Association of AGER genetic variants with chronic obstructive pulmonary disease susceptibility in Southern Chinese Han populations

Abstract

Objective

Chronic obstructive pulmonary disease (COPD) remains a leading cause of disability and mortality among elderly populations. Studies indicate that AGER plays a critical regulatory role in the pathogenesis of respiratory disorders. However, the genetic variations in AGER to COPD susceptibility remain incompletely understood. This study employs a case–control design to investigate associations between AGER genetic variants and COPD risk in the Southern Chinese Han population.

Methods

This study enrolled 270 COPD patients and 271 healthy controls. AGER single-nucleotide polymorphisms (SNPs) were analysed using the MassARRAY iPLEX platform. Logistic regression models evaluated associations between AGER polymorphisms and COPD susceptibility, with false discovery rate (FDR) correction applied to mitigate multiple testing errors. SNP–SNP interactions were investigated through multifactor dimensionality reduction (MDR) analysis. Expression quantitative trait locus (eQTL) data from the GTEx database were further analysed to assess regulatory relationships between SNPs and AGER gene expression levels.

Results

This study showed that rs3134941 (G allele, OR = 0.21, 95% CI = 0.10–0.41, p (FDR) = 0.001) and rs3131300 (G allele, OR = 0.32, 95% CI = 0.20–0.49, p (FDR) = 0.0001) were significantly associated with a reduced susceptibility to COPD. MDR indicated that rs3131300 was the optimal predictive model for COPD risk. Additionally, initial mechanistic investigations utilizing the GTEx database identify rs3134941 (C > G) and rs3131300 (A > G) as significant expression quantitative trait loci for AGER mRNA in cell-cultured fibroblasts and whole blood.

Conclusion

Our study demonstrated that AGER genetic variants might play a protective role in the progression of COPD.

Introduction

Chronic obstructive pulmonary disease (COPD) ranks as the third leading cause of death worldwide, characterized by persistent airflow limitation and chronic inflammation [1]. Clinical manifestations include progressive dyspnoea, recurrent acute exacerbations and systemic complications [2]. According to the Global Burden of Disease Study, COPD affects approximately 384 million individuals and causes over 3 million deaths annually [1]. The 5-year mortality rate reaches 40–70%, exceeding most solid malignancies [3]. While smoking remains the primary risk factor, emerging evidence demonstrates rising COPD prevalence among nonsmokers, highlighting the multifactorial contributions of air pollution, occupational dust exposure and genetic susceptibility [4]. Genetic factors play a pivotal role in COPD pathogenesis. Genome-wide association studies (GWAS) have identified loci including HHIP and FAM13A that significantly correlate with lung function decline [5]. As the most prevalent genetic variations, single nucleotide polymorphisms (SNPs) influence disease susceptibility and phenotypic heterogeneity through alterations in coding sequences, regulatory elements or splice sites [6,7]. Thus, conducting research into the genetic factors in COPD is of significant importance for developing novel prevention and treatment strategies.

The AGER gene, located on human chromosome 6p21.3, encodes the receptor for advanced glycation end products (RAGE), a multifunctional pattern recognition receptor. RAGE interacts with diverse ligands to regulate inflammatory responses, immune modulation, cell proliferation and apoptosis. In COPD pathogenesis, RAGE drives chronic inflammation and oxidative stress by activating NF-κB and MAPK signalling pathways [8,9]. Its excessive activation promotes alveolar epithelial cell apoptosis while inhibiting regeneration, exacerbating emphysema [10]. Genetic studies demonstrate significant associations between AGER polymorphisms and COPD susceptibility/phenotypic heterogeneity, though population-specific variations exist. For instance, the rs2070600-T allele correlates with a 15% accelerated annual FEV1 decline in East Asians [11] and confers 2.1-fold higher emphysema risk in GWAS [12]. The rs3134940-A allele significantly reduces sputum soluble RAGE (sRAGE) levels and accelerates lung function deterioration in biomass smoke-exposed populations [13], yet shows weaker associations in European cohorts [14]. Notably, the AGER haplotype (rs2070600-rs3134940-rs184003) in Northern Chinese Han populations combined with smoking elevates COPD risk by 3.5-fold [15]. Trans-ethnic meta-analyses confirm AGER variants independently associate with baseline lung function parameters [16]. Observed discrepancies arise from population genetic heterogeneity, sample size variations, genotyping methodologies and environmental confounders. Further investigations into AGER SNPs in population-specific COPD susceptibility are therefore warranted.

