Potentiation of Nigra–Striatal Dopaminergic Projection Underpins Core Autism-Like Behaviors in Valproate-Exposed Mice

Abstract

Autism is characterized by two key diagnostic criteria including social deficits and repetitive behaviors. However, the underlying neural circuit dysfunction that accounts for these coexisting symptoms in autism remains poorly understood. Here we revealed that prenatal valproate exposure induced functional alterations of dopaminergic projections from substantia nigra pars compacta (SNc) to dorsomedial striatum (DMS). Specifically, we observed enhanced excitatory input and increased excitability in SNc→DMS dopamine (DA) neurons, resulting in a basal state of potentiation. This potentiated baseline activity blunted the phasic responses of SNc→DMS projections, as evidenced by reduction of transient Ca²⁺ and DA signaling during social interaction and expression of repetitive behaviors in valproate-exposed male mice. We then utilized chronic chemogenetic and optogenetic approaches to selectively manipulate the abnormal basal activity of SNc→DMS dopaminergic signaling. This targeted intervention successfully rectified the dysfunction in D1R-expressed medium spiny neurons (D1-MSNs) associated with social deficits, while simultaneously restoring the functionality of D2-MSNs linked to repetitive behaviors. Collectively, our findings support the hypothesis that prenatal valproate exposure disrupts SNc→DMS dopaminergic signaling, which mediates the coexistence of two core autism-like behaviors by reshaping the dynamics of direct and indirect pathway MSNs. Moreover, these results highlight potential therapeutic targets for developing interventions for both core symptoms of autism.

Significance Statement

Autism is characterized by two key diagnostic criteria including social deficits and repetitive behaviors. Although the two core symptoms are apparently different and seemingly unrelated, they are actually associated with each other; social behaviors need to be processed by a series of actions. Repetitive behaviors, especially the high-order restrictive interests, have their scopes to cognitive and emotional domains. This study, for the first time, revealed that prenatal valproate exposure disrupts nigrostriatal dopaminergic signaling, which mediated the coexistence of two core autism-like behaviors by reshaping the dynamics of direct and indirect pathway MSNs. These results offer insights regarding dopaminergic signaling as a hub underpinning the two coexisting behavioral abnormalities and highlighting potential therapeutic targets for autism.

Introduction

Autism spectrum disorder (ASD) is characterized by two symptom domains including impaired social interactions and restrictive interests and repetitive behaviors (American Psychiatric Association, 2013; Lai et al., 2014). Although the two core ASD symptoms are apparently different and seemingly unrelated, they are actually associated with each other, social behaviors need to be processed by a series of actions and repetitive behaviors, especially the high-order repetitive behaviors such as restrictive interests, have their scopes to cognitive and emotional domains (Langen et al., 2007). The coexistence of ASD core symptoms, together with the anatomical overlap in brain regions mediating both social behavior and motor control (Bariselli et al., 2016; Fuccillo, 2016), raises a compelling hypothesis that these two ASD behavioral abnormalities might share a common neural circuit.

Recent evidence including ours has elucidated a relationship between autism-like behaviors and dysfunction in the striatal direct and indirect pathways (Rothwell et al., 2014; Fuccillo, 2016; Wang et al., 2017; Lee et al., 2018; Di et al., 2022). This suggests that the striatum functions as a common node in the pathophysiology of ASD (Fuccillo, 2016). Approximately 95% of striatal neurons are medium-sized spiny GABAergic projection neurons (MSNs), which can be categorized into two distinct populations: direct pathway MSNs expressed dopamine D1 receptors (D1R, D1-MSNs) and indirect pathway MSNs expressed dopamine D2 receptors (D2R, D2-MSNs). The striatum plays a critical role in the regulation of reward processing, movement control, and goal-directed behaviors through the opposing functions of these pathways (Kravitz et al., 2010; Calabresi et al., 2014; Cox and Witten, 2019). In pathological conditions, these pathways are implicated in the emergence of ASD-related behavioral abnormalities (Gunaydin et al., 2014; Fuccillo et al., 2016; Wang et al., 2017; Solié et al., 2022). Notably, several studies have demonstrated that D1-MSNs mediate social behaviors (Gunaydin et al., 2014; Francis et al., 2015; van der Kooij et al., 2017; Folkes et al., 2020), while others indicate that D2-MSNs are associated with repetitive behaviors (Tanimura et al., 2010; Wang et al., 2017; Muehlmann et al., 2020). Most importantly, our previous findings revealed that prenatal exposure to valproate acid (VPA) induce coexisting and opposite functional alterations in D1-MSNs and D2-MSNs pathways within DMS, and these alterations differentially mediate two coexisting autism-like behavioral abnormalities, respectively (Di et al., 2022).

One of the key characteristics of MSNs in the striatum is the differential expression of dopamine receptors, specifically D1R and D2R. Striatal MSNs receive robust dopaminergic inputs from midbrain dopamine (DA) neurons, which play a crucial role in differential modulating corticostriatal glutamatergic signaling and the intrinsic excitability of direct and indirect pathway MSNs (Kreitzer and Malenka, 2005; Surmeier et al., 2007, 2014; Gerfen and Surmeier, 2011). Recent findings from both clinical and animal studies have highlighted the dysregulation of dopaminergic systems in ASD (Karayannis et al., 2014; Bariselli et al., 2016, 2018; Paval, 2017; Clements et al., 2018; Paval and Miclutia, 2021; Zurcher et al., 2021; DiCarlo and Wallace, 2022), supporting the emergence of a dopaminergic hypothesis of ASD (Paval, 2017; Paval and Miclutia, 2021). However, the precise abnormalities within DA neurons and the mechanisms by which dysregulation of dopaminergic projection pathways contributes to the behavioral manifestations of autism remain poorly understood. We propose that the dopaminergic system may play a pivotal role in regulating two core symptoms of ASD through the differential modulation of direct and indirect pathway MSNs in DMS.

VPA is a medication used for epilepsy and bipolar and is black boxed for pregnant women (Christensen et al., 2013). Prenatal VPA exposure affects global gene expression profiles and replicates a relatively full spectrum of ASD symptomatology. Thus, it is a commonly used ASD model representing the environmental/genetic factor interaction in etiology (Mabunga et al., 2015). In this study, we found that prenatal VPA exposure potentiated basal activity in SNc→DMS DA projection, which in turn induced opposite alterations in DMS direct pathways and indirect pathways MSNs by activating different dopamine receptors and subsequently mediates social deficits and repetitive behaviors, respectively.

Materials and Methods

Mouse strain

All mouse experiments were approved by the Institutional Animal Care and Use Committee of Shaanxi Normal University and complied with the National Institutional Guidelines for Animal Experimentation. The study utilized C57BL/6J, DAT-ires-Cre [B6. SJL-Slc6a3tm1.1(Cre) Blmn/J, Stock number: 006660], Drd1-eGFP knock-in mice (B6. Biocytogen, LC-060). The animals were housed in a facility designed to simulate a natural light/dark cycle (lights on at 8:00 A.M. and off at 8:00 P.M.) and were maintained under strictly controlled temperature conditions. Ad libitum access to food and water was provided at all times to ensure the health and nutritional needs of the mice. All experiments were conducted in a blinded manner, and mice from the same were randomly assigned to different experiments groups.

VPA-induced autism models

VPA-induced (Sigma-Aldrich, P4543) models of autism have been previously described (Di et al., 2022). Briefly, VPA was dissolved in 0.9% saline to a final concentration of 250 mg/ml. Pregnant mice were administered a single intraperitoneal injection of either 500 mg/kg VPA or an equivalent volume of vehicle saline as a control on embryonic day (E) 12.5. Only male offspring were included in this study since severe autism-like behavior deficits were only observed in male offspring after VPA exposure as previous reports (Kim et al., 2013; Mabunga et al., 2015).

Viral vectors

AAV-Ef1α-DIO-GCaMp6m (PT-0283), AAV-hSyn-DA3m (PT-4720), AAV-hSyn-DIO-hM3D(Gq)-mCherry (PT-0019), AAV-hSyn-DIO-hM4D(Gi)-mCherry (PT-0020), AAV-hSyn-DIO-mCherry (PT-0115), and AAV-Ef1a-DIO-EYFP (PT-0012) were purchased from BrainVTA. pAAV-Ef1α-DIO-eNpHR3.0-EYFP (AG26966) and pAAV-Ef1α-DIO-EYFP (AG20296) were obtained from OBiO Technology. All vectors were serotyped with AAV2/9 and prepared at titers of ∼2–5 × 10¹² vector genomes (vg) ml⁻¹. The viral vectors were aliquoted and stored at −80°C until used.

Stereotaxic surgery

For all surgeries, mice were anesthetized with isoflurane (4% for induction and 1% for maintenance) and were secured in a stereotaxic frame equipped with a mouse adaptor (RWD Life Science). Body temperature was maintained at 37°C throughout the procedure. Each animal positioned in the stereotaxic frame using nonpuncturing ear bars. Skull measurements were referenced to bregma according to the mouse atlas. The surgeries exposed the brain surface above SNc or DMS. The stereotaxic coordinates for SNc were as follows: anteroposterior (AP) −3.0 mm, mediolateral (ML) ± 1.1 mm, and dorsoventral (DV) −4.25 mm; for DMS, they were AP +0.7 mm, ML ±1.5 mm, and DV −2.8 mm. Viral injection was administered at a rate of 40 nl per minute using borosilicate glass pipettes connected to a 10 µl microsyringe (Hamilton). The needle was left in place for an additional 10 min after the injection to facilitate viral diffusion.

