa Clara, CA, USA), PL-ELS 1000 ELSD (Polymer Laboratories, Long Beach, CA, USA), and a Waters Alliance Micromass ZQ LC-MS system (Waters Corp, Milford, MA, USA), using a reversed-phase column (Phenomenex Luna C18 (2) 100 Å, 100 mm×4.6 mm, 5 µm) (Phenomenex, Torrance, CA, USA) at a flow rate 1.0 mL/min at the National Research Facilities and Equipment Center (NanoBioEnergy Materials Center) at Ewha Womans University.

EL001668 fungal strain identification by Internal Transcribed Spacer Sequencing

A lichen specimen of the species Cetraria laevigata Rass. was collected from Mt. Baimaxueshan, Yunnan, China. Voucher specimens were deposited in the Korean Lichen Research Institute (KoLRI, https://cc.aris.re.kr/cc/app/main/mainView.do), Sunchon National University in Korea. The endolichenic fungus EL001668 was isolated from the Cetraria laevigata Rass. specimen employing the surface sterilization technique (Guo et al., 2003). DNA extraction from EL001668 grown on PDA was conducted with a DNeasy Plant Mini Kit following the manufacturer’s instructions (Qiagen, Hilden, Germany). BLAST similarity search of the ITS sequence identified EL001668 (KACC 83020BP) as Nemania sp., exhibiting 99.7% similarity to Nemania sp. (GenBank Accession No. MZ493060.1).

Preparation of endolichenic fungal extracts

Initially, EL001668 was grown on potato dextrose agar (PDA) medium at 25°C. ELF mycelia grown on agar were transferred into liquid culture media (PDB (potato dextrose broth)) in 500 mL Erlenmeyer flasks and incubated for 3-4 weeks at 25°C in a shaking incubator (150 rpm). After that, each flask was filled with 200 mL of ethyl acetate (EtOAc) and shaken vigorously for approximately 2 h. The filtrate and mycelia from each culture were subsequently isolated through filtration. By allowing the filtrate to stand in a separating funnel, the filtrate was divided into water-soluble and EtOAc-soluble layers. The crude extracts of EL006848 were obtained using a rotary evaporator to evaporate EtOAc to dryness while maintaining a vacuum.

Isolation of bioactive compounds from EL001668

The crude extract of EL001668 (17.87 g) was fractionated using flash column chromatography on silica gel with a stepwise gradient of CH2Cl2/CH3OH (100/0, 100/1, 100/2, 100/5, 100/10, 100/20, 100/50, 100/100 and 0/100, v/v, each of 200 mL), and eight fractions were obtained (Fraction 1 to Fraction 8). Fraction five (575.4 mg) was further purified by reversed-phase HPLC (Phenomenex Luna C-18 (2), 250×10 mm, 5 μm, 100 Å) at a flow rate of 2.0 mL/min, with UV detection at 210 nm and evaporative light scattering detection (ELSD) using an isocratic condition of 90% CH3CN in H2O (0.1% Trifluoroacetic acid in H2O) to obtain c-NDA (4.7 mg, tR=35.8 min). c-NDA: a light yellowish oil; 1H NMR (500 MHz, chloroform-d): δH 5.29-5.38 (2H, m, H-10 and 11, overlapped), 2.35 (2H, t, J=7.5 Hz, H-2), 2.01 (4H, m, H-9 and 12, overlapped), 1.63 (2H, quint, J=7.5 Hz, H-3), 1.24-1.37 (22H, m, H-4,5,6,7,13,14,15,16,17 and 18, overlapped), 0.87 (3H, t, J=6.9 Hz, H-19); 13C NMR (125 MHz, chloroform-d): δc 180.4 (C-1), 130.1 (C-10), 129.5 (C-11), 34.2 (C-2), 32.1 (C-17), 29.9 (C-8), 29.8 (C-7), 29.7 (C-16), 29.5 (C-13, 14 and 15), 29.4 (C-5 and 6), 29.2 (C-4), 27.4 (C-12), 27.3 (C-9), 24.8 (C-3), 22.8 (C-18), 14.3 (C-19); LR-ESI-MS m/z=297.27 [M+H]+.

Cell culture

CSC221 (human colorectal adenocarcinoma-enriched CSCs) cells were used in the experiments performed in this study. CSC221 cells were cultured in DMEM (GenDepot, Katy, TX, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2 (Lee et al., 2024).

Cell viability assays

Cells were inoculated in a 96-well plate and incubated overnight for adherence. Following a 48-h treatment with the investigated compounds, 15 µL of MTT solution (5 mg/mL in PBS) was added to each well (final concentration 0.5 mg/mL) and incubated at 37°C for 4 h in the dark (Hwangbo et al., 2024). The medium was removed, and 150 µL of DMSO was added to dissolve the formazan crystals. After a 10 min incubation at 37°C in a non-CO2 incubator, absorbance was measured at 570 nm using a microplate reader.

Spheroid formation assay

Cells were washed with 1% (v/v) N2-supplemented DMEM/F12 (containing human recombinant epidermal growth factor (20 ng/mL) and human basic fibroblast growth factor (10 ng/mL)) after the trypsinization step and then washed twice without media devoid of supplemented DMEM/F12 media. After that, cells were seeded in an ultra-low attachment 24-well plate. Spheres were quantified using inverted phase contrast microscopy following a 7-14 day incubation period. The IMT iSolution program (IMT iSolution Inc., Northampton, NJ, USA) was used to quantify the pixel intensity of the sphere area randomly in each plate to determine the relative sphere formation capabilities.