This study aims to investigate the association between five SNP loci (rs3134941, rs184003, rs1035798, rs2070600 and rs3131300) in the AGER gene and COPD susceptibility in the Southern Chinese Han population. Using a case–control association design, we will evaluate the independent effects of these SNPs on COPD risk and their interaction effects. The findings may offer genetic markers for early screening of high-risk populations and provide novel insights into the genetic mechanisms underlying COPD pathogenesis.

Materials and methods

Sample selection

This case–control genetic association study was approved by the Ethics Committee of Hainan General Hospital (Medical Ethics Research [2022] No. 312) and conducted in accordance with the ethical principles of the Helsinki Declaration, as described in our previous publication [17]. Sample size was calculated using G*Power software version 3.1.9.7. A t-test for the difference between two independent means was selected, with the following parameters: two-tailed test, effect size d = 0.26, significance level α = 0.05, statistical power (1-β) = 0.8 and allocation ratio N2/N1 = 1. This calculation determined a required sample size of 267 participants per group. The study comprised 270 COPD patients and 271 gender- and age-matched healthy controls recruited between August 2022 and September 2024 at Hainan Provincial People’s Hospital, with all participants providing written informed consent. Inclusion criteria of the case are as follows: (1) Meeting GOLD 2023 diagnostic criteria: persistent respiratory symptoms (cough, sputum production, dyspnoea or wheezing) and post-bronchodilator FEV₁/FVC < 70% after 400 μg salbutamol sulphate administration [18]. (2) Age ≥ 18 years. (3) At least three generations of Han Chinese ancestry in Hainan without interethnic marriage. (4) Normal cognitive function for independent study completion. Exclusion criteria were: (1) Comorbid restrictive ventilatory disorders (active tuberculosis, thoracic deformities, pleural effusion and bronchial carcinoma). (2) Other obstructive airway diseases (bronchiectasis and tuberculous lung destruction). (3) History of allergic diseases (asthma, allergic rhinitis). (I4) Interethnic marriage within three generations. Control subjects were selected from health examination populations without history of COPD, asthma, other respiratory diseases, chronic cough, wheezing, dyspnoea or COPD medication use. Demographic and clinical data were collected through medical records and standardized questionnaires.

DNA extraction

Genomic DNA was isolated from whole blood samples obtained from COPD patients and healthy controls using the GoldMag Mini Whole Blood Genomic DNA Purification Kit. DNA quality and concentration were subsequently analysed with a Nanodrop 2000 spectrophotometer, with stringent acceptance criteria requiring a minimum concentration of 20 ng/μL and OD260/280 purity ratios within the optimal range of 1.8–2.0.

SNP selection and genotyping

This study selected five SNPs (rs3134941, rs184003, rs1035798, rs2070600 and rs3131300) in the AGER gene based on the following criteria: (1) The genomic coordinates of the AGER gene on chromosome 6 (GRCh37/hg19: 32180968-32184322) were retrieved from the human reference genome. Using these coordinates in the VCF to PED Converter tool, we extracted SNPs for the Southern Han Chinese (CHS) population, obtaining .ped and .info files containing a total of 24 SNPs. (2) Tag SNPs were identified from the initial set using Haploview software, applying the following filters: minor allele frequency (MAF) > 0.05, minimum genotype call rate > 75%, pairwise linkage disequilibrium (LD) threshold r² < 0.8 and Hardy–Weinberg equilibrium (HWE) p value > 0.05. (3) SNPs with an individual call rate <95% were excluded. (4) SNPs previously reported in association with COPD were excluded. These sequential filters resulted in the selection of the five SNPs listed above for further investigation. The primer sequences listed in Table 1 were meticulously designed using the Agena Bioscience Assay Design Suite version 2.0 online software. To achieve precise genotyping of these five AGER SNPs, the Agena MassARRAY platform was employed. Data management, analysis and accurate interpretation of genotyping results were conducted using the Agena Bioscience TYPER software version 4.0, ensuring robust quality control throughout the process.

Table 1.

PCR Primer sequences used in this study.