Fiber photometry

A fiber photometry recording system (ThinkerTech) was used to record Ca²⁺ signals (GCaMp6m) or dopamine release signals (DA3m) in neuronal population or terminals during behavioral tests. To capture Ca²⁺ transient signals in SNc DA cell bodies, a total volume of 200 nl AAV-Ef1α-DIO-GCaMp6m or AAV-Ef1α-DIO-EGFP was unilaterally injected into SNc (AP: −3.0 mm; ML: −1.1 mm; DV: −4.25 mm), followed by implantation of an optic fiber (200 µm core diameter, 0.37 NA; Shanghai Fiblaser) 0.1 mm above the injected site. To record Ca²⁺ transient signals in SNc→DMS terminals, 200 nl of AAV-Ef1α-DIO-GCaMp6 m or AAV-Ef1α-DIO-EYFP was unilaterally injected into SNc (AP: −3.0 mm; ML: −1.1 mm; DV: −4.25 mm), and an optic fiber was subsequently implanted into DMS (AP: +0.7 mm; ML: −1.5 mm; DV: −2.8 mm). For monitoring DA release in DMS, 200 nl of rAAV-hSyn-DA3 m or AAV-hSyn-EYFP was unilaterally infused into DMS (AP: +0.7 mm; ML: −1.5 mm; DV: −2.8 mm), and an optical fiber was implanted 0.1 mm above the injected site. Dental cement was used to secure the fiber after implantation. Following surgery, mice were allowed to recover in their cages for 2–3 weeks before behavioral testing. Laser intensity at the fiber tips was measured and adjusted to 30–40 µW to minimize laser bleaching. The signal was digitalized at 50 Hz and recorded using Cam Fiber Photometry software (ThinkerTech). Considering the number and duration of the behavioral events are differential in VPA and Control mice, and an overall adaptation of dopaminergic neuron activity after repeated exposure to the same conspecific (Solié et al., 2022; Molas et al., 2024), the first three behavioral events were included for statistical analysis to avoid biases among mice and conditions. Fluorescence changes were quantified by calculating ΔF/F (ΔF/F = (F − F₀) / F₀), where F₀ represents the baseline fluorescence signal. The area under the perievent plot curve was calculated during a 2 s time window following the initiation of the behavioral bout to evaluate the magnitude of the calcium response.

In vivo electrophysiology and analysis

Mice were anaesthetized with isoflurane and placed in a stereotaxic apparatus. Their body temperature was maintained at 37 ± 0.5°C. Following a craniotomy, a glass microelectrode (2.0 mm outer diameter × 1.16 mm inner diameter; Harvard Apparatus; 8–10 MΩ) filled with 2 M sodium chloride was lowered into the mSNc using the following coordinates: AP −2.9 to −3.5 mm; ML ±0.7 to 1.2 mm; DV −4.0 to −4.8 mm. SNc DA neurons were identified based on standardized electrophysiological features (Ungless and Grace, 2012), which included the following: (1) a typical triphasic action potential with a duration of at least 1.1 ms (measured from the start of the action potential to the negative trough); (2) a slow spontaneous firing rate (≤10 Hz) with an irregular single spiking pattern; single and burst spontaneous firing patterns consisting of 2 to 10 spikes in vivo. The start of a burst was defined by an interspike interval <80 ms, and the end of the burst was defined by an interspike interval >160 ms. Data from at least 5 min of stable recording were analyzed for four parameters for SNc DA neurons (Cao et al., 2010): (1) average firing rates; (2) bursting rate; the percentages of spikes with bursts (number of spikes within bursts / total number of spikes × 100%). All recordings were performed without knowledge of the experimental groups until after the analysis of spontaneous activity. Extracellular signals were amplified (1,000×) and filtered (0.3–1 kHz bandpass) using a Neurolog System (Digitimer). Single neuron spikes were collected online (Micro1401, Spike2; Cambridge Electronic Design) and stored on a computer for offline analysis.

Electrophysiology in vitro

Slice preparation

Mice were anesthetized with isoflurane and decapitated. Horizontal acute midbrain slices (250 µm) containing SNc were prepared using a microslicer (VT 1200S, Leica). Slices were maintained in artificial cerebrospinal fluid (ACSF) containing the following (in mM): 125 NaCl, 2.5 KCl, 25 glucose, 25 NaHCO₃, 1.25 NaH₂PO₄, 2 CaCl₂, and 1 MgCl₂, with a constant flow rate of ACSF equilibrated with 95% O₂ and 5% CO₂. Slices were incubated at room temperature for at least 30 min to recover and were then transferred to a holding chamber filled with oxygenated ACSF.

Visualization and identification standards for DA neurons

Neurons in brain slices were visualized using a 40× water-immersion lens (DM-LFSA, Leica) equipped with infrared-differential interference contrast and an infrared camera (IR-1000) connected to a video monitor. To identify SNc→DMS DA neurons, we adopted a three-step strategy. First, retrobeads (Lumafluor) were injected into DMS of C57BL/6J mice, which facilitated the retrograde tracing of SNc DA neurons that projected to DMS. Second, these neurons were characterized by their large somatic size, a cell capacitance >28 pF, and the presence of a hyperpolarization-activated I_h current, all of which are characteristic features of DAergic neurons in mice (Bariselli et al., 2016). Lastly, after electrophysiological recordings, the cytoplasmic contents of the recorded cells were aspirated into the patch pipette for subsequent identification of SNc→DMS DA neurons using single-cell PCR, with minor modifications to a method previously described (Diao et al., 2021). Recordings were obtained from neurons that had been virally tagged with mCherry and were subsequently sorted as SNc→DMS DA neurons in chronic DREADD experiments.

Whole-cell patch-clamp recording

For voltage-clamp recordings of excitatory postsynaptic currents (EPSCs), pipettes with a resistance of 2–4 MΩ were filled with an internal solution containing the following (in mM), as previous reported (Musardo et al., 2022): 130 CsCl, 4 NaCl, 2 MgCl₂, 1.1 EGTA, 5 HEPES, 2 Na₂ATP, 5 sodium creatine phosphate, 0.6 Na₃GTP, adjusted to pH 7.2–7.3 and 280 to 285 mOsm. Spermine (0.1 mM, Sigma-Aldrich) was added to the internal solution for measuring the current–voltage relationship of AMPAR currents. Cells were recorded at an access resistance of 10–20 MΩ for SNc→DMS DA neurons (Bariselli et al., 2016; Musardo et al., 2022). All experiments were conducted in the presence of 100 µM PTX (Tocris Bioscience), a GABA^a receptor antagonist, with SNc→DMS DA neurons clamped at −60 mV. mEPSCs were pharmacologically isolated by 1 µM TTX (Fishery Science and Technology Development), which was present throughout the experiment. For evoked EPSCs, a stainless steel bipolar microelectrode, placed 100–300 µm rostral to the mSNc, was stimulated (0.05–0.1 ms) at 0.1 Hz to elicit synaptic currents. Paired-pulse ratios (PPRs) were obtained using pairs of afferent stimulations of equal intensity at a 50 ms interpulse interval, with the ratio calculated from the peak amplitude values (eEPSC2/eEPSC1). The AMPAR/NMDAR ratio (A/N ratio) was determined using pharmacological isolation methods by evoking a dual-component EPSC at +40 mV. AMPAR-mediated currents were isolated with dʟ-APV (50 µM, Sigma-Aldrich), a selective NMDAR antagonist. NMDAR responses were obtained by digitally subtracting the difference current in the presence of dʟ-APV from the response in its absence. The AMPAR/NMDAR current ratio was calculated by dividing the AMPAR-EPSC amplitude by the NMDAR-EPSC amplitude at +40 mV. The rectification index of AMPAR-mediated currents (RI-AMPAR) was calculated as the ratio of the chord conductance at negative potential (−60 mV) to that at positive potential (+40 mV), as previously reported (Bariselli et al., 2016; Musardo et al., 2022).

For current-clamp recordings of intrinsic excitability or spontaneous action potential (sAPs) firing (Song et al., 2024), electrodes were filled with an internal solution containing the following (in mM), as described previously (Friedman et al., 2014): 115 potassium gluconate, 20 KCl, 1.5 MgCl₂, 10 phosphocreatine, 10 HEPES, 2 MgATP, and 0.5 GTP (pH 7.2, 285 mOsm). Under the current-clamp mode to recording intrinsic excitability, SNc→DMS DA neurons were injected with 2 s incremental steps of current injections (ranging from 0 to 200 pA, in 25 pA increments, with a 15 s intertrial interval) in the presence of 20 µM CNQX and 50 µM dʟ-APV. The I_h current was measured with a series of 2 s pulses with −10 mV command voltage steps from −60 to −130 mV, and steady-state leakage current was removed through offline leak subtraction. For sAP firing recording, cells were maintained at their resting membrane potential (Vrest) without current injection.

Series and input resistances were monitored for stability throughout each experiment, and data were discarded if the resistance changed by >20%. Whole-cell recordings were conducted using a MultiClamp 700B amplifier (1 kHz low-pass Bessel filter and 10 kHz digitization) and a Digidata 1550 (Molecular Devices). For data collection and analysis, we use pClamp 10.5 software (Molecular Devices).