Western blotting

CSC221 cells were cultured in 6-well plates at a density of 2×105 cells/well overnight and treated with DMSO, c-NDA, DHA, or EPA at the indicated concentration for 48 h. Subsequently, cells were harvested and lysed, and protein concentrations were determined by the BCA protein assay. Then, protein lysate was separated by SDS-PAGE. Membranes incubated with 5% skim milk for 1 h to block non-specific binding, and then antibodies against ALDH1 (sc-166362; Santa Cruz Biotechnology, Dallas, TX, USA), CD133 (CA1217; Cell Applications, San Diego, CA, USA), CD44 (3570; Cell Signaling Technology, Danvers, MA, USA), Lgr-5 (ab75850; Abcam, Cambridge, MA, USA), Musashi-1 (ab52865; Abcam), BMI-1 (ab38295; Abcam) and α-tubulin (2125; Cell Signaling Technology) were incubated for 2 h at room temperature (RT). Blots were washed and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h. Specific antibody binding was detected under a chemiluminescence imaging system and measured by Multi Gauge 3.0. software (Fujifilm, Tokyo, Japan). Relative density was calculated against the density of loading control (Park et al., 2024).

Quantitative reverse-transcription PCR (qRT-PCR)

Total RNA was extracted from CSC221 cells with RNAiso Plus (Takara, Otsu, Japan). Subsequently, RNA was reverse transcribed into cDNA by MMLV reverse transcriptase, Invitrogen, Carlsbad, CA, USA. The qPCR was conducted using SYBR Green (Enzynomics, Seoul, Korea) and gene-specific primers (Table 1). qRT-PCR reactions and analyses were performed on a CFX instrument (Bio-Rad, Hercules, CA, USA) (Lee and Im, 2025).

Table 1.

List of primers used in q-RT-PCR analyses

Gene Forward Primer (5'-3') Reverse Primer (5'-3')
GAPDH ATCACCATCTTCCAGGAGCGA AGTTGTCATGGATGACCTTGGC
ALDH1 TGTTAGCTCATGCCGACTTG TTCTTAGCCCGCTCAACACT
CD44 TGCCGCTTTGCAGGTGTAT GGCCTCCGTCCGAGAGA
CD133 GGACCCATTGGCATTCTC CAGGACACAGCATAGAATAATC
LGR5 CTCTTCCTCAAACCGTCTGC GATCGGAGGCTAAGCAACTG
BMI-1 CCA GGGCTTTTCAAAAATGA CCGATCCAATCTGTTCTGGT
Open in a new tab

Statistical analysis

Data are expressed as means ± standard deviation. Statistical analyses were carried out using the Sigma Plot 12.5 software (RRID:SCR_003210, Systat Software, Erkrath, Germany). The statistical significance between the two groups was assessed using the Student’s t-test. Unless indicated otherwise, a p-value ≤0.05 was considered significant.

RESULTS

Identification of bioactive compounds from an EL001668 crude extract

Guided by bioactivity, we performed fractionation to isolate the bioactive constituents from the EL001668 crude extract (Fig. 1A). The c-NDA compound was isolated as light yellowish oil, and LR-ESI-MS revealed an ionic peak at m/z 279.2 [M+H]+ (Fig. 1B). The 1H NMR spectrum of c-NDA exhibited one methyl proton at H-19 (δH 0.87, t, J=6.9 Hz), sixteen methylene protons at H-2 (δH 2.35 t, J=7.5 Hz), H-3 (δH 1.63, quint, J=7.5 Hz), H-4,5,6,7,13,14,15,16,17 and 18 (δH 1.37, m, overlapped), and H-9 and 12 (δH 2.01, m, overlapped), and two olefinic methine protons at the double bond H-10 and 11 (δH 5.29-5.8 m, overlapped). 13C NMR spectrum of c-NDA showed one carboxylic acid carbon C-1 (δc 180.1), fifteen methylene carbons C-2,3,4,5,6,7,8,9,12,13,14,15,16,17, and 18 (δc 34.2, 24.8, 29.2, 29.4, 29.8, 29.9, 27.3, 27.4, 29.5, 29.7, 32.1, and 22.8), one methyl carbon C-19 (δc 14.3), and two methine carbons at the double bond carbons C-10 and 11 (δc 130.1 and 129.5) (Supplementary Fig. 2, 3). Comparing the 1H NMR and 13C NMR data of the compound with those reported in the literature, the compound was identified as c-NDA (Wube et al., 2011).

Fig. 1.

Fig. 1

Open in a new tab

Isolation of a bioactive compound from EL001668 crude extract. (A) Flowchart illustrating the separation of the purified compound c-NDA isolated from Cetraria laevigata Rass. (B) HPLC chromatograms (detected at 210 nm) of (a) blank; (b) the isolated bioactive compound c-NDA.