SNP	1st-PCRP	2nd-PCRP	UEP_SEQ
rs3134941	ACGTTGGATGCCAAGATCGCACCATTGCAT	ACGTTGGATGCAGTGGAGTCTTTCCCTTTC	cGGAGTTTCACTTTTGTTGCC
rs184003	ACGTTGGATGTCAGCTCCTAGCCTGCCTTT	ACGTTGGATGTGAAGGATGTGAGTGACCTG	GGTAGGGTGAACCATAACTA
rs1035798	ACGTTGGATGGAAAAAGCCTTCAACCCCAG	ACGTTGGATGCTGTAATTGTGAAGGTTCTC	cctgGTGAAGGTTCTCAAACTCTGT
rs2070600	ACGTTGGATGAGCTTGGAAGGTCCTGTCTC	ACGTTGGATGCGGAAAATCCCCTCATCCTG	CCGGAAGGAAGAGGGAGC
rs3131300	ACGTTGGATGTGCTGGTCCTCAGTCTGTG	ACGTTGGATGTTAAAGTGCTTTCTGCAGGG	tGGGTCAGTGGGGTTG

SNP: single nucleotide polymorphisms; PCRP: polymerase chain reaction primer; UEP_SEQ: unique extension primer_sequenom

Bioinformatic analysis

This study employed the HaploReg version 4.2 online tool to analyse five SNPs and predict their potential regulatory functions [19]. Concurrently, expression quantitative trait locus (eQTL) analysis was performed using the Genotype-Tissue Expression (GTEx) database (http://www.gtexportal.org/) to evaluate the correlation between the selected SNP loci and AGER gene expression levels [20].

Statistical analysis

This study employed the following statistical analysis pipeline to assess the association between AGER gene variants and COPD susceptibility. Initial comparisons of continuous variables (e.g. age, body mass index [BMI]) and categorical variables (e.g. sex, smoking and alcohol consumption) between case and control groups were performed using independent t-tests and Pearson’s chi-square tests, respectively. HWE testing verified genetic distribution conformity of five SNP loci in controls. Subsequently, logistic regression models analysed SNP-COPD risk associations, calculating adjusted odds ratios (ORs) with 95% confidence intervals (95% CI) after controlling for age, sex, BMI, and smoking status. Analyses encompassed allelic, codominant, dominant, recessive and additive genetic models. To address multiple comparisons, statistical significance thresholds were adjusted using the Benjamini–Hochberg procedure to control the false discovery rate (FDR). Forest plots constructed through the Sangerbox platform visualized genetic effects. Furthermore, multifactor dimensionality reduction (MDR) analysis with information gain entropy values evaluated potential SNP–SNP interaction effects on COPD risk, accompanied by interaction network dendrogram construction. All statistical procedures were conducted using SPSS version 22.0 software (SPSS Inc., Chicago, IL), with statistical significance defined as two-tailed p < 0.05.

Results

Effects of AGER gene polymorphisms on COPD susceptibility

The comparative analysis of demographic characteristics between the case and control groups is presented in Table 2. The case group demonstrated significantly higher mean age (72.26 ± 10.40 years) compared to the control group (69.21 ± 6.61 years) (p < 0.001). However, no statistically significant differences were observed in gender distribution (76.3% male vs. 77.5% male, p = 0.742), BMI levels (21.35 ± 3.66 kg/m² vs. 21.64 ± 3.70 kg/m², p = 0.350), smoking status (p = 0.518) or alcohol consumption (p = 0.575). These findings indicate effective matching between groups for potential confounding variables including sex, BMI and substance use behaviours. This matching strategy successfully minimized interference from these covariates in analyzing associations between AGER gene SNPs and COPD susceptibility.

Table 2.

Comparative analysis of demographic characteristics between COPD patients and healthy controls.

Characteristics	COPD (N = 270)	Healthy control (N = 271)	p value
Age (mean ± SD, years)	72.26 ± 10.40	69.21 ± 6.61	<0.001a
Gender
Women	64 (23.7%)	61 (22.5%)	0.742b
Men	206 (76.3%)	210 (77.5%)
BMI (mean ± SD, kg/m2)	21.35 ± 3.66	21.64 ± 3.70	0.350a
≥24	57 (21.1%)	65 (24.0%)
<24	213 (78.9%)	206 (76.0%)
Smoking status
Yes	142 (52.6%)	135 (49.8%)	0.518b
No	128 (47.4%)	136 (50.2%)
Drinking status
Yes	126 (48.6%)	133 (51.4%)	0.575b
No	144 (51.1%)	138 (48.9%)

COPD: chronic obstructive pulmonary disease; BMI: body mass index

^ap Value was evaluated by t-test. ^bp Value was tested by a two-sided χ² test. p < 0.05 presents a significant difference.