Single-cell PCR

After recording, the cytoplasmic contents of the recorded cells were harvested into the patch pipette for identifying of SNc→DMS DA neurons using single-cell PCR, performed with minor modifications as previously reported (Diao et al., 2021). Briefly, the contents were transferred into a PCR tube containing 3 µl of RNase-free water and 0.5 µl of 40 U/µl RNasin Ribonuclease Inhibitor (10,000 U, N2112S, Promega), dNTP mix (No.4030), oligo-dT (No.3806), random primer (No.3802), Maxima H Minus Reverse Transcriptase (EP0753), and PCR mix (RR901A), all purchased from Takara Biomedical Technology. As a negative control, a patch pipette filled with RNase-free intracellular solution and aspirated with ACSF while positioned near the tissue in the recording chamber was used.

Single-strand cDNA synthesis was performed in PCR tubes containing 2 µl of mixed dNTPs (2.5 mM each), 0.5 µl of oligo(dT) primer (50 µM), and 0.5 µl of random primer (100 µM). The mixture was heated to 65°C for 5 min and then cooled on ice for 1 min. Next, 2.5 µl of 5× RT buffer and 0.75 µl of Maxima Reverse Transcriptase (200 U/µl) with the following thermal profile: 25°C for 10 min; 50°C for 30 min; 85°C for 5 min; holding at 4°C.

A multiplex single-cell nested PCR was performed to detect tyrosine hydroxylase (TH), with primers and amplicons details provided in Table 1. The first-round PCR commenced after the addition of 2× PCR Master Mix, DNase- and RNase-free water, and primers 1 (4 µM each) to the RT product (final volume 20 µl). A total of 25 cycles were performed (denaturation at 94°C for 3 min; annealing at 59°C for 1 min; extension at 72°C for 1 min; and a final elongation at 72°C for 10 min).

Table 1.

Oligonucleotide primers used for single-cell PCR

Gene	GenBank accession no.	Primer name	Primer sequency	Product length (bp)	Annealing temperature (°C)
Tyrosine hydroxylase (TH)	NM_009377.2	TH-F1 TH-R1	GGCCTCTATGCTACCCATGC ATGCAAGTCCAATGTCCTGGG	343	60. 32 60. 62
		TH-F2 TH-R2	GGAACGGTACTGTGGCTACC GTGTGCACTGAAACACACGG	161	60. 11 60. 25

F, Forward; R, Reverse; 1, the primers for the first-round PCR; 2, the primers for the second-round PCR.

For the second-round PCR, 2 µl of the first-round PCR product was used as a template, and the reaction was run for 35 cycles with annealing at 58°C for 30 s and extension at 72°C for 30 s. The reaction mix for the second round was identical to that of the first round, except primers 1 was replaced with primer 2. The second-round PCR products were analyzed by 2% agarose gel electrophoresis.

Immunostaining

Mice were anesthetized with isoflurane and subsequently killed. They were perfused with 0.9% saline, followed by 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). The brains were postfixed in 1× PFA solution at 4°C overnight and then cryoprotected by immersion in 30% sucrose until they sank. Coronal brain sections (30 µm thick) encompassing SNc or DMS were obtained using a cryostat (CM1950, Leica). Sections were washed with PBS and then permeabilized with 0.3% Triton X-100 in PBS for 30 min at room temperature. Following a 1 h blocking period with normal goat serum (Boster Biological Technology), slices were incubated with a rabbit polyclonal antibody against tyrosine hydroxylase (TH; 1:500 dilution, ab112, Abcam) overnight at 4°C. After washing with PBS, the sections were incubated with CoraLite 594-conjuated Goat anti Rabbit IgG(H + L; 1:200 dilution, SA00013-4, Proteintech) or Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rat IgG (H + L; 1:200 dilution, 112-545-003, Jackson) for 2 h at room temperature. The slices were mounted on slides using DAPI/Antifade solution (S2100, Solarbio). Fluorescence images were captured using an Axio Imager M2 Microscope (Zeiss).

Behavioral assessments

Open field test (OFT)

The test mouse was gently placed in the center of a standard open field arena (50 × 50 × 50 cm³) and allowed to explore unimpeded for 10 min. Its moving trajectory was automatically tracked, and the total distance traveled was calculated using SMART v.3.0 software (Panlab Harvard Apparatus).

Three-chamber sociability test

Sociability was evaluated using a three-chamber test conducted in a box with three communicating compartments (60 × 40 × 40 cm³), allowing the subject mouse access to each chamber. On the day before the experiment, mice were individually habituated to the three-chamber apparatus for 5 min.

At the start of the sociability test, the subject mouse was placed in the center of the middle chamber for 5 min to freely explore all three chambers. Subsequently, a circular wire cage containing a novel juvenile male mouse was placed in one side chamber (Stranger chamber), while an empty wire cage was placed in the other side chamber (Empty chamber). The time spent and movement trajectory of the subject mouse in each chamber were recorded over a 10 min period using SMART v.3.0 software. Social index was calculated as the ratio of the time spent in stranger chamber to the time spent in the empty chamber.

Reciprocal social interaction test in the home cage

The subject mice were individually placed in the home cage for a 10 min habituation period. Following this, an unfamiliar juvenile male mouse (3–4 weeks old) was introduced into the same, allowing mice to explore freely for 10 min. During this period, the subject mouse's social behaviors, including direct contact such as facial and anogenital sniffing or following, were recorded. All behaviors were video-recorded and analyzed using SMART v.3.0 software.

Self-grooming behavior test

Mice were individually placed in a home cage (30 × 20 × 15 cm³) without bedding to prevent digging behavior and allowed to habituate for 10 min. During the 10 min testing period, the cumulative time spent engaging in repetitive grooming behaviors, including wiping the face, rubbing body, head, or ears with the forelimbs, was recorded.

Marble burying test

The marble burying test was performed to assess repetitive stereotyped behaviors. A clean home cage was filled with sawdust to a depth of 5 cm. Subsequently,12 glass marbles were evenly spaced on the sawdust in a 3 × 4 grid. Each mouse was kept in the cage for 20 min, and the number of marbles buried (to two-thirds their depth) in the bedding was assessed after each testing session.

Chemogenetic manipulation in vivo

For chemogenetic regulation of SNc DA neurons, AAV-DIO-hM4D(Gi)-mCherry (200 nl per side; BrainVTA) was injected bilaterally into SNc of VPA DAT-Cre mice (AP: −3.0 mm; ML: ± 1.1 mm; DV: −4.25 mm). The AAV-hSyn-DIO-mCherry virus serving as the control. Mice were allowed 2–3 weeks for recover before the initiation of clozapine N-oxide (CNO). For behavioral and electrophysiological experiments, CNO (1 mg/kg in saline vehicle, i.p.) was administered daily for 7 consecutive days to virus-infected mice.

For chronic regulation of SNc→DMS DA projections, AAV-hSyn-DIO-hM4D(Gi)-mCherry virus, AAV-hSyn-DIO-hM3D(Gq)-mCherry, or AAV-hSyn-DIO-mCherry virus was injected bilaterally into SNc (AP: −3.0 mm; ML: ±1.1 mm; DV: −4.25 mm) of VPA or Control DAT-Cre mice. Bilateral stereotaxic implantation of 26 gauge (Ga) stainless steel guide cannulas (C.C 3.0 mm, RWD Life Science), fitted with removable obturators to prevent obstruction, was implanted into DMS (AP: +0.7 mm; ML: ±1.5 mm; DV: −2.8 mm). Cannula was secured with dental cement. After a 2–3 weeks virus expression period, sterile 26 gauge (Ga) microinjection needles were connected to two 10 µl Hamilton syringes via PE-50 tubing. Mice received local bilateral infusion of CNO (5 µM, 120 nl) at a rate of 100 nl/min through the implanted cannula into DMS, under the control of a micro-infusion pump (R462, RWD Life Science) for 7 consecutive days. The microinjection needles remained in place for an additional 5 min to prevent backflow. Behavioral tests were performed 24 h after the final infusion of CNO, and cannula placements were confirmed postmortem in all mice.

Optogenetic manipulations in vivo

For optogenetic rescued experiment, Cre-dependent adenovirus-associated eNpHR3.0 (AAV-DIO-eNpHR3.0-EYFP) or Control vector (AAV-Ef1α-DIO-EYFP) was injected bilaterally into SNc (AP: −3.0 mm; ML: ±1.1 mm; DV: −4.25 mm) of VPA DAT-Cre mice. Following a 20 min waiting period postinjection to allow for viral uptake, optical fibers [200 µm core diameter, 0.37 numerical aperture (NA), ThinkerTech] were implanted bilaterally at 10° angle above the injected site and secured with dental cement. Mice were allowed at least 2–3 weeks for recover and viral expression. For optogenetic activation of eNpHR3.0, the optical fiber was connected to a 589 nm yellow laser diode (Newdoon). Prior to stimulation, mice were allowed 3 min of recovery time after being connected to the patch cable. The optogenetic stimulation protocol involved bilateral cycles of 8 s light on and 2 s light off, with an output power of 5 mW, administered for 20 min daily over 5 consecutive days to inhibit the activity of SNc DA neurons in VPA DAT-Cre mice. Behavioral tests were performed 24 h after the final light stimulation. Postmortem analysis was conducted to confirm correct fiber placement in all mice.