In a biological evaluation, we observed that fraction 5 effectively suppressed CSC221 spheroid formation at 5 μg/mL concentration (Fig. 2A). Subsequently, we separated fraction 5 and isolated c-NDA from fraction 5A using bioactivity-guided fractionation (Supplementary Fig. 1). To obtain additional confirmation, we evaluated the effects of crude extract of EL001668, fraction 5A, and c-NDA against spheroid formation and observed that both fraction 5A and c-NDA effectively suppressed their formation (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

The EL001668 bioactive component, c-NDA, suppresses spheroid formation. (A) CSC221 cells treated with EL001668 crude extracts and their fractions. (B) Treatments of cells with bioactive components of EL001668, c-NDA, Fraction 5A (Fr5-A), and the crude extract for further validation. After 10-14 days of incubation, the number of spheroid formations after each treatment was analyzed quantitatively. *p<0.05; **p<0.01; ***p<0.001; n=3.

Comparison of the effects of c-NDA with EPA and DHA on colorectal cancer stemness

EPA (eicosapentaenoic acid) and DHA (docosahexaenoic acid) (Fig. 3A) exhibit remarkable anti-inflammatory and anticancer properties in the context of inflammation and cancer biology (Rahman et al., 2013). Here, we investigated the impact of the fatty acid fraction of the EL001668 crude extract and c-NDA on cell viability compared with EPA and DHA. Based on our results, high concentrations of the EL001668 crude extract, c-NDA and EPA significantly decreased cell viability at 100 and 50 µg/mL, whereas DHA suppressed cell viability starting from 6.25 µg/mL (Fig. 3B). Furthermore, we evaluated and compared the dose-dependent effects of the EL001668 crude extract, c-NDA, EPA, and DHA on spheroid formation in CSC221 cells. Our results showed that the EL001668 crude extract, c-NDA, EPA, and DHA suppressed spheroid formation in a dose-dependent manner and exhibited similar effects on the phenotypic characteristics of CSC221 cells (Fig. 3C). In conclusion, fatty acids can suppress the spheroid formation of CSC221 at non-toxic concentrations.

Fig. 3.

Fig. 3

Open in a new tab

Comparing the effects of EPA and DHA with c-NDA on spheroid formation. (A) Chemical structures of EPA (eicosapentaenoic acid) and DHA (docosahexaenoic acid). (B) Cell viability of CSC221 treated with the EL001668 crude extract, c-NDA, EPA, and DHA at 1.56-100 µg/mL concentrations. DMSO was used as a control. (C) CSC221 cells were treated with the crude extract of EL001668, c-NDA, EPA, and DHA. After 10-14 days of incubation, the number of spheroid formations after each procedure was analyzed quantitatively. *p<0.05; **p<0.01; ***p<0.001; n=3.

Differential Regulation of CSC Markers by c-NDA isolated from EL001668, EPA, and DHA in CSC221 Cells

The downregulation of ALDH1, BMI-1, CD133, CD44, Lgr5, and Musashi-1 suggests disruption of critical pathways in CSC maintenance, self-renewal, and tumor initiation. These findings indicate that fatty acid constituents may disrupt cancer stemness properties and functions, possibly causing a decrease in tumorigenic capacity and metastasis (Barker et al., 2007; Ginestier et al., 2007; Chiou et al., 2017; Senbanjo and Chellaiah, 2017; Moreno-Londoño and Robles-Flores, 2023). A significant impact of the fatty acid fraction of the EL001668 crude extract, as well as of the individual purified fatty acids, c-NDA, DHA, and EPA, was observed on the expression of major CSC markers in CSC221 cells. Cells were treated for 48 h, and the mRNA levels of ALDH1, BMI-1, CD133, CD44, and Lgr-5 were quantified. Consequently, the findings of this study validate the therapeutic potential of the fatty acid components of EL001668, and of the purified compound c-NDA against CSCs. However, while c-NDA, EPA, and DHA exhibited comparable inhibitory effects on ALDH1, BMI-1, and CD133 mRNA levels, DHA failed to statistically significantly down-regulate the expression of CD44 and LGR5. While c-NDA and EPA exhibited similar inhibitory activities, the crude extract suppressed CD44 and LGR5 expression more strongly compared to other compounds (Fig. 4A). For further characterization of their activities, we performed a protein assay using western blotting. The bioactive compound of the EL001668 extract, c-NDA, effectively suppressed the protein levels of important markers such as ALDH1, CD44, and Musashi-1, but failed to suppress CD133, BMI-1 and Lgr-5. DHA exhibited a more potent inhibitory ability against CD133 and Lgr5 compared to c-NDA, whereas c-NDA demonstrated a stronger inhibition of ALDH1 and Musashi-1. When comparing c-NDA with EPA, c-NDA demonstrated superior inhibitory activity, with the exception of Lgr-5, CD133, and BMI-1 protein levels. Overall, c-NDA emerges as a novel potential therapeutic compound when compared with EPA and DHA, which possess established anti-cancer properties (Fig. 4B).

Fig. 4.

Fig. 4

Open in a new tab

Effects of the fatty acid constituents of EL001668 crude extract and of purified fatty acids on cancer stemness markers. (A) CSC221 cells were treated for 48 h with the crude extract of EL001668, c-NDA, DHA, or EPA at 5 µg/mL for mRNA expression analysis. Quantitative assessment of mRNA levels for cancer stem cell markers, such as ALDH1, BMI-1, CD133, CD44, and Lgr5. *p<0.05; **p<0.01; ***p<0.001; NS, no significant difference between groups; n=3. (B) Western blot analysis demonstrating the protein expression levels of ALDH1, CD44, CD133, Lgr-5, Musashi-1, BMI-1. Quantitative analysis of Western blot data. The bar graph illustrates the relative expression levels of the indicated proteins, normalized to the loading control. *p<0.05; **p<0.01; ***p<0.001, n=2.