Genotyping was performed for five SNP loci (rs3134941 C > G, rs184003 C > A, rs1035798 G > A, rs2070600 C > T, rs3131300 A > G) within the AGER gene. Table 3 summarizes the chromosomal positions, minor/major allele distributions, functional annotations, MAF in case and control groups and HWE test results in controls. All SNPs conformed to HWE in controls (p > 0.05), indicating genetic equilibrium within the sampled population. This equilibrium status demonstrates stable allele and genotype frequency distributions of these SNPs, with no significant evolutionary disturbances from non-random mating, mutation, population migration or natural selection pressures.

Table 3.

Information for SNPs in AGER.

SNP	Function	Chr: position	Allele (A/B)	MAF		HWE p	HaploReg v4.2
				Case	Control
rs3134941	Intron variant	6: 32181760	G/C	0.020	0.091	0.708	Enhancer histone marks, motifs changed, selected eQTL hits
rs184003	Intron variant	6: 32182519	A/C	0.109	0.115	1.000	Enhancer histone marks, DNAse, proteins bound, motifs changed, selected eQTL hits
rs1035798	Intron variant	6: 32183445	A/G	0.110	0.115	0.549	DNAse, GRASP QTL hits, selected eQTL hits
rs2070600	Missense variant	6: 32183666	T/C	0.214	0.206	0.852	Enhancer histone marks, DNAse, motifs changed, NHGRI/EBIGWAs hits, selected eQTL hits
rs3131300	Non-coding transcript variant	6: 32184157	G/A	0.052	0.148	1.000	Enhancer histone marks, proteins bound, motifs changed, selected eQTL hits

SNP: single nucleotide polymorphism; A: minor; B: major; MAF: minor allele frequency; HWE: Hardy–Weinberg equilibrium

Figure 1 demonstrates the associations between SNPs and COPD risk. For the rs3134941 locus in the AGER gene, the G allele showed significant correlation with reduced COPD risk in the allele model (OR = 0.21, 95% CI = 0.10–0.41, p (FDR) = 0.001). Under the codominant model, individuals carrying the CG genotype exhibited decreased COPD susceptibility (OR = 0.21, 95% CI = 0.10–0.41, p (FDR) = 0.0002). The dominant model revealed that C/G-G/G genotypes were significantly associated with lower COPD risk (OR = 0.20, 95% CI = 0.10–0.40, p (FDR) = 0.0001), while the additive model confirmed rs3134941’s protective effect against COPD development (OR = 0.21, 95% CI = 0.10–0.41, p (FDR) = 0.0003). Similarly, the G allele of rs3131300 displayed significant COPD risk reduction in allelic analyses (OR = 0.32, 95% CI = 0.20–0.49, p (FDR) = 0.0001). Codominant analysis identified AG genotype carriers with diminished COPD risk (OR = 0.32, 95% CI = 0.20–0.52, p (FDR) = 0.0002), and the dominant model demonstrated protective effects of AG-GG genotypes ((OR = 0.30, 95% CI = 0.18–0.48, p (FDR) = 0.0001)). Additive model results further supported that rs3131300 was significant associated with reduced risk of COPD risk (OR = 0.30, 95% CI = 0.19–0.48, p (FDR) = 0.0001). No significant correlations were observed between COPD risk and the remaining three loci (rs184003, rs1035798, rs2070600) across all genetic models.

Figure 1.

The association of AGER genetic variants with COPD risk under different genetic models. If a was the wild-type allele and B was the mutant allele, the genetic models were defined as follows: Allele model: B vs. A (a was the reference). HET model: AB vs. AA (AA was the reference). HOM model: BB vs. AA (AA was the reference). Dominant model: Combined AB + BB vs. AA (AA was the reference). Recessive model: BB vs. combined AA + AB (AA + AB was the reference). Log-additive model: ordered comparison of AA vs. AB vs. BB. OR: odds ratio, CI: confidence interval, FDR: false discovery rate, HOM: homozygous, HET: heterozygote. The p-value was calculated using logistic regression analysis, adjusted for age, gender, body mass index and smoking.