Intra-DMS cannulations and microinjections

The surgical procedure followed the previously outlined “Stereotaxic surgery” methods. Bilateral 26 gauge (Ga) stainless steel guide cannula (RWD Life Science) were implanted into DMS (AP: +0.7 mm; ML: ±1.5 mm; DV: −2.8 mm). Prior to microinfusions, mice underwent two habituation sessions, which involved performing mock perfusions with a microinjector. The tip of the microinjector was cut to be flush with the length of the guide cannula. Following microinjections, the injection needles were left in place for an additional 5 min to prevent backflow. Mice were then returned to their home cages. For the pharmacological intervention, either the Drd1 receptor (D1R) antagonist SCH23390 (0.25 µg/µl, HY-19545A, MedChemExpress) or the Drd2 receptor (D2R) antagonist sulpiride (2 µg/µl, HY-B1019, MedChemExpress) was bilaterally infused into DMS at a total volume of 200 nl (100 nl per side). The infusion rate was 100 nl/min, and the infusions were administered for 7 consecutive days. Behavioral experiments were conducted 24 h after the final drug infusion. The testing procedures followed the methods described above. The accuracy of injection placements was verified posttest in all mice.

Experimental design and statistical analyses

Data collection and analyses were performed by investigators who were blinded to the experimental conditions. All data are presented as mean ± SEM, with statistical significance defined as p < 0.05. The significance level was assessed at a 95% confidence level. Normality of data distribution was tested using the Shapiro–Wilk test, while homogeneity of variance was assessed with Levene's test, respectively. Statistical analyses were conducted using two-tailed paired or unpaired Student's t test, two-way repeated-measures analysis of variance (ANOVA), followed by post hoc tests as appropriate. In cases where normality or homogeneity assumptions were violated, nonparametric statistical methods were employed. For data visualization and further statistical analyses, GraphPad Prism 8.0 and SPSS version 22.0 were used. Detailed descriptions of the statistical methods and results are provided in Extended Data Figure 1-1.

Results

Prenatal VPA exposure strengthens basal activity in SNc→DMS DA neurons

Prenatal VPA exposure induced autism-like behaviors including social deficits (Extended Data Fig. 1-2A,B) and repetitive behaviors (Extended Data Fig. 1-2C,D) in male offspring as previously reported (Di et al., 2022). Given that VPA exposure induced coexisting and opposite striatal D1-MSNs and D2-MSNs functional alterations in DMS (Chaliha et al., 2020; Di et al., 2022), and DMS mainly receives SNc DA projections which dichotomously modulates the strength of glutamatergic synaptic transmission and excitability of direct and indirect pathway MSNs (Kreitzer and Malenka, 2005; Surmeier et al., 2007, 2014; Gerfen and Surmeier, 2011), we hypothesize that VPA exposure might also affect the activity in SNc→DMS DA neurons. We firstly evaluated the effects of VPA exposure on basal activity in SNc→DMS neurons by in vitro recording. To label SNc→DMS projection neurons, fluorescent retrobeads were injected into DMS; these labeled cells were mainly located in medial part of SNc (mSNc) and colocalized with TH⁺ staining neurons (Fig. 1A). The labeled DA neurons were further confirmed by their morphology, high capacitance, low input resistance, and presentence of hyperpolarization-activated cation channel-mediated current during recording (Extended Data Fig. 1-3A) and by TH gene expression using single-cell PCR after recordings (Extended Data Fig. 1-3B). To evaluate the effects of VPA exposure on excitatory synaptic transmission to SNc→DMS neurons, we performed whole-cell voltage-clamp recordings of mEPSCs on retrobeads labeled cells in C57BL/6J mice in the presence of TTX and PTX (Fig. 1B–D). We observed the mean frequency of mEPSCs was significantly increased with the cumulative interevent interval distribution curve exhibiting a significant left shift (Fig. 1C), suggesting that the probability of presynaptic glutamate release was increased in SNc→DMS neurons of VPA mice. The amplitude of mEPSCs was also increased with a right shift in the cumulative probability distribution curve (Fig. 1D), which indicates that prenatal VPA exposure also enhanced the postsynaptic currents on SNc→DMS DA neurons. These results suggest that prenatal VPA exposure potentate glutamatergic synaptic transmission in SNc→DMS DA neurons. It is not surprising since midbrain DA neurons receive excitatory inputs from widespread brain regions and SNc receives their most prominent excitatory inputs from the somatosensory/motor cortex, subthalamic nucleus (STN), and pedunculopontine tegmental nucleus (PPTg; Geisler and Wise, 2008; Watabe-Uchida et al., 2012). VPA exposure at the early developmental stage disrupts global gene expression and contributes to widespread excitatory/inhibitory (E/I) imbalance in the brain (Gogolla et al., 2009; Mabunga et al., 2015). These effects could enhance baseline activity of SNc→DMS DA projection.

Figure 1.

Prenatal VPA exposure strengthens excitatory synaptic transmission and excitability of SNc→DMS dopaminergic neurons. A, Schematic injections of retrobeads and colocalization of retrobeads (red) in SNc→DMS neurons (TH⁺, green); scale bar, 50 µm. B–D, Representative traces of mEPSCs (B). Summary data for mEPSC frequency with cumulative probability plots of interevent intervals (C) and amplitude with cumulative probability plots (D) in SNc→DMS neurons. Control, n = 14 cells from 5 mice; VPA, n = 20 cells from 7 mice. E, F, Representative traces (E) and summary data showing a reduction of PPR in SNc→DMS DA neurons of VPA mice (F). Control, n = 13 cells from 4 mice; VPA, n = 17 cells from 6 mice. G, H, Representative traces (G) and statistics data showing an increased AMPAR/NMDAR ratio in SNc→DMS neurons of VPA mice (H). Control, n = 11 cells from 4 mice; VPA, n = 14 cells from 6 mice. I, J, Representative traces (I) and summary data showing a higher rectification index of AMPAR-EPSCs in SNc→DMS neurons of VPA mice (J). Control, n = 13 cells from 5 mice; VPA, n = 12 cells from 4 mice. K–M, Summary data showing increased intrinsic excitability of SNc→DMS neurons in VPA mice, illustrated by a decreased rheobase (K), an increase R_in (L), and an increase of spike number (M). Control, n = 16 cells from 5 mice; VPA, n = 15 cells from 6 mice. N, O, Representative traces (N) and statistics data showing an increased firing of sAPs in SNc→DMS neurons of VPA mice (O). Control, n = 14 cells from 3 mice; VPA, n = 13 cells from 4 mice. P, Q, Representative trace of mSNc DA neurons firing activity in vivo using single-unit recording. R–T, Summary data showing increased spontaneous firing rates (R), higher bursting frequency (S), and a greater percentage of spikes within bursts (T) in mSNc DA neurons of VPA mice compared with Control mice. Control, n = 12 cells from 5 mice; VPA, n = 11 cells from 4 mice. U, V, Representative I_h currents traces (U) and summary data showing an elevated I–V curve of I_h currents in SNc→DMS neurons of VPA mice (V). Control, n = 10 cells from 4 mice; VPA, n = 10 cells from 5 mice. W, X, Representative I_h currents traces (W) and summary data showing rectified I–V curve of I_h currents (X) in SNc→DMS neurons of VPA mice with ZD7288(10 µM) incubation in slice. n = 7 cells from 5 mice. Y, Z, Representative spike traces (Y) and summary data showing the decreased spike number (Z) in SNc→DMS neurons of VPA mice with ZD7288(10 µM) incubation in slice. n = 7 cells from 5 mice. Two-tailed unpaired t test for C, D, F, H, L; Mann–Whitney U test for J, K, O, R, S, T; Friedman's M test for M, V, X, Z. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1. The behavioral data of VPA male offspring were presented in Extended Data Figure 1-2. Intrinsic properties and single-cell PCR identification of SNc→DMS DA neurons in whole-cell recordings were presented in Extended Data Figure 1-3.

Figure 1-1

Statistical detail information for figures and extended figures. Download Figure 1-1, XLSX file ^{(33.6KB, xlsx)} .

Figure 1-2

VPA male mice exhibit social interaction deficits and repetitive behavior. (A-E) Behavioral paradigm and statistic data for three-chamber test (A), home-cage social interaction test (B), marble burying test (C), self-grooming test (D), and open-field test (E) from Control and VPA mice. VPA mice displayed no significant changes in locomotor (E), but appeared lower social index (A), less social time with the stranger (B), more grooming time (D) and increased the numbers of marbles buried (C). Control, n = 8 mice; VPA, n = 9 mice, two-tailed unpaired t test for A, B, C, D; Mann–Whitney U test for E; Two-way ANOVA for A time duration. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± S.E.M. Statistical details and results are presented in Figure 1-1. Download Figure 1-2, TIF file ^{(3.8MB, tif)} .

Figure 1-3

Intrinsic properties and single-cell PCR identification of SNc-DMS DA neurons in whole-cell recordings. (A) Voltage protocol for recording I_h-currents, and representative I_h-currents sample traces in a SNc-DMS DA neuron. (B) Representative image of the agarose gel electrophoresis of single-cell PCR with nested primers applied to SNc DA neuron. NC: Negative control. (C, D) The RMP (C) and AP threshold (D) in SNc-DMS DA neurons from Control and VPA mice. Control, n = 16 cells from 5 mice; VPA, n = 15 cells from 6 mice. Two-tailed unpaired t test for C and D. Data represented as mean ± S.E.M. Statistical details and results are presented in Figure 1-1. Download Figure 1-3, TIF file ^{(364.8KB, tif)} .