DISCUSSION

Omega-3 fatty acids (EPA and DHA) have a wide range of health-promoting properties. Omega-3 fatty acids contribute to cardiovascular health by reducing blood pressure, regulating triglycerides, and preventing inflammation (Carrasco et al., 2020; Tsugane, 2020; Chen et al., 2022; Lobine et al., 2022). They are recognized for improving brain function and are considered supportive in managing mental disorders like depression and anxiety (von Schacky, 2021). Furthermore, there is interest in the diverse anti-cancer properties attributed to omega-3 fatty acids, specifically EPA and DHA, against different types of cancer. Their activities include the induction of apoptosis in cancerous cells, reduction of inflammation, and inhibition of tumor cell proliferation and metastasis. Anti-angiogenic properties also prevent the vascularization of tumors (Zajdel et al., 2010; Liu et al., 2021; Newell et al., 2021; Soni et al., 2021). Thus, omega-3 fatty acids appear to be promising as an adjunctive intervention in cancer prevention and treatment (Gurav et al., 2024). EPA and DHA have been reported to increase the effectiveness of chemotherapy and reduce its side effects when used together with chemotherapeutics (Crovella et al., 2023; Theinel et al., 2023; Jameel et al., 2024). Interestingly, EPA and DHA exhibited differential effects on stemness-related markers in our study. While both omega-3 PUFAs are generally considered bioactive lipids that possess anti-inflammatory and anti-tumor properties, their distinct biochemical structures likely underpin their divergent actions on cancer cell plasticity (Calviello et al., 2013). DHA, with its higher degree of unsaturation compared to EPA, may more effectively modulate membrane fluidity and receptor signaling (Serini et al., 2011). The ability of EPA to accumulate in high levels in plasma and cells, compared to DHA’s propensity to incorporate into lipid rafts, may distinguish the effects of these two fatty acids on cancer cells. EPA and DHA may have different effects on hematological malignancies. Understanding these differences may enable a more accurate assessment of the therapeutic potential of omega-3 fatty acids and the development of personalized treatment approaches (Moloudizargari et al., 2018). These findings underscore the importance of distinguishing between individual omega-3 fatty acids in therapeutic strategies targeting cancer stemness.

In colorectal cancer, heightened ALDH1 expression has also been associated with aggressive tumor behavior and poor clinical outcomes. ALDH1A1 expression, assessed by immunohistochemical analyses, has been shown to be significantly associated with lymph node metastasis. This finding suggests that ALDH1 may play a role in CRC pathogenesis and tumor progression (Yang et al., 2018a). The expression levels of both CD44 and CD133 were significantly elevated in CRC tissues and in concurrent hepatic metastases compared to normal mucosa. In particular, it was emphasized that the increased expression of CD44 exhibited significant correlations with the anatomical localization and histopathological features of the tumor and was associated with shorter disease-free survival. The involvement of CD44 in processes such as cellular adhesion, migration, and chemotherapy resistance underscores its significance as both a prognostic indicator and a potential therapeutic target (Wang et al., 2012; Jing et al., 2015; Huang et al., 2021). LGR5 has been identified as a stem cell marker in colorectal cancer (CRC) and plays an important role in tumor biology. High expression levels of Lgr-5 have been associated with tumor progression, metastasis, and patient survival in CRC. In conjunction with this information, further studies are needed to determine the clinical significance of Lgr-5 (Jiang et al., 2016; Jang et al., 2018; Morgan et al., 2018). BMI-1 plays a biologically and clinically important role in colorectal cancer liver metastasis. BMI-1 promotes the migration of colorectal cancer cells via epithelial-mesenchymal transition (EMT) by modulating the AKT/GSK-3β/Snail signaling pathway (Xu et al., 2021). Musashi-1 is an RNA-binding protein that regulates stem cell renewal in the intestinal epithelium and has recently attracted attention for its oncogenic role in colorectal cancer. Musashi-1, together with Musashi-2, has been shown to promote tumor cell proliferation through the activation of the PDK-Akt-mTORC1 signaling pathway. Specifically, it has been reported that both Musashi family members functionally complement each other, and their concurrent inhibition markedly suppresses CRC cell proliferation. These findings suggest that Musashi-1 plays an essential role in tumor development and progression in CRC and may serve as a potential therapeutic target (Li et al., 2015).

While transcript and protein levels are largely correlated, critical inconsistencies are observed, underscoring the complexity of post-transcriptional and post-translational regulation. These discrepancies can be attributed to the complex regulatory architecture governing stemness, which includes multiple layers of control beyond transcription. First, post-transcriptional mechanisms such as mRNA stability and translation efficiency often decouple mRNA abundance from protein expression (Imai et al., 2001; Schwanhüusser et al., 2011; Vogel and Marcotte, 2012; Liu et al., 2016). Among the markers examined, BMI-1 exhibits a clear discrepancy between mRNA and protein levels, suggesting post-transcriptional regulation (Bhattacharyya et al., 2009; Bhattacharya et al., 2015). Musashi-1, a known RNA-binding protein involved in stem cell maintenance, has been shown to autoregulate stemness-associated transcript translation, which could explain the mismatch between its transcript and protein levels (Imai et al., 2001). Additionally, upstream open reading frames (uORFs), internal ribosome entry sites, or stress-induced eIF2α phosphorylation can selectively impact the translation of certain mRNAs in cancer cells (Spriggs et al., 2010). Furthermore, ubiquitin-mediated degradation pathways can significantly affect protein levels and turnover (Cui et al., 2018; Wang et al., 2019; Atta et al., 2025). To validate these mechanistic insights and confirm the translational relevance of the observed expression patterns, future studies should assess transcriptional heterogeneity using ribosome profiling, proteasome inhibition assays, and single-cell RNA sequencing.