MDR analysis

This study applied MDR to analyse SNP–SNP interactions influencing genetic susceptibility to COPD. As shown in Table 4, the rs3131300 locus emerged as the optimal predictive model for COPD risk, demonstrating a significant risk effect (p < 0.0001) with perfect cross-validation consistency (CVC = 10/10) and a testing balanced accuracy of 0.5833, indicating robust predictive stability. In the interaction network diagram (Figure 2), node sizes represent the information gain (percentage entropy reduction) from individual SNP main effects, while connection thickness reflects pairwise SNP interaction-derived information gain. Notably, positive entropy values (orange) characterize synergistic effects (non-additive interactions), whereas negative entropy values (blue/green) indicate effect redundancy or independence (additive effects). The analysis revealed a negative entropy value (information gain = −4.13%) for the interaction between rs3131300 and rs3134941, suggesting genetic independence or phenotypic explanatory redundancy in their combined effects on COPD risk.

Table 4.

SNP–SNP interaction analysis in AGER.

Model	Testing Bal. Acc.	CVC	p
rs3131300	0.5833	10/10	<0.0001
rs184003, rs3131300	0.5574	7/10	<0.0001
rs184003, rs1035798,rs3131300	0.5667	7/10	<0.0001
rs3134941, rs184003, rs1035798, rs3131300	0.5556	6/10	<0.0001
rs3134941, rs184003, rs1035798, rs2070600, rs3131300	0.5537	10/10	<0.0001

MDR: multifactor dimensionality reduction; Bal. Acc.: balanced accuracy; CVC: cross-validation consistency

p values were calculated by χ² test.

Figure 2.

The Fruchterman-Reingold of SNP–SNP interaction. Node magnitudes quantify individual information gains (main effects), while edge weights indicate pairwise interaction effects. Negative percentage entropy values in grey, green and blue hues denote redundancy or independence between attributes.

The impact of SNPs on gene expression (eQTLs)

Utilizing the GTEx database, we analysed rs3134941 and rs3131300 as eQTLs for AGER mRNA expression. Both SNPs demonstrated significant associations in cells-cultured fibroblasts and whole blood. Specially, rs3134941 exhibited strong eQTL effects in cell-cultured fibroblasts (p = 5.7e-5) and whole blood (p = 5.82e-6) (Figure 3(A)). Similarly, rs3131300 was significantly associated with AGER expression in cells-cultured fibroblasts (p = 7.18e-5) and whole blood (p = 8.5e-6) (Figure 3(B)). These findings indicate consistent regulatory effects of both SNPs on AGER transcription across distinct tissue types.

Figure 3.

GTEx Association analysis of rs3131941 (A) and rs3131300 (B) with AGER expression levels.

Discussion

COPD is a progressive respiratory disorder characterized by significant impairment of pulmonary function, reduced quality of life and elevated mortality rates [21]. Genetic predisposition plays a critical role in its pathogenesis [22–24]. Although previous studies have investigated associations between AGER gene polymorphisms and COPD susceptibility, their conclusions remain inconsistent. This study examines the relationship between AGER genetic variants and COPD predisposition in a Southern Chinese Han population. Results demonstrated that SNP loci rs3134941 and rs3131300 in the AGER gene exhibited significant associations with reduced COPD risk. These findings provide novel molecular insights into COPD biological mechanisms and genetic susceptibility.

This study identified significant associations between AGER gene loci rs3134941 and rs3131300 with reduced COPD risk in the CHS population. The effect sizes observed for these variants, particularly rs3134941, were notably stronger than those previously reported in Northern Han Chinese populations [15], highlighting potential regional genetic heterogeneity within Han Chinese subgroups, possibly influenced by environmental factors or differing allele frequencies. Notably, functional studies by Malik et al. revealed that AGER variants modulate sRAGE levels, an anti-inflammatory mediator inversely correlated with pulmonary function decline in COPD [25]. These findings suggest that the protective effects of rs3134941/rs3131300 may stem from enhanced sRAGE expression or improved ligand-binding capacity. Contrary to findings in some other populations [26–28], we observed no significant associations between COPD risk and the rs184003, rs1035798 and rs2070600 loci in our Southern Chinese cohort. This discrepancy, also noted in Korean cohorts for rs2070600 [29], underscores that the effects of specific variants can be highly dependent on population genetic background, phenotype definition and environmental context [16]. The lack of association for rs2070600 compared to the findings in the Northern Chinese cohort and the studies linking it to impaired lung function warrants consideration. One potential explanation lies in differences in LD structures across ethnic groups. Collectively, these non-significant findings underscore the importance of population background, precise phenotyping and environmental context in interpreting genetic associations for complex diseases like COPD.

To investigate SNP–SNP interactions influencing to COPD susceptibility, we applied MDR analysis. The optional interaction model identified rs3131300 alongside adjacent variants, demonstrating significant predictive power for COPD risk (CVC). This finding suggests rs3131300 may serve as an independent predictor of COPD susceptibility. Notably, the interaction between rs3131300 and rs3134941 exhibited negative entropy values, indicating genetic independence or functional redundancy in explaining COPD phenotypes. This implies distinct biological pathways might mediate their disease-associated effects. Further mechanistic studies are required to elucidate molecular interactions between these loci.

Genetic variation can influence phenotypic traits and susceptibility to complex diseases such as COPD by regulating gene expression. This study identified two SNPs (rs3134941 and rs3131300) significantly associated with AGER expression through eQTL analysis using the GTEx database. Notably, AGER has been implicated in COPD pathogenesis via mediation of inflammatory responses and oxidative stress pathways, as evidenced by prior studies [30–34]. We propose that these SNPs may modulate COPD susceptibility by altering AGER expression levels. Our findings suggest a potential association between AGER polymorphisms and COPD risk in the CHS population, expanding current understanding of COPD genetics and highlighting AGER SNPs as potential biomarkers for risk stratification. However, molecular mechanisms underlying AGER’s role in COPD (particularly RAGE signalling-mediated alveolar structural damage) warrant further investigation.

This study has several limitations. First, although the sample size is statistically adequate, the relatively small sample size may reduce the power to detect rare genetic variants or weak effect associations. Second, the findings are confined to specific geographic and ethnic populations, requiring validation across broader demographics to confirm generalizability. Despite this, our findings hold potential clinical relevance. For risk prediction, polymorphisms in the AGER gene associated with COPD susceptibility could refine personalized risk assessment models. Incorporating these genetic markers alongside traditional risk factors might facilitate early identification of high-risk individuals, enabling timely preventive interventions. Regarding targeted therapies, the AGER gene’s involvement in inflammatory and oxidative stress pathways offers insights for novel drug development. If a specific polymorphism heightens inflammatory response via the AGER protein, therapies modulating this pathway could be designed, providing more precise treatment options. However, before translating these biomarkers into clinical screening or application, current limitations must be addressed. Larger, more diverse cohorts are essential to validate the genetic associations and enhance generalizability. Functional studies are also critical to elucidate the mechanistic impact of these genetic variations on COPD pathogenesis. This will solidify the genetic foundation for early diagnosis, risk stratification and personalized management in COPD.

Conclusion

This study indicated that rs3134941 and rs3131300 in the AGER gene was significantly related to a reduced risk of COPD in the Southern Chinese Han population, which enhanced current understanding of this gene’s role in COPD pathogenesis. These findings suggest potential variations in disease-modifying effects of specific loci across diverse populations and genetic contexts. Subsequent large-scale multicenter investigations are required to validate these genetic associations, clarify their mechanistic contributions to COPD progression, and evaluate their potential utility as biomarkers or therapeutic targets.

Funding Statement

This article was supported by Hainan Province Science and Technology Special Fund (No. ZDYF2024SHFZ094), Innovation Platform for Academicians of Hainan Province and National Natural Science Foundation of China (No. 82160011).

Ethics approval and consent to participate

Our study was approved by the Ethics Committee of Hainan General Hospital. All procedures involving human participants in this study were conducted in accordance with the ethical standards of Hainan General Hospital and the principles of the Helsinki Declaration. Informed consent was obtained from all individual participants.

Consent for publication

Not applicable.

Disclosure statement

The authors declare that they have no conflict of interest.

Data availability statement

The data included in this study are available from the corresponding author on reasonable request.