To further confirm the presynaptic and postsynaptic alterations that we observed in SNc→DMS DA neurons, firstly, we performed PPR at a 50 ms interpulse interval to assess the presynaptic release probability. A reduction in PPR was observed in SNc→DMS neurons of VPA mice (Fig. 1E,F), suggesting that there was presynaptic enhanced alteration of glutamatergic terminals innervating these SNc→DMS neurons. Then, to determine whether prenatal VPA exposure affects glutamatergic transmission at the postsynaptic receptor level, we recorded the A/N ratio in SNc→DMS DA neurons; the A/N ratio was significantly larger in VPA mice (Fig. 1G,H), implying an increase in AMPAR-mediated postsynaptic currents onto SNc→DMS neurons after prenatal VPA exposure. An aberrant increase in the A/N ratio usually reflects functional changes and subunit composition in the AMPAR subunit arrangement (Bariselli et al., 2016, 2018). To address this point, AMPAR-mediated EPSCs were pharmacologically isolated, and the rectification index (RI) was calculated as the ratio of the chord conductance at negative potential (−60 mV) to that at positive potential (+40 mV). An increase in RI was observed in SNc→DMS neurons of VPA mice (Fig. 1I,J), indicating the aberrant presence of GluA2-lacking AMPARs at excitatory inputs onto SNc DA neurons. Collectively, these data indicate that prenatal VPA exposure strengthens excitatory inputs onto SNc→DMS DA neurons.

In addition to synaptic transmission, the excitability properties of SNc→DMS neurons were also evaluated in current-clamp mode (Song et al., 2024). The intrinsic excitability of SNc→DMS neurons was significantly increased in VPA mice, illustrated by a decreased rheobase current (Fig. 1K), an increase in membrane input resistance (Fig. 1L), and a significantly increase of spike number in response to a series of current injections (Fig. 1M). But there were no significant differences observed in the RMP and AP threshold of VPA mice (Extended Data Fig. 1-3C,D). Consistent with intrinsic excitability, the frequency of spontaneous firing was also increased in SNc→DMS DA neurons of VPA mice (Fig. 1N,O).

The above in vitro electrophysiological data demonstrate that prenatal VPA exposure increases synaptic transmission and excitability on SNc→DMS DA neurons. To verify this potentiated state of baseline in vivo, we further performed extracellular single-unit recordings onto mSNc DA neurons in anesthetized mice, since DMS mainly receive DA projections from mSNc (Farassat et al., 2019). DA neurons were identified by the typical triphasic action potential with a duration of at least 1.1 ms (Fig. 1P) according to well-established methods (Grace and Bunney, 1983; Ungless and Grace, 2012). We found that mSNc DA neurons in VPA mice displayed an increase of spontaneous firing rates (Fig. 1Q,R), higher frequency of bursting (Fig. 1S), and percentage of spikes within bursts (Fig. 1T) than those in Control mice. While increased bursting activity has previously been attributed to enhanced NMDA receptor function, our current findings suggest an additional mechanism that the elevated insertion of Ca²⁺-permeable AMPA receptors in SNc DA neurons of VPA-exposed mice. Altogether, the electrophysiological data indicate that prenatal VPA exposure results in a potentiated state of baseline activity in SNc DA neurons.

Given the importance of HCN channels regulate neuronal excitability (Yi et al., 2016), we further detected whether VPA exposure affects I_h currents mediated by HCN channels. We found that I_h currents were significantly increased in SNc→DMS neurons of VPA mice (Fig. 1U,V). Typically, a high I_h decreases input resistance which would reduce neuronal excitability if all other properties were comparable (Yi et al., 2016). However, our study revealed seemingly contradictory findings including an increase in input resistance (Fig. 1L) alongside elevated HCN channel activity (Fig. 1U,V). The more likely explanation for this discrepancy is that the greater I_h represents compensatory mechanism (Okamoto et al., 2006; Friedman et al., 2014), rather than a direct driver of excitability, to counteract intrinsic neuronal property changes from an independent source of increased input resistance in VPA mice. To illustrate if I_h currents were major determinants of VPA-induced neural excitability in SNc→DMS neurons, HCN channel blocker ZD7288(10 µM) was bath applied in brain slices of VPA mice, an increase of I_h current was suppressed (Fig. 1W,X), and the significantly more action potentials were abolished in SNc→DMS neurons of VPA mice (Fig. 1Y,Z). These results suggest that VPA exposure induces abnormal neural excitability on SNc→DMS neurons, and this phenotype is associated with I_h currents mediated by HCN channels.

Prenatal VPA exposure attenuates the responsiveness of SNc→DMS projection during social interaction and repetitive behaviors

SNc DA neurons project toward the dorsal striatum, forming the nigrostriatal circuit that plays important roles both in motivation and motor control (Iversen and Iversen, 2007; Costa and Schoenbaum, 2022). Dysregulation of dopaminergic projection pathways contribute to the behavioral manifestations of ASD (Paval, 2017; Paval and Miclutia, 2021; DiCarlo and Wallace, 2022). After having identified the enhanced basal activity in SNc→DMS DA neurons reported in Figure 1, we next intended to investigate whether the functional alterations in these DA neurons were associated with the core behavioral phenotypes including social deficits and repetitive behaviors in VPA mice. To address this issue, we firstly evaluated the population Ca²⁺ transient onto SNc DA cell bodies or SNc→DMS DA terminals in freely moving mice during these behavioral periods. Cre-dependent AAV GCaMP6m or EYFP was stereotactically injected into SNc of DAT-Cre mice, and an optical fiber was either implanted above the injection to measure Ca²⁺ transient of the soma (Fig. 2A) or implanted into DMS to detect projection-specific activity of the DA terminal (Fig. 2N), respectively. After waiting 2–3 weeks for virus expression, we conducted fiber photometry to record population Ca²⁺ signal fluctuations. To further confirm the enhanced basal activity in VPA animal as Figure 1, we performed baseline SNc DA neurons recordings of DAT mice within the animal's home cage (Fig. 2C–E). Consistent with the electrophysiological recordings in Figure 1, baseline Ca²⁺ activity of SNc DA neurons were increased in VPA mice, as illustrated by an increased Ca²⁺ transient frequency (Fig. 2D,E). After baseline activity recording, we then detected behavior-evoked Ca²⁺ signal during social interaction and marble burying tasks (Fig. 2B,O). To our surprise, a marked decrease of transient Ca²⁺ signaling were observed in SNc DA cell bodies of VPA mice during social interaction (Fig. 2F–H) and repetitive behaviors such as digging in the marble burying task (Fig. 2J–L). We then detected Ca²⁺ signaling in a projection-specific manner in DMS. Similar as in cell bodies, a decrease of the Ca²⁺ signaling were observed in the terminal of SNc→DMS projections of VPA mice (Fig. 2P–R,T–V). There were no significant Ca²⁺ signal changes in EYFP expressed animal (Fig. 2G,K,Q,U). These results suggest the behavior-evoked responsiveness are impaired in both cell bodies and terminals of SNc→DMS neurons. This impaired Ca²⁺ responsiveness may be attributed to reduced voltage-gated calcium channel (VGCC) expression in SNc→DMS DA neurons of VPA mice. This mechanism will be investigated in future study (Voineagu et al., 2011; De Rubeis et al., 2014).

Figure 2.

Prenatal VPA exposure attenuates the Ca²⁺ responsiveness of SNc→DMS projection during social interaction and repetitive behaviors. A, Schematic of viral injection and optic-fiber placement into SNc. Representative immunofluorescence images showing the coexpression of GCaMP6m and TH (red) in the SNc (scale bar, 200 µm). C, Schematic of SNc DA neurons baseline Ca²⁺ activity detection in home cage. D, Representative baseline Ca²⁺ traces and peak analysis from a Control and VPA mouse. E, Baseline SNc DA neurons activity was higher in VPA mice, illustrated by an increased Ca²⁺ transient frequency. N, Schematic of viral injection into SNc and optic-fiber placement in DMS. Representative immunofluorescence images showing coexpression of GCaMP6m and TH (red) in SNc DA cell bodies (right; scale bar, 200 µm) and terminals (left; scale bar, 50 µm). B, O, Schematic of viral injection and following behavioral test. F–H, P–R, Heatmaps and perievent plots of averaged calcium or EYFP responses (ΔF/F, %) of SNc DA cell bodies (F, G) or terminals (P, Q) during social interaction. The Ca²⁺ responses during social interaction were weaker in SNc DA cell bodies (H) or terminals (R) of VPA mice. J–L, T–V, Heatmaps and perievent plots of averaged calcium or EYFP responses (ΔF/F, %) of SNc DA cell bodies (J, K) or terminals (T, U) during marble burying. The Ca²⁺ responses on marble burying were weaker in SNc DA cell bodies (L) or terminals (V) of VPA mice. Gray lines and shaded areas indicated EYFP fluorescence signal in SNc DA neurons or SNc→DMS terminals during behavioral test. I, M, S, W, Summary data of social interaction (I, S) and the numbers of marbles (M, W) in VPA and Control mice. For F–M and P–S: Control, n = 10 mice; VPA, n = 11 mice; for E and T–W: Control, n = 9 mice; VPA, n = 11 mice. Two-tailed unpaired t test for E, I, L, M, R, S, V, and W. Mann–Whitney test for H. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

We then recorded behavior-triggered DA release of these SNc→DMS projection neurons. The G-protein-coupled receptor activation-based dopamine sensor (GRAB_DA sensor, DA3m) or EYFP was injected into DMS of C57BL/6J mice, and an optical fiber was implanted above the injected site to detect DA release (Fig. 3A,B). Consistent with the Ca²⁺ transient activity in the terminal of SNc→DMS neurons, behavior-triggered DA release in DMS was decreased in VPA mice during encounters with the stranger (Fig. 3C–F) or spontaneous repetitive activities (Fig. 3G–J). This is not surprising since the bulk calcium signaling in the terminal of SNc→DMS neurons roughly reflect neural activity and DA release during behavior-triggered stimulation (Howe and Dombeck, 2016; Willmore et al., 2022; Montgomery et al., 2024). Together, these fiber photometry data suggest that VPA exposure results in decrease of responsiveness of SNc→DMS neurons involved in two autism-like behaviors.