In conclusion, this study demonstrates the therapeutic potential of c-NDA, a fatty acid produced by endolichenic fungi, in the treatment of colorectal cancer by suppressing CRC stemness through the inhibition of key markers and pathways. As the efficacy of c-NDA is comparable to or even exceeds that of established omega-3 fatty acids (EPA and DHA), it holds great potential as a novel therapeutic agent (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

A schematic illustration demonstrating that c-NDA treatment impacts colorectal cancer stem-like properties by downregulating key markers associated with tumor progression, post-transcriptional regulation, epigenetic modification, self-renewal, and proliferation. Schematic representation created with BioRender.com (https://biorender.com).

bt-33-5-842-supple.pdf (8.8MB, pdf)

ACKNOWLEDGMENTS

This research was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT; No. NRF-2022R1A2C1011848, RS-2024-00413760), and the Korea Basic Science Institute (National Research Facilities and Equipment Center) grant funded by the Ministry of Education (No. 2020R1A6C101B194).

Footnotes

AUTHOR CONTRIBUTIONS

HK conceived and designed the experiments. MV, SYP, YY, and RZ performed the experiments, in vitro. EYL, PH, and SJN performed the bioactivity-guided fractionation of the crude extract and identified the single compound. J.-S.H. contributed materials. M.V. and H.K. analyzed the data and wrote the manuscript with input from all authors. The author(s) read and approved the final manuscript.