Figure 3.

Prenatal VPA exposure impairs transient DA release in DMS during social interaction and repetitive behaviors. A, Viral expression of DA3m and placement of the optic-fiber probe in DMS. B, Schematic of viral injection and following behavioral test. C–E, G–I, Heatmaps and perievent plots of averaged DA or EYFP responses (Δ F/F, %) in DMS during social interaction (C, D) and marble burying test (G, H). The DA responses on social interaction (E) and marble burying test (I) were weaker of VPA mice. Gray lines and shaded areas indicated EYFP fluorescence signal in DMS during behavioral test. Solid line and shaded regions are the mean ± SEM. F, J, Summary data of social time (F) and the numbers of marbles (J) from Control and VPA mice. Control, n = 9 mice; VPA, n = 8 mice. Two-tailed unpaired t test for E, I, and J. Mann–Whitney test for F. *p < 0.05, **p < 0.01. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

Based on the above findings, we observed elevated basal activity (Fig. 1) and impaired responsiveness of SNc→DMS DA neurons associated with core autism-like behaviors in VPA mice (Figs. 2, 3). These seemingly opposite physiological changes observed here may result from the broad changes in gene expression due to VPA exposure (Zhang et al., 2018). Given that baseline DA activity directly dictate the phasic response to a stimulus (Montgomery et al., 2024), we make another proposal that the elevated basal activity might blunt the responsiveness during behavioral periods in DA neurons via a “ceiling effect,” thereby contributing to social deficits and repetitive behaviors in VPA offspring. To preliminarily test this hypothesis, Cre-dependent hM3Dq-mCherry were injected into SNc of DAT-Cre mice. We recorded sAP changes of SNc DA neurons with CNO stimulation (Fig. 4A). As predicted, we found that incubation with CNO (3 µM) significantly enhanced the frequencies of sAPs (Fig. 4B,C) in Control mice, but there were no significantly changes of those in SNc DA neurons in VPA mice (Fig. 4D,E).

Figure 4.

Prenatal VPA exposure blunts further induction of spontaneous action potentials in SNc DA neurons. A, Schematic of viral injection into SNc and following slice recording. The IR-DIC image of SNc DA neurons and the glass peptide in slice recording. B, D, Sample traces of sAPs firing activity in whole-cell recording. C, E, Summary data showing that CNO (3 µM) application increased the firing rate in SNc DA neurons of Control mice (C) but had no significant effect in VPA mice (E). Control, n = 14 cells from 5 mice; VPA, n = 9 cells from 4 mice. Wilcoxon matched-pairs signed rank test for C; two-tailed paired t test for E. **p < 0.01. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

Specific inhibition of SNc→DMS projection alleviates social deficits and repetitive behaviors in VPA mice

Given baseline dopaminergic activity may correlate with behavior phenotypes such as alcohol drinking (Montgomery et al., 2024), we therefore asked whether there was a causal relationship between the enhanced baseline activity of SNc→DMS neurons and autism-like behaviors. To address this point, we firstly tested whether correction of the enhanced basal activity in SNc DA neurons could ameliorate autism-like behaviors in VPA mice. Cre-dependent hM4Di-mCherry or mCherry were bilaterally injected into SNc of VPA DAT-Cre mice, followed by 7 d of repeated CNO administration (1 mg/kg in saline, i.p.) to chronically depress the basal hyperactivity of SNc DA neurons (Fig. 5A,B). As expected, intrinsic excitability (Fig. 5C,D) and I_h currents (Fig. 5E,F) were significant suppressed onto SNc DA neurons in hM4Di expression VPA mice. Importantly, chemogenetic inhibition of SNc DA neurons in VPA mice improved social interaction with spending significantly more time with the stranger mouse (Fig. 5G–I), performing more social interaction with the novel partner than mCherry expression VPA mice (Fig. 5J). Repetitive behaviors were also alleviated with decreasing of number of buried marbles and self-grooming time (Fig. 5K,L). To confirm the chronic chemogenetic results in behaviors correction, we used an optogenetic manipulation with more space accuracy to investigate the causal relationship between the basal activity of SNc DA neurons and autism-like behaviors in VPA mice, and similar results were observed at 24 h after chronical photoinhibition of SNc DA neurons in VPA DAT-Cre mice (Fig. 6). These results further indicate that enhanced basal activity of SNc DA neurons plays a causal role in autism-like behaviors.

Figure 5.

Specific and chronic inhibition of SNc→DMS projection alleviates social deficits and repetitive behaviors in VPA mice. A, Schematic of viral injection into the SNc. Representative immunofluorescence image showing coexpression of mCherry (red) in SNc DA neurons (TH⁺, green)l scale bar, 200 µm. B, Schematic of viral injection and following behavioral test. CNO dose for intraperitoneal injection (1 mg/kg in saline vehicle). C, D, Representative current–response curves (C) and analysis showing decreased intrinsic excitability in SNc DA neurons of hM4Di-expressing VPA mice following repeated CNO administration (D). mCherry, n = 14 cells from 9 mice; hM4Di, n = 12 cells from 10 mice. E, F, Sample I_h-currents traces (E) and analysis showing rectified I_h currents in SNc DA neurons of hM4Di-expressing VPA mice following repeated CNO administration (F). mCherry, n = 11 cells from 9 mice; hM4Di, n = 14 cells from 10 mice. M, Schematic of viral injection into SNc and cannula placement in DMS. Representative immunofluorescence image showing coexpression of mCherry (red) in SNc DA neurons (TH⁺, green; scale bar, 200 µm) or terminals (scale bar, 50 µm). N, Schematic of viral injection and following behavioral test. CNO dose for infusion (5 µM, 120 nl in saline vehicle). G–I, O–Q, Representative traces (G, O), summary data of time spent in the social compartment (H, P), and social index (I, Q) during three-chamber test. Following repeated CNO administration, hM4Di-expressing VPA mice spent more time in the stranger compartment (H, P) and showed higher social index (I, Q). J, R, Summary data showing increased social time in home cage social interaction test of hM4Di-expressing VPA mice following repeated CNO administration. K, S, L, T, Summary data showing the decreased numbers of marbles buried (K, S) and self-grooming time (L, T) of hM4Di-expressing VPA mice following repeated CNO administration. In G–L, mCherry, n = 9 mice; hM4Di, n = 10 mice. In O–T, mCherry, n = 10 mice; hM4Di, n = 9 mice. Two-way ANOVA for H and P; two-tailed unpaired t test for I, K, Q, R, and S; Mann–Whitney test for J, L, and T; Friedman's M test for D and F. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1. Repeated DREADD activation of SNc→DMS DA projection induces the autism-like behaviors in saline Control DAT-Cre mice are presented in Extended Data Figure 5-1.

Figure 6.

Repeated photoinhibition of SNc DA neurons relieves social deficits and repetitive behavior in VPA mice. A, Schematic of viral injection into SNc and placement of optic-fiber. Representative immunofluorescence image showing the coexpression of EYFP in SNc DA neurons (TH⁺, red). B, Schematic of viral injection and following behavioral test. A 589 nm yellow light (8 s light on and 2 s light off) were delivered 20 min a day for 5 consecutive days. C–E, Representative traces, summary data of time spent in the social compartment (D), and social index (E) during three-chamber test. Following 5 d repeated photoinhibition, eNpHR-expressing VPA mice spent more time in the stranger compartment (D) and showed higher social index (E). F, Summary data showing increased social time in home cage social interaction test of eNpHR-expressing VPA mice following repeated photoinhibition. G, H, Summary data showing the decreased numbers of marbles buried (G) and self-grooming time (H) in eNpHR-expressing VPA mice following repeated photoinhibition. EYFP, n = 10 mice; eNpHR, n = 13 mice. Two-tailed unpaired t test for E, G, and H; two-way ANOVA for D; Mann—Whitney U test for F. *p < 0.05, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

Figure 5-1

Repeated DREADD activation of SNc-DMS DA projection induces the autism-like behaviors in saline Control DAT-Cre mice. (A) Schematic of viral injection into SNc and cannula placement in DMS. Representative immunofluorescence image showing co-expression of mCherry (red) in SNc-DMS DA terminals (TH⁺, green), Scale bar = 50 μm. (B) Experimental timeline. CNO dose for infusion (5 μM, 120 nL in saline vehicle). (C-E) Representative traces (C), summary data of time spent in the social compartment (D) and social index (E) during three-chamber test. Following repeated CNO administration, hM3Dq-expressing Control mice spent less time in the stranger compartment (D), and showed lower social index (E). (F) Summary data showing decreased social time in home-cage social interaction test of hM3Dq-expressing Control mice following repeated CNO administration. (G, H) Summary data showing the decreased numbers of marbles buried (G) and self-grooming time (H) of hM3Dq-expressing Control mice following repeated CNO administration. mCherry, n = 12 mice; hM3Dq, n = 13 mice. Two-tailed unpaired t test for E-H; Two-way ANOVA for D. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± S.E.M. Statistical details and results are presented in Figure 1-1. Download Figure 5-1, TIF file ^{(1.8MB, tif)} .

To further examine the enhanced baseline activity of SNc→DMS projection in VPA-induced autism-like behaviors, Cre-dependent hM4Di-mCherry or mCherry were injected into SNc, and a cannula was implanted in DMS for local application of CNO in VPA DAT-Cre mice (Fig. 5M,N). Following 7 d repeated CNO (5 µM, 120 nl) administration to selectively suppress SNC→DMS axonal terminals, we found that suppressing SNc→DMS projection in VPA mice was sufficient to correct autism-like behaviors (Fig. 5O–T), consistent with the results of chronic SNc DA somatic inhibition (Fig. 5G–L). In contrast, chronic chemogenetic activation of SNc→DMS projects resulted in social interaction deficits and repetitive behaviors in saline Control DAT-Cre mice (Extended Data Fig. 5-1). All of the above data shown that the elevated basal activity of SNc→DMS projections mediate autism-like behaviors, and chronical inhibition of this pathway alleviates social deficits and repetitive behaviors in VPA mice.

Suppression of SNc→DMS projection rectified functional alterations on D1-MSNs and D2-MSNs in VPA mice

Our previous study proved that prenatal VPA exposure induced differential functional alterations of direct and indirect pathways in DMS, and the potentiation of direct pathway associated with social deficits, while the depression of indirect pathway linked to repetitive behaviors (Di et al., 2022). Since the strength of glutamatergic inputs and intrinsic excitability in each type of MSNs is under control of DA (Kreitzer and Malenka, 2005; Surmeier et al., 2007, 2014; Gerfen and Surmeier, 2011), and the functional alteration of SNc→DMS DA projections in VPA mice as above, it was important to investigate whether SNc→DMS DA projections involve in regulating two core autism-like behaviors through the differentially modulation of the direct and indirect pathway MSNs. To address this point, DAT^Cre/+D1-eGFP^flox/+ mice were generated by crossing DAT^Cre+/+ with D1-eGFP^flox+/+ mice. By using these mice, SNc DA neurons could be specifically modulated by Cre-dependent chemogenetic virus, while the two types of MSNs could be identified by GFP fluorescence for electrophysiological recording in DMS. As the baseline activity suppression strategy in VPA mice described above, Cre-dependent hM4Di-mCherry or mCherry were bilaterally injected into SNc of VPA DAT^Cre/+D1-eGFP^flox/+ mice, followed by 7 d repeated CNO administration (1 mg/kg in saline, i.p.) to chronically depress the basal hyperactivity of SNc DA neurons in hM4Di-expressing VPA DAT^Cre/+D1-eGFP^flox/+ mice (Fig. 7A,B), and social deficits and repetitive behavior were rescued (Fig. 7C–H), consistent with the results in Figure 5G–L and O–T. As expected, the frequency and amplitude of mEPSCs onto D1-MSNs in VPA mice were both suppressed (Fig. 7I–K). The frequency of mEPSCs onto D2-MSNs was corrected, while the amplitude of mEPSCs were not significantly changed (Fig. 7L–N). The intrinsic excitability onto D1-MSNs were significantly suppressed, illustrated by an increased rheobase current (Fig. 7O) and a right-shifted average instantaneous frequency (Fig. 7P). In contrast, in D2-MSNs, the intrinsic excitability was significantly increased, illustrated by a decreased rheobase current (Fig. 7Q) and a left-shifted average instantaneous frequency (Fig. 7R). The above results indicate that chronic suppression of the elevated basal activity of SNc DA neurons normalized the potentiated direct pathway and disinhibited the depressed indirect pathway in DMS, consequently enabled to improve autism-like behaviors.

Figure 7.

Suppression of SNc→DMS projection rectified synaptic transmission and intrinsic excitability on D1-MSNs and D1-MSNs in VPA mice. A, Schematic of viral injection into SNc and the location for electrophysiological recording in DMS. B, Schematic of viral injection and following behavioral test. C–E, Representative traces (C), summary data of time spent in the social compartment (D), and social index (E) during three-chamber test. Following repeated CNO administration, hM4Di-expressing VPA mice spent more time in the stranger compartment (D) and showed higher social index (E). F, Summary data showing increased social time in home cage social interaction test in hM4Di-expressing VPA mice following repeated CNO administration. G, H, Summary data showing the decreased numbers of marbles buried (G) and self-grooming time (H) of hM4Di-expressing VPA mice following repeated CNO administration. I, L, Representative traces of mEPSCs from D1-MSNs (I) and D2-MSNs (L) of mCherry- and hM4Di-expressing VPA mice following repeated CNO administration. J, M, Summary data for mEPSC frequency with cumulative probability plots of interevent intervals in D1-MSNs (J) and D2-MSNs (M). K, N, Summary data for mEPSC amplitude with cumulative probability plots in D1-MSNs (K) and D2-MSNs (N). O–R, Summary data showing an increased AP rheobase (O) and a right-shifted average instant firing frequency–current (F/I) curves for D1-MSNs (P). A decreased AP rheobase (Q) and a left-shifted average instant firing F/I curves for D2-MSNs (R) in hM4Di-expressing VPA mice following repeated CNO administration. For C–H, mCherry, n = 12 mice; hM4Di, n = 10 mice. For J–N, D1-MSNs: mCherry, n = 17 cells from 7 mice; hM4Di, n = 15 cells from 4 mice; D2-MSNs: mCherry, n = 11 cells from 6 mice; hM4Di, n = 13 cells from 4 mice. For O–R, D1-MSNs: mCherry, n = 16 cells from 5 mice; hM4Di, n = 23 cells from 6 mice; D2-MSNs: mCherry, n = 17 cells from 5 mice; hM4Di, n = 12 cells from 6 mice. Two-way ANOVA for D; two-tailed unpaired t test for E, G, J, K, M, and N; Mann–Whitney test for F, H, O, and Q; Friedman's M test for P and R. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

One of the distinguishing features of MSNs is their differential dopamine receptor expression (Gerfen and Surmeier, 2011; Calabresi et al., 2014). To further confirm that baseline hyperactivity of SNc→DMS projection might result in enhanced baseline dopaminergic tone, which differentially regulates two core autism-like behaviors through the dichotomously expression of the D1R and D2R on direct and indirect pathway MSNs, specific D1R inhibitor SCH23390 (0.05 µg, 200 nl) or D2R inhibitor sulpiride (0.4 µg, 200 nl) was locally applied to DMS via bilateral implantation of cannula in VPA mice (Fig. 8A,B). We found that repetitive D1R inhibition significantly improved social deficits in VPA mice, with spending more time with the stranger mouse (Fig. 8C–E) and performing more social interaction with the novel partner (Fig. 8F). However, the self-grooming time and number of buried marbles were not significantly rescued in VPA mice (Fig. 8G,H). In parallel, repeated D2R inhibition alleviated repetitive behaviors (Fig. 8M,N), but there were no significantly changes in social deficits of VPA mice (Fig. 8I–L). The above results demonstrated that enhanced basal activity of SNc→DMS projections mediate the coexisting autism behaviors through the dichotomously modulation of direct and indirect pathway MSNs, respectively.

Figure 8.

Specific and chronic D1R inhibitor infusion in DMS improves social deficits, while D2R inhibitor alleviates repetitive behavior in VPA mice. A, Representative coronal section of the bilateral cannula placement in the DMS. B, Schematic of cannula implantation and following behavioral test. SCH23390 (0.25 µg/µl, 200 nl) or sulpiride (2 µg/µl, 200 nl) was administered, respectively. Cannula placements were confirmed postmortem in all mice. C–F, Representative traces (C) and summary data of three-chamber test or home cage test (F). VPA mice spent more time with the stranger (D, F) and had a higher social index (E) following SCH23390 infusion. G, H, Summary data showing numbers of marbles buried (G) and self-grooming time (H) were no improvement in VPA mice following SCH23390 infusion. I–L, Representative traces (I) and summary data of three-chamber test or home cage test (L). There were no significant changes in social deficits (J, K, L) of VPA mice following sulpiride infusion. M, N, Summary data showing the decreased numbers of marbles buried (M) and self-grooming time (N) in VPA mice following sulpiride infusion. SCH23390, n = 11 mice; sulpiride, n = 10 mice; two-way ANOVA for D and J; two-tailed paired t test for G, H, L–N; Wilcoxon test for E, F, and K. *p < 0.05, **p < 0.01, ***p < 0.001. Data represented as mean ± SEM. Statistical details and results are presented in Extended Data Figure 1-1.

Discussion

The hallmark of ASD is the coexistence of two core symptoms including social deficits and repetitive behaviors. Here we demonstrated that prenatal VPA exposure disrupts SNc→DMS dopaminergic signaling, contributing to the coexistence of core autism-like behaviors by reshaping the dynamics of direct and indirect pathway MSNs. The basal potentiation of SNc→DMS projections blunted the phasic responses during social interactions and repetitive behaviors. Chronic suppression of the abnormal enhanced basal activity in SNc→DMS projection, which effectively restored normal function in the D1-MSNs, is linked to social deficits while concurrently normalizing the D2-MSNs associated with repetitive behaviors. These findings offer insights regarding dopaminergic signaling as a hub underpinning the two coexisting behavioral abnormalities and highlighting potential therapeutic targets for autism.