REFERENCES

  1. Atta H., Kassem D. H., Kamal M. M., Hamdy N. M. Targeting the ubiquitin proteasome system in cancer stem cells. Trends Cell Biol. 2025;35:97–101. doi: 10.1016/j.tcb.2024.11.011. [DOI] [PubMed] [Google Scholar]
  2. Barker N., Van Es J. H., Kuipers J., Kujala P., Van Den Born M., Cozijnsen M., Haegebarth A., Korving J., Begthel H., Peters P. J., Clevers H. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 2007;449:1003–1007. doi: 10.1038/nature06196. [DOI] [PubMed] [Google Scholar]
  3. Bhattacharya R., Banerjee Mustafi S., Street M., Dey A., Dwivedi S. K. D. Bmi-1: at the crossroads of physiological and pathological biology. Genes Dis. 2015;2:225–239. doi: 10.1016/j.gendis.2015.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bhattacharyya J., Mihara K., Yasunaga S., Tanaka H., Hoshi M., Takihara Y., Kimura A. BMI-1 expression is enhanced through transcriptional and posttranscriptional regulation during the progression of chronic myeloid leukemia. Ann. Hematol. 2009;88:333–340. doi: 10.1007/s00277-008-0603-8. [DOI] [PubMed] [Google Scholar]
  5. Calviello G., Su H. M., Weylandt K. H., Fasano E., Serini S., Cittadini A. Experimental evidence of ω-3 polyunsaturated fatty acid modulation of inflammatory cytokines and bioactive lipid mediators: their potential role in inflammatory, neurodegenerative, and neoplastic diseases. Biomed Res. Int. 2013;2013:743171. doi: 10.1155/2013/743171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carrasco R., Ramirez M. C., Nes K., Schuster A., Aguayo R., Morales M., Ramos C., Hasson D., Sotomayor C. G., Henriquez P., Cortés I., Erazo M., Salas C., Gormaz J. G. Prevention of doxorubicin-induced Cardiotoxicity by pharmacological non-hypoxic myocardial preconditioning based on Docosahexaenoic Acid (DHA) and carvedilol direct antioxidant effects: study protocol for a pilot, randomized, double-blind, controlled trial (CarDHA trial) Trials. 2020;21:1–10. doi: 10.1186/s13063-019-3963-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen J., Jayachandran M., Bai W., Xu B. A critical review on the health benefits of fish consumption and its bioactive constituents. Food Chem. 2022;369:130874. doi: 10.1016/j.foodchem.2021.130874. [DOI] [PubMed] [Google Scholar]
  8. Chiou G. Y., Yang T. W., Huang C. C., Tang C. Y., Yen J. Y., Tsai M. C., Chen H. Y., Fadhilah N., Lin C. C., Jong Y. J. Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells. Sci. Rep. 2017;7:1–13. doi: 10.1038/s41598-017-02057-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Crovella S., Ouhtit A., Rahman S. M., Rahman M. M. docosahexaenoic acid, a key compound for enhancing sensitization to drug in doxorubicin-resistant MCF-7 cell line. Nutrients. 2023;15:1658. doi: 10.3390/nu15071658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cui C. P., Zhang Y., Wang C., Yuan F., Li H., Yao Y., Chen Y., Li C., Wei W., Liu C. H., He F., Liu Y., Zhang L. Dynamic ubiquitylation of Sox2 regulates proteostasis and governs neural progenitor cell differentiation. Nat. Commun. 2018;9:1–15. doi: 10.1038/s41467-018-07025-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Das P. K., Islam F., Lam A. K. the roles of cancer stem cells and therapy resistance in colorectal carcinoma. Cells. 2020;9:1392. doi: 10.3390/cells9061392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. de Vera J. P., Horneck G., Rettberg P., Ott S. The potential of the lichen symbiosis to cope with extreme conditions of outer space - I. Influence of UV radiation and space vacuum on the vitality of lichen symbiosis and germination capacity. Int. J. Astrobiol. 2002;1:285–293. doi: 10.1017/S1473550403001216. [DOI] [Google Scholar]
  13. Ginestier C., Hur M. H., Charafe-Jauffret E., Monville F., Dutcher J., Brown M., Jacquemier J., Viens P., Kleer C. G., Liu S., Schott A., Hayes D., Birnbaum D., Wicha M. S., Dontu G. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 2007;1:555–567. doi: 10.1016/j.stem.2007.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Guo L. D., Huang G. R., Wang Y., He W. H., Zheng W. H., Hyde K. D. Molecular identification of white morphotype strains of endophytic fungi from Pinus tabulaeformis. Mycol. Res. 2003;107:680–688. doi: 10.1017/S0953756203007834. [DOI] [PubMed] [Google Scholar]
  15. Gurav P., Patade T., Hajare S., Kedar R. N. n-3 PUFAs synergistically enhance the efficacy of doxorubicin by inhibiting the proliferation and invasion of breast cancer cells. Med. Oncol. 2024;41:1–8. doi: 10.1007/s12032-023-02229-w. [DOI] [PubMed] [Google Scholar]
  16. Hamida R. S., Ali M. A., Abdelmeguid N. E., Al-Zaban M. I., Baz L., Bin-Meferij M. M. Lichens-a potential source for nanoparticles fabrication: a review on nanoparticles biosynthesis and their prospective applications. J. Fungi. 2021;7:291. doi: 10.3390/jof7040291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Huang J. L., Oshi M., Endo I., Takabe K. Clinical relevance of stem cell surface markers CD133, CD24, and CD44 in colorectal cancer. Am. J. Cancer Res. 2021;11:5141–5154. [PMC free article] [PubMed] [Google Scholar]
  18. Hwangbo H., Park C., Bang E., Kim H. S., Bae S. J., Kim E., Jung Y., Leem S. H., Seo Y. R., Hong S. H., Kim G. Y., Hyun J. W., Choi Y. H. Morroniside protects C2C12 myoblasts from oxidative damage caused by ROS-mediated mitochondrial damage and induction of endoplasmic reticulum stress. Biomol. Ther. (Seoul) 2024;32:349–360. doi: 10.4062/biomolther.2024.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Imai T., Tokunaga A., Yoshida T., Hashimoto M., Mikoshiba K., Weinmaster G., Nakafuku M., Okano H. The neural RNA-binding protein Musashi1 translationally regulates mammalian numb gene expression by interacting with its mRNA. Mol. Cell. Biol. 2001;21:3888–3900. doi: 10.1128/MCB.21.12.3888-3900.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jahanafrooz Z., Mosafer J., Akbari M., Hashemzaei M., Mokhtarzadeh A., Baradaran B. Colon cancer therapy by focusing on colon cancer stem cells and their tumor microenvironment. J. Cell. Physiol. 2020;235:4153–4166. doi: 10.1002/jcp.29337. [DOI] [PubMed] [Google Scholar]