The precise regulation of DA signaling is disrupted in ASD (Bariselli et al., 2016, 2018; Paval, 2017; Kosillo and Bateup, 2021; Paval and Miclutia, 2021). However, how dopaminergic dysregulation contributes to the core symptoms of autism remain unclear. The midbrain DA neurons are predominantly located in SNc and ventral tegmental area (VTA). SNc DA neurons primarily project to the striatum, forming the nigrostriatal pathway, while VTA DA neurons project to the medial prefrontal cortex and the nucleus accumbens (NAc), establishing the mesocorticolimbic pathway (Iversen and Iversen, 2007). A subregion DA hypothesis of autism was proposed that the ASD core symptoms arise from distinct subpopulations of DA neurons. Dysfunction of the mesocorticolimbic circuit might lead to social deficits, while dysfunction of the nigrostriatal circuit contributes to repetitive behaviors (Paval, 2017; Paval and Miclutia, 2021). Supporting evidence for this hypothesis includes that ASD patients exhibit aberrant activation of reward circuitry and a typical processing of social rewards (Clements et al., 2018; Zurcher et al., 2021). Animal models confirmed that VTA→NAc projections encode social behaviors (Gunaydin et al., 2014) and that abnormalities in VTA dopaminergic signaling correlate with impaired social preferences in Shank 3 and neuroligin-3 mouse (Bariselli et al., 2016, 2018).

Conversely, this subregion DA hypothesis faces challenges that the nigrostriatal circuit involved in both motor regulation and reward processing (Kravitz et al., 2012; Cox and Witten, 2019; Solie et al., 2022). A few studies support that striatal D1-MSNs mediate social behaviors (Gunaydin et al., 2014; Francis et al., 2015), while D2-MSNs associate with repetitive behaviors (Tanimura et al., 2010; Wang et al., 2017). Importantly, our previous study demonstrated that differential alterations in two striatal pathways mediate the two autism-like behavioral abnormalities, respectively (Di et al., 2022). Our current study identified dysfunction of SNc→DMS DA signaling in VPA offspring, leading us propose a pathway hypothesis: dysfunction of dopaminergic system mediates two core autism symptoms through two-type MSNs pathway, respectively.

While the pathway hypothesis offers a compelling explanation for the coexistence of core symptoms in ASD, an alternative hypothesis posits that dysfunction in both SNc and VTA dopaminergic pathways, also through reshaping of the direct and indirect MSN pathways, account for the coexistence of the two-core autism symptoms. This perspective actually complements our original hypothesis by acknowledging the complex interplay of dopaminergic signaling within multiple circuits involved in social behaviors (Gunaydin et al., 2014; Bariselli et al., 2016, 2018). Furthermore, considering that the DA system modulate neuronal activity across several brain regions implicated in autism (Iversen and Iversen, 2007; Kosillo and Bateup, 2021; Costa and Schoenbaum, 2022), dysfunctional dopaminergic signaling may disrupt neural circuits throughout a range of ASD-affected areas, thereby contributing to the phenotypic variability observed in ASD individuals.

Although genetic ASD models provide valuable insights into specific molecular alterations regarding the aberrant dopaminergic activity (Panayotis et al., 2011; Bariselli et al., 2016, 2018; Kosillo and Bateup, 2021), the environmental and genetic interaction VPA model allows for a more comprehensive investigation of DA signaling and their association with the behavior abnormalities. The VPA model is grounded in clinical findings regarding the ASD etiology and effectively replicates core behavioral symptoms (Roullet et al., 2013; Mabunga et al., 2015; Chaliha et al., 2020). Typically, VPA exposure occurs at approximately E12.5, a critical period when midbrain DA neuroprogenitors begin expressing tyrosine hydroxylase (TH) in rats (Bissonette and Roesch, 2016). As a histone deacetylase inhibitor, VPA exposure leads to global gene expression including Mecp2, Shank3, and Neuroligin3 which was associated with DA neuron development (Zhang et al., 2018). This raises the possibility that VPA may interact with these ASD-related genes during neurodevelopment, contributing to dysfunction of DA signaling.

Prenatal VPA exposure results in functional alterations of the SNc→DMS dopaminergic neurons at two key levels. One is an enhancement of basal activity, evidenced by strengthening of excitatory synaptic input and neuronal excitability (Fig. 1). Dopaminergic signaling modulates plasticity of the direct and indirect pathways in bidirectional and Hebbian plasticity (Surmeier et al., 2007, 2014; Paval and Miclutia, 2021). The enhanced basal activity in SNc→DMS DA projections could induce sustained activation of excitatory D1-MSNs, alongside concurrent inhibition of D2-MSNs. This dual alteration contributes to the manifestation of core autism-like behaviors including social deficits and repetitive behaviors, as we previously documented (Di et al., 2022). In the classical model of dopaminergic signaling, D1R operates as a low-affinity receptor activated by phasic transient high DA levels, whereas D2R functions as a high-affinity receptor that can be activated by basal tonic DA levels (Missale et al., 1998). Consequently, in VPA-exposed mice, the sustained elevation of baseline activity within the SNc→DMS projection is expected to preferentially engage the excitatory direct pathway, while the inhibition of the indirect pathway remains paradoxical, because the saturation of D2Rs by high DA levels prevents further activation of these low-affinity receptors. Recent studies suggest that G-protein-coupled inwardly rectifying potassium (GIRK) channels associated with D2Rs are predominantly in a low-affinity state, necessitating elevated concentrations of DA for their activation (Marcott et al., 2014). This finding elegantly elucidates the observed bidirectional and Hebbian plasticity of D1-MSNs and D2-MSNs following VPA exposure.

The other level was the impaired responsiveness in SNc→DMS projection, characterized by a reduction in behaviorally evoked Ca²⁺ and DA signaling during social interactions and repetitive behaviors (Figs. 2, 3). This reduced behaviorally evoked responsiveness may stem from the enhanced basal activity, which blunts the further activation of these DA neurons (Montgomery et al., 2024; Figs. 2C–E, 4). Together, these two levels of alterations complicate the understanding of dopaminergic signaling dysfunction in VPA-exposed mice. The enhanced basal activity of SNc→DMS neurons likely contributes to elevated basal DA levels in these mice, while the transient DA release evoked by behavior is significantly reduced (Fig. 3). These dynamic changes pose challenges for accurately measuring basal DA levels changes, which may be undetectable by in vivo brain microdialysis or high-performance liquid chromatography (HPLC) typically used for assessing basal DA levels (Liu et al., 2021; Maisterrena et al., 2022). We thus did not observe changes in basal DA levels in DMS of VPA-exposed mice in the current study. However, our previous study indicates elevated baseline DA levels in VPA mice, evidenced by potentiation of D1-MSNs and depression of D2-MSNs (Di et al., 2022). Furthermore, our current research indicates that chronic administration of D1R/D2R antagonists effectively rescues VPA-induced social deficits and repetitive behaviors (Fig. 8). Importantly, chronic chemogenetic/optogenetic suppression of SNc→DMS projection rectifies functional alterations in D1-MSNs and D2-MSNs, leading to amelioration of core behavioral abnormalities in VPA mice (Figs. 5–7). Collectively, these findings suggest that prenatal VPA exposure induces baseline potentiation in SNc→DMS projections, reshaping the D1-MSNs and D2-MSNs and mediating the observed social deficits and repetitive behaviors.

Our current study supports the hypothesis that enhanced baseline activity of dopaminergic signaling differentially reshapes two-type MSN pathways, thereby mediating the coexistence of core symptoms of ASD. However, this hypothesis faces several significant challenges. Firstly, dopamine modulators such as risperidone and aripiprazole have not demonstrated a clear impact on the core symptoms of ASD (LeClerc and Easley, 2015; Anagnostou, 2018). Secondly, the inhibit synaptic transmission onto SNc→DMS DA neurons have not been documented in our current studies. Considering D1-MSNs project preferentially onto GABAergic interneurons that inhibit dopaminergic neurons (Rothwell et al., 2014), and elevated baseline activity in D1-MSNs (Di et al., 2022), a decrease in inhibitory synaptic transmission onto DA neurons of VPA-exposed mice is anticipated. Thirdly, dysfunction of the DA system is implicated in a variety of psychiatric disorders, such as schizophrenia, addiction, attention-deficit/hyperactivity disorder (ADHD), and ASD (Gerfen and Surmeier, 2011; Surmeier et al., 2014; Hamid et al., 2016; Cox and Witten, 2019). The phenotypic manifestations of these neurological conditions vary significantly, raising the question of whether the dysfunction of SNc→DMS projection specifically leads to the constellation of behavioral symptoms characteristic of autism or contributes to other neurodevelopmental disorders. Finally, although this study was conducted in male mice, future longitudinal studies will investigate sex differences in dopaminergic neural circuits and related molecular mechanism in VPA-exposed mice. In summary, our study proposes a hypothesis: dysfunction of DA system mediates two core autism symptoms through two MSN pathways. This helps for the development of targeted therapeutic strategies aimed at dopaminergic circuit alterations to address core ASD behavioral abnormalities.