  21. Jameel F., Agarwal P., Ahmad R., Siddiqui S., Serajuddin M. Synergistic anticancer effects of omega-3 fatty acids (EPA/DHA) and anticancer drug Doxorubicin against human lung adenocarcinoma. Food Biosci. 2024;61:104710. doi: 10.1016/j.fbio.2024.104710. [DOI] [Google Scholar]
  22. Jang B. G., Kim H. S., Chang W. Y., Bae J. M., Kim W. H., Kang G. H. Expression profile of LGR5 and its prognostic significance in colorectal cancer progression. Am. J. Pathol. 2018;188:2236–2250. doi: 10.1016/j.ajpath.2018.06.012. [DOI] [PubMed] [Google Scholar]
  23. Jiang Y., Li W., He X., Zhang H., Jiang F., Chen Z. Lgr5 expression is a valuable prognostic factor for colorectal cancer: evidence from a meta-analysis. BMC Cancer. 2016;16:1–9. doi: 10.1186/s12885-015-1986-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jing F., Kim H. J., Kim C. H., Kim Y. J., Lee J. H., Kim H. R. Colon cancer stem cell markers CD44 and CD133 in patients with colorectal cancer and synchronous hepatic metastases. Int. J. Oncol. 2015;46:1582–1588. doi: 10.3892/ijo.2015.2844. [DOI] [PubMed] [Google Scholar]
  25. Kellogg J. J., Raja H. A. Endolichenic fungi: a new source of rich bioactive secondary metabolites on the horizon. Phytochem. Rev. 2017;16:271–293. doi: 10.1007/s11101-016-9473-1. [DOI] [Google Scholar]
  26. Lee C., Park J. M., Hillman P. F., Yoo M., Kim H. Y., Lee C. S., Nam S. J. Anti-melanogenic activity of undecylprodigiosin, a red pigment isolated from a marine streptomyces sp. SNA-077. Biomol. Ther. (Seoul) 2024;32:492–498. doi: 10.4062/biomolther.2023.208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee J. H., Im D. S. Inhibition of sphingosine-1-phosphate receptor 2 (S1P2) attenuates imiquimod-induced psoriasis-like skin inflammation in BALB/c mice. Biomol. Ther. (Seoul) 2025;33:544–553. doi: 10.4062/biomolther.2024.197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lei X., He Q., Li Z., Zou Q., Xu P., Yu H., Ding Y., Zhu W. Cancer stem cells in colorectal cancer and the association with chemotherapy resistance. Med. Oncol. 2021;38:1–13. doi: 10.1007/s12032-021-01488-9. [DOI] [PubMed] [Google Scholar]
  29. Li N., Yousefi M., Nakauka-Ddamba A., Li F., Vandivier L., Parada K., Woo D. H., Wang S., Naqvi A. S., Rao S., Tobias J., Cedeno R. J., Minuesa G., Barlowe T. S., Valvezan A., Shankar S., Deering R. P., Klein P. S., Jensen S. T., Kharas M. G., Gregory B. D., Yu Z., Lengner C. J. The Msi family of RNA binding proteins function redundantly as intestinal oncoproteins. Cell Rep. 2015;13:2440. doi: 10.1016/j.celrep.2015.11.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu Y., Beyer A., Aebersold R. On the dependency of cellular protein levels on mRNA abundance. Cell. 2016;165:535–550. doi: 10.1016/j.cell.2016.03.014. [DOI] [PubMed] [Google Scholar]
  31. Liu Y., Tian Y., Cai W., Guo Y., Xue C., Wang J. DHA/EPA-enriched phosphatidylcholine suppresses tumor growth and metastasis via activating peroxisome proliferator-activated receptor γin lewis lung cancer mice. J. Agric. Food Chem. 2021;69:676–685. doi: 10.1021/acs.jafc.0c06890. [DOI] [PubMed] [Google Scholar]
  32. Lobine D., Rengasamy K. R. R., Mahomoodally M. F. Functional foods and bioactive ingredients harnessed from the ocean: current status and future perspectives. Crit. Rev. Food Sci. Nutr. 2022;62:5794–5823. doi: 10.1080/10408398.2021.1893643. [DOI] [PubMed] [Google Scholar]
  33. Maduranga H. A. K., Weerasinghe W. R. H., Attanayake R. N., Santhirasegaram S., Shevkar C. D., Kate A. S., Weerakoon G., Samanthi K. A. U., Kalia K., Paranagama P. A. Identification of novel bioactive compounds, neurosporalol 1 and 2 from an endolichenic fungus, Neurospora ugadawe inhabited in the lichen host, Graphis tsunodae Zahlbr. from mangrove ecosystem in Puttalam lagoon, Sri Lanka. Asian J. Chem. 2021;33:1425–1432. doi: 10.14233/ajchem.2021.23229. [DOI] [Google Scholar]
  34. Migliore L., Migheli F., Spisni R., Copped F. Genetics, cytogenetics, and epigenetics of colorectal cancer. Biomed Res. Int. 2011;2011:792362. doi: 10.1155/2011/792362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Moloudizargari M., Mortaz E., Asghari M. H., Adcock I. M., Redegeld F. A., Garssen J. Effects of the polyunsaturated fatty acids, EPA and DHA, on hematological malignancies: a systematic review. Oncotarget. 2018;9:11858–11875. doi: 10.18632/oncotarget.24405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Moreno-Londoño A. P., Robles-Flores M. Functional roles of CD133: more than stemness associated factor regulated by the microenvironment. Stem Cell Rev. Rep. 2023;20:25–51. doi: 10.1007/s12015-023-10647-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Morgan R. G., Mortensson E., Williams A. C. Targeting LGR5 in colorectal cancer: therapeutic gold or too plastic? Br. J. Cancer. 2018;118:1410–1418. doi: 10.1038/s41416-018-0118-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Newell M., Mazurak V., Postovit L. M., Field C. J. N-3 long-chain polyunsaturated fatty acids, eicosapentaenoic and docosahexaenoic acid, and the role of supplementation during cancer treatment: a scoping review of current clinical evidence. Cancers. 2021;13:1206. doi: 10.3390/cancers13061206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nguyen K. H., Chollet-Krugler M., Gouault N., Tomasi S. UV-protectant metabolites from lichens and their symbiotic partners. Nat. Prod. Rep. 2013;30:1490–1508. doi: 10.1039/c3np70064j. [DOI] [PubMed] [Google Scholar]
  40. Park H. J., Kim K., Lee E. Y., Hillman P. F., Nam S. J., Lim K. M. Methylanthranilate, a food fragrance attenuates skin pigmentation through downregulation of melanogenic enzymes by cAMP suppression. Biomol. Ther. (Seoul) 2024;32:231–239. doi: 10.4062/biomolther.2023.103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Rahman M. M., Veigas J. M., Williams P. J., Fernandes G. DHA is a more potent inhibitor of breast cancer metastasis to bone and related osteolysis than EPA. Breast Cancer Res. Treat. 2013;141:341–352. doi: 10.1007/s10549-013-2703-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schwanhüusser B., Busse D., Li N., Dittmar G., Schuchhardt J., Wolf J., Chen W., Selbach M. Global quantification of mammalian gene expression control. Nature. 2011;473:337–342. doi: 10.1038/nature10098. [DOI] [PubMed] [Google Scholar]
  43. Senbanjo L. T., Chellaiah M. A. CD44: a multifunctional cell surface adhesion receptor is a regulator of progression and metastasis of cancer cells. Front. Cell Dev. Biol. 2017;5:252198. doi: 10.3389/fcell.2017.00018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Serini S., Fasano E., Piccioni E., Cittadini A. R. M., Calviello G. Differential anti-cancer effects of purified epa and dha and possible mechanisms involved. Curr. Med. Chem. 2011;18:4065–4075. doi: 10.2174/092986711796957310. [DOI] [PubMed] [Google Scholar]
  45. Soni S., Torvund M., Mandal C. C. Omega-3 fatty acid treatment combined with chemotherapy to prevent toxicity, drug resistance, and metastasis in cancer. Curr. Drug Targets. 2021;23:574–596. doi: 10.2174/1389450122666210901121935. [DOI] [PubMed] [Google Scholar]
  46. Spriggs K. A., Bushell M., Willis A. E. Translational regulation of gene expression during conditions of cell stress. Mol. Cell. 2010;40:228–237. doi: 10.1016/j.molcel.2010.09.028. [DOI] [PubMed] [Google Scholar]
  47. Theinel M. H., Nucci M. P., Alves A. H., Dias O. F. M., Mamani J. B., Garrigós M. M., Oliveira F. A., Rego G. N. A., Valle N. M. E., Cianciarullo G., Gamarra L. F. The effects of omega-3 polyunsaturated fatty acids on breast cancer as a preventive measure or as an adjunct to conventional treatments. Nutrients. 2023;15:1310. doi: 10.3390/nu15061310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Tsugane S. Why has Japan become the world's most long-lived country: insights from a food and nutrition perspective. Eur. J. Clin. Nutr. 2020;75:921–928. doi: 10.1038/s41430-020-0677-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Varlı M., Ngo M. T., Kim S. M., Taş İ., Zhou R., Gamage C. D. B., Pulat S., Park S. Y., Sesal N. C., Hur J. S., Kang K. B., Kim H. A fatty acid-rich fraction of an endolichenic fungus Phoma sp. suppresses immune checkpoint markers via AhR/ARNT and ESR1. Heliyon. 2023;9:e19185. doi: 10.1016/j.heliyon.2023.e19185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Vogel C., Marcotte E. M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 2012;13:227–232. doi: 10.1038/nrg3185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. von Schacky C. Importance of EPA and DHA blood levels in brain structure and function. Nutrients. 2021;13:1074. doi: 10.3390/nu13041074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wang C., Xie J., Guo J., Manning H. C., Gore J. C., Guo N. Evaluation of CD44 and CD133 as cancer stem cell markers for colorectal cancer. Oncol. Rep. 2012;28:1301–1308. doi: 10.3892/or.2012.1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wang D., Bu F., Zhang W. The role of ubiquitination in regulating embryonic stem cell maintenance and cancer development. Int. J. Mol. Sci. 2019;20:2667. doi: 10.3390/ijms20112667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wube A. A., Hüfner A., Thomaschitz C., Blunder M., Kollroser M., Bauer R., Bucar F. Design, synthesis and antimycobacterial activities of 1-methyl-2-alkenyl-4(1H)-quinolones. Bioorg. Med. Chem. 2011;19:567–579. doi: 10.1016/j.bmc.2010.10.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xie F., Luan X. Y., Gao Y., Xu K., Lou H. X. Cytotoxic heptaketides from the endolichenic fungus Ulospora bilgramii. J. Nat. Prod. 2020;83:1623–1633. doi: 10.1021/acs.jnatprod.0c00108. [DOI] [PubMed] [Google Scholar]
  56. Xu Z., Zhou Z., Zhang J., Xuan F., Fan M., Zhou D., Liuyang Z., Ma X., Hong Y., Wang Y., Sharma S., Dong Q., Wang G. Targeting BMI-1-mediated epithelial-mesenchymal transition to inhibit colorectal cancer liver metastasis. Acta Pharm. Sin. B. 2021;11:1274–1285. doi: 10.1016/j.apsb.2020.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yang W., Wang Y., Wang W., Chen Z., Bai G. Expression of aldehyde dehydrogenase 1A1 (ALDH1A1) as a prognostic biomarker in colorectal cancer using immunohistochemistry. Med. Sci. Monit. 2018a;24:2864. doi: 10.12659/MSM.910109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Yang Y., Bae W. K., Nam S. J., Jeong M. H., Zhou R., Park S. Y., Taş İ., Hwang Y. H., Park M. S., Chung I. J., Kim K. K., Hur J. S., Kim H. Acetonic extracts of the endolichenic fungus EL002332 isolated from Endocarponpusillum exhibits anticancer activity in human gastric cancer cells. Phytomedicine. 2018b;40:106–115. doi: 10.1016/j.phymed.2018.01.006. [DOI] [PubMed] [Google Scholar]
  59. Zajdel A., Paduszyński P., Gruchlik A., Głogowska-Ligus J., Wilczok A., Dzierzewicz Z. Polyunsaturated fatty acids alter expression of genes encoding antioxidant enzymes in A549 cells exposed to doxorubicin. Acta Pol. Pharm. 2010;67:696–700. [PubMed] [Google Scholar]
  60. Zhang W., Ran Q., Li H., Lou H. Endolichenic fungi: a promising medicinal microbial resource to discover bioactive natural molecules-an update. J. Fungi. 2024;10:99. doi: 10.3390/jof10020099. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

bt-33-5-842-supple.pdf (8.8MB, pdf)

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES