The molecular components of the anti-inflammatory cholinergic pathway are extrasplenic

Warda Merchant; Steven Wyler; Bandy Chen; Laurent Gautron

doi:10.1371/journal.pone.0331707

. 2025 Sep 5;20(9):e0331707. doi: 10.1371/journal.pone.0331707

The molecular components of the anti-inflammatory cholinergic pathway are extrasplenic

Warda Merchant ¹, Steven Wyler ¹, Bandy Chen ¹, Laurent Gautron ^1,^*

Editor: Yoshihiko Kakinuma²

PMCID: PMC12412977 PMID: 40911568

Abstract

The anti-inflammatory cholinergic pathway describes the interaction between cholinergic vagal nerves and splenic immune cells, yet the exact mechanisms underlying the anti-inflammatory cholinergic pathway remain disputed. Here, we mapped the expression of key molecular components of the anti-inflammatory cholinergic pathway in the adult mouse using RNAScope in situ hybridization (ISH) and quantitative PCR (qPCR). In C57BL/6J wild-type male mice, we observed the expression of choline acetyltransferase (Chat) and alpha 7 nicotinic acetylcholine receptor (Chrna7) in various autonomic neurons throughout the body, but not in the spleen, even after bacterial lipopolysaccharide (LPS) treatment. In contrast, the beta-2 adrenergic receptor (Adrb2), another autonomic receptor with well-documented anti-inflammatory actions, was highly expressed in the spleen, with a significant decrease following LPS administration. Interestingly, Adrb2 was also expressed at lower levels in the spleen of a newly generated global knockout mouse for Chrna7. Lastly, we did not observe YFP-positive cells or axons in the spleen of the ChAT-Cre-ChR2-YFP mouse. Based on our findings, we propose a new model of the cholinergic anti-inflammatory pathway that highlights the roles of extrasplenic cholinergic signaling.

Introduction

The electrical stimulation of the vagus nerve (VNS) inhibits the release of pro-inflammatory cytokines in laboratory rodents [1–8]. To explain these anti-inflammatory effects, it has been proposed that electrically stimulated vagal motor neurons trigger nerves reflexes which, subsequently, induce the acute release of acetylcholine (ACh) within the spleen [6,9–13]. The release of ACh in the latter structures has been attributed to a subtype of choline acetyltransferase (Chat)-expressing immune cells sensitive to changes in autonomic outflow [6,14–16]. Ultimately, binding of immune-derived ACh to the alpha 7 nicotinic acetylcholine receptor (α7nAChR) expressed by immune cells dampens the release of proinflammatory cytokines [6,10–13,17–19]. In agreement with the above scenario, the α7nAChR knockout mouse model resists the anti-inflammatory actions of VNS [19]. In addition, quantitative PCR (qPCR) and RT-PCR studies have reported Chrna7 (transcript for α7nAChR) expression in lymphoid tissues and isolated immune cells in rodents and humans [10,19–27]. Immune cells bearing α7nAChR have also been detected using techniques such as GFP reporter mice, flow cytometry antibodies, and alpha-bungarotoxin binding [10,28,29,19]. Lastly, the administration of α7nAChR agonists inhibits the release and expression of pro-inflammatory cytokines both in vivo and in vitro [30–39]. Hence, the vast majority of the review articles on the anti-inflammatory actions of VNS, often referred to as the anti-inflammatory cholinergic pathway, describe α7nAChR-expressing splenocytes as an obligatory link between the vagus nerve and immunity [40–47].

On the other hand, α7nAChR agonists do not always relieve inflammation in laboratory rodents depending on the examined inflammatory paradigm [48–50]. Of note, one clinical trial did not confirm the anti-inflammatory effects of a α7nAChR agonist in human subjects acutely treated with bacterial lipopolysaccharides [51]. Moreover, the exact mechanisms underlying the anti-inflammatory cholinergic pathway remain disputed. For instance, no anatomical and functional connections between vagal motor neurons and the spleen exist in the rat [52]. Others noted that electrically stimulated vagal motor neurons can inhibit inflammation in the α7nAChR knockout model [53,54]. Adding to the latter concerns, the anti-inflammatory effects of commonly used α7nAChR agonists are largely intact in primary macrophages from α7nAChR knockout mice [26], in the presence of α7nAChR antagonists [55], and in splenectomized animals [56]. Moreover, the administration of α7nAChR agonists exerts beneficial effects in α7nAChR knockout mice suffering from sepsis [57]. It is therefore likely that α7nAChR agonists exert α7nAChRs-independent anti-inflammatory effects.

More importantly, whether immune cells express α7nAChR remains debated. While prior studies reported α7nAChR immunoreactivity in immune and splenic cells [20,29,58–61], the detection of α7nAChR using commercial antibodies is deemed unreliable by many experts [62–66]. Whereas numerous reports of Chrna7 mRNA expression in immune cells [10,19–26], other studies found very low levels of Chrna7 mRNA in unstimulated human immune cells and cell lines [22,67,68]. One recent study failed to detect Chrna7 in the mouse spleen using RNA sequencing [69]. By in situ hybridization (ISH), another study similarly failed to detect Chrna7 in the developing mouse spleen [70]. Given the major discrepancies listed above, this study aimed at reassessing the in vivo distribution of the two main molecular components of the anti-inflammatory cholinergic pathway: Chat and Chrna7. In parallel, we also assessed the expression of beta-2 adrenergic receptor (Adrb2), another autonomic receptor with well-documented anti-inflammatory effects [11,50,71–74].

Methods

Experiments listed below were approved by the University of Texas Southwestern Institutional Animal Care and Use Committee under protocols 2016–101605 and 2017–101994. Mice were given an overdose of Ketamine/Xylazine (500/50 mg/kg, i.p.) before being transcardiacally perfused. All the mice were bred and studied at the Animal Resource Center at The University of Texas Southwestern Medical Center. Mice were grouped-housed in ventilated cages with enrichment (nestlet and igloo) in a light (12 h on/12 h off; lights on at 6 am)- and temperature-controlled environment (21.5°C–22.5°C). Water and standard chow (Harlan Teklad TD.2016 Global) were provided without restrictions. The number of mice used for experiments is indicated below. Anesthesia and/or analgesia were not provided since all our procedures were terminal. Mice treated with LPS were always sacrificed within a few hours to alleviate suffering.

Commercial mice

Male mice on a C57Bl/6J background were ordered from the Jackson Laboratory (stock #000664) and animals were used when they reached approximately 6–8 weeks of age. One cohort was used for RNAscope studies (n = 4 saline; n = 4 LPS). Another cohort of mice treated with either saline (n = 5) or LPS (n = 5) was used for quantitative real-time PCR (qPCR) as described below. An additional cohort of mice was treated with a high dose of LPS (n = 5) for a qPCR control experiment. In addition, we generated male Chat-Cre-Chr2-YFP mice by crossing ChAT-Cre mice from the Jackson Laboratory (strain #:031661) with Ai32 (strain #:024109). One cohort was used for RNAscope studies (n = 4 saline; n = 4 LPS).

Generation of Chrna7 knockout mice

To generate a conditional, Chrna7 loxP- flanked allele (Chrna7 flox), we used CRISPR-Cas9-mediated homologous recombination to insert two LoxP sites flanking exon 1 and 2 of the Chrna7 gene encoding the transcriptional and translational start site as well as the first 65 amino acids of nAChRα7. Guides were designed using IDT’s design algorithm as follows: 5’ Guide ribonucleotides sequence: 5’- AGGACCCACGGUCAAUUUUCGUUUUAGAGCUAUGCU −3’ 3’ ribonucleotide sequence: 5’- UUAGAAAACAAUCGUCCACGGUUUUAGAGCUAUGCU-3’. Two IDT Ultramers™ containing 80 bp homology arms flanking the loxP sequence were used as the HDR templates. Guides, trcRNA, HDR templates and Cas9 protein (all from Integrated DNA Technologies, Coralville, IA) were administered through a pronuclear injection in fertilized C57Bl/6NCrl (Charles River Laboratories, Wilmington MA) zygotes by the UT Southwestern Transgenic Technology Center. Founders were screened by PCR and sanger sequencing. Germline transmission of the floxed allele was verified by crossing Founders to C57Bl/6NCrl mice. A floxed mouse was crossed with a germline, CMV-Cre mouse (Schwenk et al 1995 PMID: 8559668) to generate knockout mice. This mouse was subsequently crossed to a C57Bl/6NCrl to “breed-out” the CMV-Cre allele. Mice were genotyped using the following primers: 5’-CACTGCATGTGATCCTGAAGAG-3’, 5’-AAGTGAAAAGCAAGGCTGGAG-3’, and 5’-AGGGAAGCCAAACCTCAAGATG-3’ with a wildtype band of 123 bp, a floxed band of 163 bp, and a knockout band of 430 bp. Wild-type (n = 6), heterozygous (n = 8), and homozygous (n = 8) were used for the purpose of qPCR assays.

LPS treatment

LPS (Sigma L2880 Escherichia coli 055:B5) was prepared in sterile pyrogen-free 0.9% saline (Hospira, IL, USA). A single dose of LPS at 1 mg/kg of body weight (i.p.) was administered during the light phase and animals were sacrificed 2hrs post-injection. The dose and time of sacrifice were previously considered suitable for studying the vagal anti-inflammatory pathway in mice [75]. Notably, a separate cohort was treated with a high dose of LPS (15 mg/kg, i.p.) for a qPCR control experiment.

QPCR

Analysis of gene expression by quantitative real time PCR (qPCR). Total mRNA was isolated from brainstem, duodenum, and spleen using RNA PureZol (Bio-Rad, Inc). RNA concentration was assessed by UV spectroscopy using the Beer-Lambert law at 260 nm wavelength. Complementary DNA from 1 μg of input RNA was generated with the High-Capacity cDNA Reverse Transcription Kits (Life Technologies). cDNA was diluted in ultra-pure distilled water, DNase-free RNase free (Invitrogen, 10977015). mRNA transcript levels were measured in duplicate using TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437), the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, 4317596) and the CFX maestro software. Prevalidated Taqman assays were performed using primers of Mm01317884_m1 (Chrna7), Mm01221876_m1 (Chat), and Mm02524224_s1 (Adrb2). Relative gene expression was calculated by the 2-ΔΔCT method with 18s as a control gene.

RNAscope studies

The protocol used below follows recommendations from our prior publication [76]. Mice were given an overdose of Ketamine/Xylazine (500/50 mg/kg, i.p.) before being transcardiacally perfused with 1x phosphate buffer saline (PBS) and 10% formalin (Sigma). Samples of interests were collected, kept in formalin at 4°C for 24 hours, and switched to 30% sucrose for another 24 hours. Samples were next positioned inside a drop of OCT medium (Sakura), frozen on dry ice, and stored at −80°C. Samples were cut with a cryostat into sections of 14 μm thickness and collected on SuperFrost glass slides. Pretreatment and ISH following the recommendations from the manufacturer (Advanced Cell Diagnostics, USA). Briefly, slides were rinsed, baked, post-fixed, and dehydrated in series of ethanol. Subsequently, slides were treated with H₂0₂, target retrieval, and protease plus as recommended by the manufacturer. Different combinations of probes for Adrb2 (#449771), Chat (#408731-C2), Phox2b (#407861-C2), and Chrna7 (#465161) were applied for 2 hours at 40°C (HybEZ oven). Slides were next incubated with amplification reagents contained in the multiplex kit (cat# 323100) and appropriate Opal dyes 520, 570, 690 (1/1,500; Akoya Biosciences). Slides were rinsed, exposed to DAPI, before applying EcoMount (BioCare Medical, USA) and coverslip. Other spleen slides were incubated with probes for Adrb2 (#449771), Chat (#408731), or Chrna7 (#465161) and processed with a FastRed chromogenic assay (ACD #323910) following the manufacturer’s instructions. Hematoxylin counterstained was applied to the latter slides before applying mounting medium and coverslip.

GFP immunostaining

A standard procedure was used to label YFP after RNAscope staining. Briefly, tissues already treated with RNAscope reagents were incubated with an antiserum against GFP (Aves Lab., cat. no. GFP-1020). This is a chicken polyclonal antiserum raised against GFP emulsified in Freund’s adjuvant. We are confident in the specificity of this antiserum for several reasons: a) according to the manufacturer, this antibody detected a single 28 kDa band using western blot analysis; b) this antibody was previously shown to produce no staining in the tissues of wildtype mice [77]; c) The staining obtained in this study was highly consistent with the anticipated distribution of GFP in our samples. Following incubation with the primary antibody, slides were incubated with a biotinylated anti-chicken secondary (Jackson ImmunoResearch, 1:1,000 dilution) and streptavidin AlexaFluor488 (Invitrogen, 1:1,000 dilution). Slides were rinsed, exposed to DAPI, before applying EcoMount and a coverslip.

Microscopic and data analysis

Digital images of FastRed-stained spleens were captured with an epifluorescence microscope (Leica DM6 B microscope with Leica DFC 9000 GT digital microscopy camera) attached to the LAS X software. Digital fluorescent images used for plates were acquired by confocal microscopy using the Zeiss (LSM880 Airyscan) under standardized acquisition settings. A typical image was generated with stacks of optical sections. Image J Fiji was used to merge our final RGB images at 300 dpi. For nodose ganglion sections, we manually estimated the proportion of Chrna7-expressing profiles expressing Phox2b mRNA. The number of positive Chrna7 dots per profile was also manually counted on digital images using the multi-points command. Adobe Photoshop 2021 was used to generate final plates and make annotations. We slightly adjusted the contrast and brightness of images uniformly. All graphs were generated, and statistical analyses were performed using GraphPad Prism 10 with data presented as mean values ± S.E.M. The number of mice per group and the statistical results are provided in the Fig legends and/ or result section.

Statistical reporting

Following a between subjects experimental design, animals were randomly attributed to treatment groups (saline or LPS). The experimenter performing qPCR was not aware of experimental groups. Once experimental data were collected, however, an unblinded experimenter performed the statistical tests. Raw data were not transformed, and no outliers were removed. Data in Fig 1 were analyzed by unpaired t-test (normal distribution) to compare saline vs LPS groups. Calculation was two-tailed. Data in Fig 5 with more than two groups were analyzed by ordinary one-way ANOVA (not matching or pairing with normal distribution). Multiple comparison was accounted for with the Dunnett test (recommended by GraphPad). Based on conventional practices and literature in qPCR studies, the threshold for statistical significance is typically set at a p-value of less than 0.05 (p < 0.05).

Fig 1 — Samples were obtained from mice treated with saline (grey dots) or LPS (red dots; n = 5 per group). LPS was administered at 1 mg/kg (ip) and mice sacrifice 2 hours post-injection. Gene expression was normalized against GADPH. Data are expressed as mean fold changes values ± S.E.M. Average Cq values are indicated above each bar graph. **(A)** *Adrb2* expression in the brainstem, duodenum, and spleen of saline- and LPS-treated mice. *, p = 0.0276 (unpaired t test). **(B)** *Chrna7* expression in the brainstem, duodenum, and spleen of saline- and LPS-treated mice. **(C)** *Chat* expression in the brainstem, duodenum, and spleen of saline- and LPS-treated mice.

Fig 5 — **(A)** Schematic representation of the transgenes used to generate Chrna7 knockout mice. **(B)** QPCR for *Chrna7* expression in the duodenum from wildtype vs Chrna7^+/− and Chrna7^−/− mice (N = 6 − 9 mice per genotype). **** for p < 0.0001 (Dunnett post-hoc comparison). **(C)** QPCR for *Chrna7* expression in the spleen from wildtype vs Chrna7^+/− and Chrna7^−/− mice (ns, not significant). **(D)** QPCR for *Chat* expression in the duodenum from wildtype vs Chrna7^+/− and Chrna7^−/− mice. *** for p < 0.001 (Dunnett post-hoc comparison with). **(E)** QPCR for *Chat* expression in the spleen from wildtype vs Chrna7^+/− and Chrna7^−/− mice. Gene expression was undetectable (ND) in all samples. **(F)** QPCR for *Adrb2* expression in the duodenum from wildtype vs Chrna7^+/− and Chrna7^−/− mice. ** for p < 0.01 (Dunnett post-hoc comparison). **(G)** QPCR for *Adrb2* expression in the spleen from wildtype vs Chrna7^+/− and Chrna7^−/− mice. ** for p < 0.01 (Dunnett post-hoc comparison). Average Ct values for each group is listed above bar graphs.

Results

QPCR analysis of the main molecular components of the anti-inflammatory pathway in wild-type mice

We examined by qPCR the expression for Adrb2, Chat, and Chrna7, three molecules known to be involved in the regulation of immunity by the autonomic nervous system. We focused on the brainstem compared to structures linked to the autonomic control of immunity, with a special emphasis on the gastrointestinal tract (GI) tract and spleen, in animals treated with either saline or LPS (Fig 1). Adrb2 expression was moderate in the brainstem and duodenum, and high in the spleen (Fig 1A). Interestingly, LPS treatment significantly reduced Adrb2 in the brainstem (unpaired t test; p = 0.0276, t = 2.687, df = 8) and spleen (p = 0.0250; t = 2.753, df = 8), but not in the duodenum (p = 0.6640, t = 0.4509, df = 8) (Fig 1A). Chrna7 expression was expressed at moderate levels in the brainstem and not regulated by LPS (unpaired t test; p = 0.9452, t = 0.07095, df = 8) (Fig 1B). In the duodenum, Chrna7 expression was low and not regulated by LPS (p = 0.3811, t = 0.9269, df = 8). In the spleen, Chrna7 expression was very low, close to its limits of detection (Ct approaching 37), and not regulated by LPS (p = 0.1454, t = 1.613, df = 8) (Fig 1B). Chat expression was expressed at moderate and low levels in the brainstem and duodenum, respectively (Fig 1C). LPS did not regulate Chat in the brainstem (unpaired t test; p = 0.9040, t = 0.1245, df = 8) and duodenum (p = 0.8479, t = 0.1981, df = 8). Chat remained completely undetectable in the spleen. We wondered if a very high dose of LPS could influence Chat expression. To address this point, we conducted additional qPCR experiments using a high LPS dose (15 mg/kg, i.p.; S1 Fig). Notably, Chat remained undetectable regardless of the dosage.

Expression of Chrna7 is restricted to neurons

To validate our qPCR data and clarify α7nAChR target cells, we used fluorescent RNAScope assays to survey the distribution of Chrna7 mRNA in the brainstem, gut and spleen (Fig 2). Abundant Chrna7 signals (red dots) accumulated in neurons throughout the parasympathetic nervous system including vagal motor neurons (Fig 2A), nodose-jugular ganglion neurons (Fig 2B, 2C), and the enteric nervous system (Fig 2D, 2E). In contrast, Chrna7 signals were virtually undetectable in the GI mucosa (Fig 2D) and Peyer’s patches (Fig 2F). Within the sympathetic nervous system, many neurons belonging to the dorsal root ganglion (Fig 2G) and celiac ganglion (Fig 2H) also expressed Chrna7 at high levels. The mouse spleen was devoid of Chrna7 signals (Fig 2I).

Fig 2 — Hybridization signals for *Chrna7* (red dots) were found in neurons throughout the parasympathetic nervous system including the dorsal nucleus of the vagus **(A)**, the nodose ganglion **(B, C)**, and the enteric nervous system **(D, E)**. White arrows indicate representative neuronal profiles positive for *Chrna7*. Note that Chrna7 expression was not seen in non-neuronal areas such as the intestinal mucosa (D) or the Peyer’s patch **(F)**. Hybridization signals for *Chrna7* were also abundant in neurons belonging to the dorsal root ganglion (G) and celiac ganglion **(H)**, but not the spleen **(I)**. white arrows indicate representative *Chrna7*-expressing neurons. Tissues were counterstained with DAPI (grey) and all images were acquired using confocal microscopy. Abbreviations: cc, central canal; DMX, dorsal nucleus of the vagus; ep, epithelium; lp, lamina propria; mp, myenteric plexus; Sol, nucleus of the solitary tract; XII, hypoglossal nucleus. Scale bar in A applies to B, D, F, G, I. Scale bar in C applies to E and the insets in G and H.

Multiplex fluorescence RNAScope further revealed that Chrna7 was expressed by at least 50% of Phox2b-positive vagal afferent neurons (Fig 3A–3D). The administration of LPS did not alter the overall distribution and percentage of Chrna7-expressing neurons (Fig 3E). To ascertain the absence of Chrna7 and Chat in the spleen, we also performed chromogenic RNAscope assays, a method suited to detecting lowly expressed transcripts and avoid issues of endogenous fluorescent background. As anticipated, Adrb2 signals (red dots) were observed across the entire mouse spleen in both the white and red pulps (Fig 4A, 4B). By contrast, we could never detect any signals for either Chrna7 or Chat in the spleen (Fig 4C–4F).

Fig 4 — Chromogenic RNAScope (FastRed dots) was performed on the spleen of wild-type mice. Tissues was counterstained with hematoxylin. **(A)** *Adrb2* positive signals were seen across most of the spleen in both the white and red pulps. **(B, C)** In agreement with our fluorescent assays, the spleen was virtually devoid of any signals for *Chat* and *Chrna7*.

Transcriptional adaptations in the spleen of α7nAChR knockout mice

The expressions of Chrna7, Chat and Adrb2 were further assessed in a newly generated knockout mouse (Fig 5A). Expression for Chrna7 was significantly reduced in the duodenum of mice lacking one copy of Chrna7 and undetectable in the knockout mouse (One-way ANOVA, F = 20.63, P < 0.0001; followed by a Dunnett post-hoc comparison with **** for p < 0.0001) (Fig 5B). In the spleen of wild-type and heterozygous animals, Chrna7 expression was detected in several samples, albeit at very low levels (One-way ANOVA, F = 2.208, P = 0.1360; ns, not significant). (Fig 5C). Since Chrna7 expression was not significantly different between genotypes, we concluded that low levels of Chrna7 in the whole spleen are attributable to a very small population of Chrna7-expressing cells that are undetectable by histology.

Interestingly, Chat was significantly reduced in the duodenum of mice lacking one or two copies of Chrna7 (One-way ANOVA, F = 16.02, P < 0.0001; followed by a Dunnett post-hoc comparison with *** for p < 0.001) (Fig 5D), suggesting adaption of the autonomic nervous system in response to α7nAChR deficiency. In agreement with our prior findings, Chat transcripts couldn’t be detected in the spleen (Fig 5E). Lastly, we report an unexpected reduction of Adrb2 expression in both the duodenum (One-way ANOVA, F = 8.924, P = 0.0019; followed by a Dunnett post-hoc comparison with ** for p < 0.01) and spleen (One-way ANOVA, F = 7.995, P = 0.0033; followed by a Dunnett post-hoc comparison with ** for p < 0.01) of mice lacking Chrna7 (Fig 5F, 5G).

The spleen is not a site of cholinergic signaling

To clarify the relationship between cholinergic cells and Chrna7-expressing neurons, multiplex RNAscope for Chrna7 was repeated in a reporter mouse model with permanently labeled cholinergic cells (ChAT-Cre-ChR2-YFP). In these mice, YFP was seen in vagal motor neurons and their axons traveling in the vagus nerve (Fig 6A, 6B), as well as in enteric neurons and their axons throughout the mucosa (Fig 6C, 6D). Within the mucosa, we observed round shape cells resembling immune cells in the GI mucosa (Fig 6D). However, these cells were only occasionally observed and not consistently in every animal. A similar observation was made in the Peyer’s patch (Fig 6E). As expected, YFP also labeled cholinergic terminals in postganglionic sympathetic ganglia such as the celiac ganglion (Fig 6F). Overall, YFP staining was distributed a pattern good agreement with the known distribution of cholinergic cells throughout the body [16]. However, neither YFP-stained cells nor axons were observed in the mouse spleen (Fig 6G). Observations were repeated in a total of 4 saline- and 4 LPS-treated mice. However, the above distribution pattern was strictly identical in both treatment groups.

Fig 6 — Confocal microcopy of YFP-stained tissues revealing the distribution of putative cholinergic structures in the ChAT-Cre-ChR2-YFP mouse. **(A)** In the brainstem, both YFP-positive somas and axons were observed in cholinergic nuclei containing vagal motor neurons. **(B)** Within the nodose ganglion, only YFP-positive axons were seen, likely originating from vagal motor neurons. **(C)** The GI tract contained abundant YFP immunoreactivity in enteric neurons, both submucosal and myenteric. The axons of enteric neurons traveled towards the mucosa. **(D)** Of note, the mucosa also contained round-shape YFP positive cells resembling immune cells (white asterisk), but only occasionally and not consistently across animals. **(E)** Sparse YFP-positive cells resembling immune cells were also occasionally detected in the Peyer’s patches. **(F)** A rich network of YFP-positive axons was observed in postganglionic sympathetic ganglia, such as the celiac ganglion, but no cell bodies. **(G)** The spleen was devoid of YFP-positive axons and cells. Upon visual inspection, the above distribution pattern was strictly identical in saline- and LPS-treated mice. Abbreviations: mp, myenteric plexus; sol, solitary tract nucleus; X, vagus nerve; XII, hypoglossal nerve; Amb, nucleus ambiguous.

We next verify whether YFP cells were genuinely cholinergic, the GI tract and spleen of YFP mice were processed for multiplex RNAscope for Chat and Chrna7 mRNAs. In the GI tract, most YFP-positive enteric neurons expressed Chat signals (Fig 7A–7D). A large subset, but not all of them, also expressed Chrna7 signals. The proportions of Chat- and Chrna7-expressing YFP enteric neurons were directly comparable in saline- and LPS-treated mice (Fig 7D). Once again, in the spleen of the same animals, YFP was not detected and signals for Chat and Chrna7 were completely absent (Fig 7E–7G).

Fig 7 — **(A-C)** Confocal microscopic analysis of RNAscope for *Chat* (white dots) and *Chrna7* (red dots) expression in the duodenum of ChAT-Cre-ChR2-YFP mice, with GFP-positive enteric neurons (green staining) identified using a GFP antibody. YFP-positive enteric neurons commonly co-expressed both transcripts. Tissue was counterstained with DAPI (blue). **(D)** Pie charts illustrating the percentage of GFP-positive cells in the duodenum that express *Chat* and/or *Chrna7*. **(E-G)** In the spleen of the same mice, neither YFP expression nor the transcripts for *Chat* and *Chrna7* were detected. Scale bar in (A) applies to all images.

Discussion

Many previous studies have reported detecting α7nAChR expression in immune cells using mRNA-based techniques, binding assays, and histology (see Introduction). However, the specificity of the latter data was not always convincingly established. In vitro, immunocompetent cells including, among other examples, cultured macrophages, microglia, and isolated B-cells have been shown to express very low levels of Chrna7 transcripts using qPCR [26,78,79]. In vivo, several studies failed to detect Chrna7 in lymphoid tissues and immune cells in mice and humans [69,70]. Our present data combined with that of others show that Chrna7 is abundantly expressed by autonomic and enteric neurons [66,80–82], but only at very low levels by splenic cells. Although low levels of Chrna7 transcripts were detected by qPCR, RNAscope consistently failed to detect Chrna7 in the spleen. Combined, our results indicate that there are very few Chrna7-expressing cells in the mouse spleen. Furthermore, LPS administration did not modify the distribution pattern and expression levels of Chrna7, at least at the dose and time point used in this study. Likewise, publicly available transcriptomics data show enrichment of β-2 adrenergic receptors, but not Chrna7 in the mouse, human, and non-human primate spleen as well as varied immune cell types [83–85]. A publicly available transcriptional survey of blood-derived human immune cell types shows the absence of Chrna7 and other cholinergic markers, even in activated cells [86]. These data from independent databases are recapitulated in Fig 8 and are in good agreement with each other’s and our own findings. Herein, definitive evidence of Chrna7 expression by immune cells is still lacking.

Prior studies have indicated that Chat-expressing lymphocytes modify immunity (15, 92, 93). However, whether immune cells are a significant source of ACh remains an ongoing debate [87]. By histochemical techniques, cells positive for cholinergic markers can be detected in the spleen of mice and humans even though at low density [88–90]. We and others have previously reported the presence of a few putative choline acetyltransferase (Chat)-positive cells in the mouse spleen using fluorescent reporter mice [6,14,16,23,91,92]. However, the visualization of ChAT-Cre or -GFP cells doesn’t preclude that ACh is being produced by these cells. Moreover, ChAT stains were not validated using knockout model, leaving uncertainty as to its specificity. ACh release is stimulated within the rodent spleen after nerve stimulation [6,14,88]. However, it may not come from a local source. In support of this view, our current data and publicly available databases do not provide convincing evidence of any Chat expression in the spleen (Fig 8A–8D). Of course, it cannot be ruled out that splenic cells may start producing Chat under specific immune challenges and, furthermore, that different animal species or mouse strains express varying levels of Chat.

In contrast, Adrb2 is highly expressed in the mouse spleen, consistent with numerous previous reports [93] (see also Fig 8). Many in vivo studies have demonstrated that Adrb2 signaling plays a significant role in inhibiting inflammation across various paradigms, including, but not limited to, septic shock [94–97]. Here, LPS administration down regulated Adrb2 expression in the spleen, further highlighting the role of adrenergic signaling in immunomodulation in response to LPS. Although it remains unclear whether LPS-induced downregulation of Adrb2 has been previously demonstrated in vivo, at least one prior in vitro study reported that LPS treatment of cultured macrophages reduces Adrb2 expression [98]. Furthermore, this LPS-induced downregulation of Adrb2 occurred in a TRIF-dependent manner [98]. The reduced expression of Adrb2 in α7nAChR knockout mice is an intriguing finding. The underlying cause of this downregulation is unknown, but it is possible that the absence of α7nAChR leads to elevated background inflammation and/or altered immune cells composition, which in turn may suppress Adrb2 expression.

If splenocytes and immune cells neither express α7nAChRs nor produce Ach, then how to explain the so-called anti-inflammatory cholinergic pathway? Even if our observations do not provide functional insights into how the vagus nerve modulates immunity, they call for a reappraisal of the cellular and anatomical determinants of the anti-inflammatory cholinergic pathway (Fig 9). Considering the enrichment of Chna7 in many autonomic neurons and its scarcity in the spleen, our data suggest that the anti-inflammatory cholinergic pathway may mainly rely on extrasplenic neuronal α7nAChRs.

Fig 9 — We speculate that the unilateral electrical stimulation of the peripheral end of the vagus nerve (VNS) triggers a cascade of nerve reflexes on both sides of the body. Upon the release of acetylcholine from enteric neurons, vagal efferents, and epithelial cholinergic cells, stimulation of α7nAChR-bearing sensory neurons (vagal and spinal) endings occurs. In turn, the stimulation of gut-to-brain pathways mobilizes the sympathetic outflow to the gut and spleen. Ultimately, adrenergic signaling in peripheral immune cells may contribute to suppressing immunity. The expression of β2 receptors in immune cells is otherwise well-established. For the sake of simplicity, the adrenergic supply to the gut is not indicated. In this model, and in agreement with others [51,105], cholinergic signaling in peripheral immune cells themselves plays little or no role in mediating the anti-inflammatory effects of vagus nerve stimulation. Here, we found little evidence of α7nAChR expression in the mouse spleen. Further studies are warranted to validate our speculative model including, most notably, studies with mice that lack α7nAChR only in neurons. If our hypothesis is correct, we predict such animals to be unresponsive to the anti-inflammatory actions of vagus nerve stimulation and α7nAChRs agonists. Black arrows indicate the direction of electrophysiological impulses. Abbreviations: ACh, acetylcholine; CMG, celiac-mesenteric ganglion; cX, contralateral vagus nerve; DMV, dorsal motor of the vagus; DRG, dorsal root ganglion; ENS, enteric nervous system; NG, nodose ganglion; NTS, nucleus of solitary tract; Nor, norepinephrine; iX, ipsilateral vagus nerve; sn, spinal nerves; VNS, vagus nerve stimulation; GI, gastrointestinal; α7, alpha 7 nicotinic acetylcholine receptors.

Prior studies have shown that both vagal and spinal afferents are highly sensitive to ACh and nicotine [66,81,99–102]. Therefore, α7nAChRs on sensory terminal endings is likely to contribute to the firing of spinal afferents after the electrical stimulation of vagal motor neurons. In parallel, stimulated enteric neurons will likely trigger various mechanical and endocrine responses which may further enhance peripheral afferents activity (Fig 9). For instance, Komegae and colleagues showed that the mechanical manipulation of abdominal viscera stimulates vagal afferent neurons and causes an anti-inflammatory effect [103]. Hence, the electrical stimulation of vagal efferents, which has been conventionally described as sparing afferents, is likely to excite a variety of sensory endings including those located on the side contralateral to the electrical stimulation (Fig 9). Put it briefly, our proposed model suggests that α7nAChRs-bearing peripheral afferents constitute an intermediate link between vagal motor stimulation and inhibited inflammation by the sympathetic system. In particular, one of the most powerful anti-inflammatory pathway in the body involves the sympathetic outflow to the spleen [104]. Once peripheral afferents are stimulated, then a multisynaptic neural pathway enhances the sympathetic outflow to the spleen and other abdominal organs, ultimately inhibiting immunity via the β-2 adrenergic receptor [8,15,50,53,104–109] (Fig 9). The link between sympathetic outflow and immunity is otherwise well established and has continued to be an active area of research for several decades [50,91,104,106,110].

In conclusion, numerous uncertainties remain as to the mechanisms of action and efficacy of the anti-inflammatory cholinergic pathway. Based on the current data, we propose that no irrefutable evidence exists supporting direct cholinergic signaling in splenic cells. Moving forward, research on the neural control of immunity should focus on how cholinergic signaling in extrasplenic sites, including autonomic neurons, rather than immune cells, inhibit inflammation.

Supporting information

S1 Fig. Table of qPCR data.

(DOCX)

pone.0331707.s001.docx^{(15.1KB, docx)}

Acknowledgments

We are grateful to Jenny Lee for her assistance with RNAscope studies in the early phase of this project. This basic research study was not pre-registered.

Data Availability

All relevant data are within the manuscript.

Funding Statement

LG: NIH P01DK119130 (CNS mechanisms linking exercise training with energy balance and metabolism, Core C). LG: TRC4 #066 (Physiological and molecular determinants of shock-induced torpor in the mouse).

References

1.Somann JP, Wasilczuk KM, Neihouser KV, Sturgis J, Albors GO, Robinson JP, et al. Characterization of plasma cytokine response to intraperitoneally administered LPS & subdiaphragmatic branch vagus nerve stimulation in rat model. PLoS One. 2019;14(3):e0214317. doi: 10.1371/journal.pone.0214317 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, et al. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 2000;405(6785):458–62. doi: 10.1038/35013070 [DOI] [PubMed] [Google Scholar]
3.Huston JM, Ochani M, Rosas-Ballina M, Liao H, Ochani K, Pavlov VA, et al. Splenectomy inactivates the cholinergic antiinflammatory pathway during lethal endotoxemia and polymicrobial sepsis. J Exp Med. 2006;203(7):1623–8. doi: 10.1084/jem.20052362 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.van Westerloo DJ, Giebelen IAJ, Meijers JCM, Daalhuisen J, de Vos AF, Levi M, et al. Vagus nerve stimulation inhibits activation of coagulation and fibrinolysis during endotoxemia in rats. J Thromb Haemost. 2006;4(9):1997–2002. doi: 10.1111/j.1538-7836.2006.02112.x [DOI] [PubMed] [Google Scholar]
5.Bosmans G, Appeltans I, Stakenborg N, Gomez-Pinilla PJ, Florens MV, Aguilera-Lizarraga J, et al. Vagus nerve stimulation dampens intestinal inflammation in a murine model of experimental food allergy. Allergy. 2019;74(9):1748–59. doi: 10.1111/all.13790 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Guyot M, Simon T, Panzolini C, Ceppo F, Daoudlarian D, Murris E, et al. Apical splenic nerve electrical stimulation discloses an anti-inflammatory pathway relying on adrenergic and nicotinic receptors in myeloid cells. Brain Behav Immun. 2019;80:238–46. doi: 10.1016/j.bbi.2019.03.015 [DOI] [PubMed] [Google Scholar]
7.Stakenborg N, Gomez-Pinilla PJ, Verlinden TJM, Wolthuis AM, D’Hoore A, Farré R, et al. Comparison between the cervical and abdominal vagus nerves in mice, pigs, and humans. Neurogastroenterol Motil. 2020;32(9):e13889. doi: 10.1111/nmo.13889 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Vida G, Peña G, Kanashiro A, Thompson-Bonilla M del R, Palange D, Deitch EA, et al. β2-Adrenoreceptors of regulatory lymphocytes are essential for vagal neuromodulation of the innate immune system. FASEB J. 2011;25(12):4476–85. doi: 10.1096/fj.11-191007 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Cailotto C, Gomez-Pinilla PJ, Costes LM, van der Vliet J, Di Giovangiulio M, Némethova A, et al. Neuro-anatomical evidence indicating indirect modulation of macrophages by vagal efferents in the intestine but not in the spleen. PLoS One. 2014;9(1):e87785. doi: 10.1371/journal.pone.0087785 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Matteoli G, Gomez-Pinilla PJ, Nemethova A, Di Giovangiulio M, Cailotto C, van Bree SH, et al. A distinct vagal anti-inflammatory pathway modulates intestinal muscularis resident macrophages independent of the spleen. Gut. 2014;63(6):938–48. doi: 10.1136/gutjnl-2013-304676 [DOI] [PubMed] [Google Scholar]
11.Bassi GS, Kanashiro A, Coimbra NC, Terrando N, Maixner W, Ulloa L. Anatomical and clinical implications of vagal modulation of the spleen. Neurosci Biobehav Rev. 2020;112:363–73. doi: 10.1016/j.neubiorev.2020.02.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Rana M, Fei-Bloom Y, Son M, La Bella A, Ochani M, Levine YA, et al. Constitutive Vagus Nerve Activation Modulates Immune Suppression in Sepsis Survivors. Front Immunol. 2018;9:2032. doi: 10.3389/fimmu.2018.02032 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Chavan SS, Pavlov VA, Tracey KJ. Mechanisms and Therapeutic Relevance of Neuro-immune Communication. Immunity. 2017;46(6):927–42. doi: 10.1016/j.immuni.2017.06.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Rosas-Ballina M, Olofsson PS, Ochani M, Valdés-Ferrer SI, Levine YA, Reardon C, et al. Acetylcholine-synthesizing T cells relay neural signals in a vagus nerve circuit. Science. 2011;334(6052):98–101. doi: 10.1126/science.1209985 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Murray K, Rude KM, Sladek J, Reardon C. Divergence of neuroimmune circuits activated by afferent and efferent vagal nerve stimulation in the regulation of inflammation. J Physiol. 2021;599(7):2075–84. doi: 10.1113/JP281189 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Gautron L, Rutkowski JM, Burton MD, Wei W, Wan Y, Elmquist JK. Neuronal and nonneuronal cholinergic structures in the mouse gastrointestinal tract and spleen. J Comp Neurol. 2013;521(16):3741–67. doi: 10.1002/cne.23376 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Pavlov VA, Parrish WR, Rosas-Ballina M, Ochani M, Puerta M, Ochani K, et al. Brain acetylcholinesterase activity controls systemic cytokine levels through the cholinergic anti-inflammatory pathway. Brain Behav Immun. 2009;23(1):41–5. doi: 10.1016/j.bbi.2008.06.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Qian J, Galitovskiy V, Chernyavsky AI, Marchenko S, Grando SA. Plasticity of the murine spleen T-cell cholinergic receptors and their role in in vitro differentiation of naïve CD4 T cells toward the Th1, Th2 and Th17 lineages. Genes Immun. 2011;12(3):222–30. doi: 10.1038/gene.2010.72 [DOI] [PubMed] [Google Scholar]
19.Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, et al. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature. 2003;421(6921):384–8. doi: 10.1038/nature01339 [DOI] [PubMed] [Google Scholar]
20.Downs AM, Bond CE, Hoover DB. Localization of α7 nicotinic acetylcholine receptor mRNA and protein within the cholinergic anti-inflammatory pathway. Neuroscience. 2014;266:178–85. doi: 10.1016/j.neuroscience.2014.02.011 [DOI] [PubMed] [Google Scholar]
21.Villiger Y, Szanto I, Jaconi S, Blanchet C, Buisson B, Krause K-H, et al. Expression of an alpha7 duplicate nicotinic acetylcholine receptor-related protein in human leukocytes. J Neuroimmunol. 2002;126(1–2):86–98. doi: 10.1016/s0165-5728(02)00057-7 [DOI] [PubMed] [Google Scholar]
22.Benfante R, Antonini RA, De Pizzol M, Gotti C, Clementi F, Locati M, et al. Expression of the α7 nAChR subunit duplicate form (CHRFAM7A) is down-regulated in the monocytic cell line THP-1 on treatment with LPS. J Neuroimmunol. 2011;230(1–2):74–84. doi: 10.1016/j.jneuroim.2010.09.008 [DOI] [PubMed] [Google Scholar]
23.Hoover DB, Poston MD, Brown S, Lawson SE, Bond CE, Downs AM, et al. Cholinergic leukocytes in sepsis and at the neuroimmune junction in the spleen. Int Immunopharmacol. 2020;81:106359. doi: 10.1016/j.intimp.2020.106359 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Costantini TW, Chan TW, Cohen O, Langness S, Treadwell S, Williams E, et al. Uniquely human CHRFAM7A gene increases the hematopoietic stem cell reservoir in mice and amplifies their inflammatory response. Proc Natl Acad Sci U S A. 2019;116(16):7932–40. doi: 10.1073/pnas.1821853116 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Zanetti SR, Ziblat A, Torres NI, Zwirner NW, Bouzat C. Expression and Functional Role of α7 Nicotinic Receptor in Human Cytokine-stimulated Natural Killer (NK) Cells. J Biol Chem. 2016;291(32):16541–52. doi: 10.1074/jbc.M115.710574 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Garg BK, Loring RH. GTS-21 has cell-specific anti-inflammatory effects independent of α7 nicotinic acetylcholine receptors. PLoS One. 2019;14(4):e0214942. doi: 10.1371/journal.pone.0214942 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Cedillo JL, Arnalich F, Martín-Sánchez C, Quesada A, Rios JJ, Maldifassi MC, et al. Usefulness of α7 nicotinic receptor messenger RNA levels in peripheral blood mononuclear cells as a marker for cholinergic antiinflammatory pathway activity in septic patients: results of a pilot study. J Infect Dis. 2015;211(1):146–55. doi: 10.1093/infdis/jiu425 [DOI] [PubMed] [Google Scholar]
28.Gahring LC, Myers EJ, Dunn DM, Weiss RB, Rogers SW. Nicotinic alpha 7 receptor expression and modulation of the lung epithelial response to lipopolysaccharide. PLoS One. 2017;12(4):e0175367. doi: 10.1371/journal.pone.0175367 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Qi Y, Si D, Zhu L, Qi Y, Wu Z, Chen D, et al. High-fat diet-induced obesity affects alpha 7 nicotine acetylcholine receptor expressions in mouse lung myeloid cells. Sci Rep. 2020;10(1):18368. doi: 10.1038/s41598-020-75414-w [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Olofsson PS, Katz DA, Rosas-Ballina M, Levine YA, Ochani M, Valdés-Ferrer SI, et al. α7 nicotinic acetylcholine receptor (α7nAChR) expression in bone marrow-derived non-T cells is required for the inflammatory reflex. Mol Med. 2012;18(1):539–43. doi: 10.2119/molmed.2011.00405 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Pavlov VA, Ochani M, Yang L-H, Gallowitsch-Puerta M, Ochani K, Lin X, et al. Selective alpha7-nicotinic acetylcholine receptor agonist GTS-21 improves survival in murine endotoxemia and severe sepsis. Crit Care Med. 2007;35(4):1139–44. doi: 10.1097/01.CCM.0000259381.56526.96 [DOI] [PubMed] [Google Scholar]
32.Hamano R, Takahashi HK, Iwagaki H, Yoshino T, Nishibori M, Tanaka N. Stimulation of alpha7 nicotinic acetylcholine receptor inhibits CD14 and the toll-like receptor 4 expression in human monocytes. Shock. 2006;26(4):358–64. doi: 10.1097/01.shk.0000228168.86845.60 [DOI] [PubMed] [Google Scholar]
33.Godin J-R, Roy P, Quadri M, Bagdas D, Toma W, Narendrula-Kotha R, et al. A silent agonist of α7 nicotinic acetylcholine receptors modulates inflammation ex vivo and attenuates EAE. Brain Behav Immun. 2020;87:286–300. doi: 10.1016/j.bbi.2019.12.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Bernik TR, Friedman SG, Ochani M, DiRaimo R, Susarla S, Czura CJ, et al. Cholinergic antiinflammatory pathway inhibition of tumor necrosis factor during ischemia reperfusion. J Vasc Surg. 2002;36(6):1231–6. doi: 10.1067/mva.2002.129643 [DOI] [PubMed] [Google Scholar]
35.Mizrachi T, Marsha O, Brusin K, Ben-David Y, Thakur GA, Vaknin-Dembinsky A, et al. Suppression of neuroinflammation by an allosteric agonist and positive allosteric modulator of the α7 nicotinic acetylcholine receptor GAT107. J Neuroinflammation. 2021;18(1):99. doi: 10.1186/s12974-021-02149-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Ulleryd MA, Mjörnstedt F, Panagaki D, Yang LJ, Engevall K, Gutiérrez S, et al. Stimulation of alpha 7 nicotinic acetylcholine receptor (α7nAChR) inhibits atherosclerosis via immunomodulatory effects on myeloid cells. Atherosclerosis. 2019;287:122–33. doi: 10.1016/j.atherosclerosis.2019.06.903 [DOI] [PubMed] [Google Scholar]
37.Lee RH, Vazquez G. Evidence for a prosurvival role of alpha-7 nicotinic acetylcholine receptor in alternatively (M2)-activated macrophages. Physiol Rep. 2013;1(7):e00189. doi: 10.1002/phy2.189 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Wu J, Jiao Z-Y, Li R-Z, Lu H-L, Zhang H-H, Cianflone K. Cholinergic activation suppresses palmitate-induced macrophage activation and improves acylation stimulating protein resistance in co-cultured adipocytes. Exp Biol Med (Maywood). 2017;242(9):961–73. doi: 10.1177/1535370217700522 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Rosas-Ballina M, Goldstein RS, Gallowitsch-Puerta M, Yang L, Valdés-Ferrer SI, Patel NB, et al. The selective alpha7 agonist GTS-21 attenuates cytokine production in human whole blood and human monocytes activated by ligands for TLR2, TLR3, TLR4, TLR9, and RAGE. Mol Med. 2009;15(7–8):195–202. doi: 10.2119/molmed.2009.00039 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Hodo TW, de Aquino MTP, Shimamoto A, Shanker A. Critical Neurotransmitters in the Neuroimmune Network. Front Immunol. 2020;11:1869. doi: 10.3389/fimmu.2020.01869 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Jarczyk J, Yard BA, Hoeger S. The Cholinergic Anti-Inflammatory Pathway as a Conceptual Framework to Treat Inflammation-Mediated Renal Injury. Kidney Blood Press Res. 2019;44(4):435–48. doi: 10.1159/000500920 [DOI] [PubMed] [Google Scholar]
42.Wu Y-J, Wang L, Ji C-F, Gu S-F, Yin Q, Zuo J. The Role of α7nAChR-Mediated Cholinergic Anti-inflammatory Pathway in Immune Cells. Inflammation. 2021;44(3):821–34. doi: 10.1007/s10753-020-01396-6 [DOI] [PubMed] [Google Scholar]
43.Bonaz B, Sinniger V, Pellissier S. Vagus Nerve Stimulation at the Interface of Brain-Gut Interactions. Cold Spring Harb Perspect Med. 2019;9(8):a034199. doi: 10.1101/cshperspect.a034199 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Fujii T, Mashimo M, Moriwaki Y, Misawa H, Ono S, Horiguchi K, et al. Expression and Function of the Cholinergic System in Immune Cells. Front Immunol. 2017;8:1085. doi: 10.3389/fimmu.2017.01085 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Cox MA, Bassi C, Saunders ME, Nechanitzky R, Morgado-Palacin I, Zheng C, et al. Beyond neurotransmission: acetylcholine in immunity and inflammation. J Intern Med. 2020;287(2):120–33. doi: 10.1111/joim.13006 [DOI] [PubMed] [Google Scholar]
46.Gallowitsch-Puerta M, Tracey KJ. Immunologic role of the cholinergic anti-inflammatory pathway and the nicotinic acetylcholine alpha 7 receptor. Ann N Y Acad Sci. 2005;1062:209–19. doi: 10.1196/annals.1358.024 [DOI] [PubMed] [Google Scholar]
47.Udit S, Blake K, Chiu IM. Somatosensory and autonomic neuronal regulation of the immune response. Nat Rev Neurosci. 2022;23(3):157–71. doi: 10.1038/s41583-021-00555-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.McAllen RM, Cook AD, Khiew HW, Martelli D, Hamilton JA. The interface between cholinergic pathways and the immune system and its relevance to arthritis. Arthritis Res Ther. 2015;17(1):87. doi: 10.1186/s13075-015-0597-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Morales JY, Young-Stubbs CM, Shimoura CG, Kem WR, Uteshev VV, Mathis KW. Systemic Administration of α7-Nicotinic Acetylcholine Receptor Ligands Does Not Improve Renal Injury or Behavior in Mice With Advanced Systemic Lupus Erythematosus. Front Med (Lausanne). 2021;8:642960. doi: 10.3389/fmed.2021.642960 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Simon T, Kirk J, Dolezalova N, Guyot M, Panzolini C, Bondue A, et al. The cholinergic anti-inflammatory pathway inhibits inflammation without lymphocyte relay. Front Neurosci. 2023;17:1125492. doi: 10.3389/fnins.2023.1125492 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Kox M, Pompe JC, Gordinou de Gouberville MC, van der Hoeven JG, Hoedemaekers CW, Pickkers P. Effects of the α7 nicotinic acetylcholine receptor agonist GTS-21 on the innate immune response in humans. Shock. 2011;36(1):5–11. doi: 10.1097/SHK.0b013e3182168d56 [DOI] [PubMed] [Google Scholar]
52.Bratton BO, Martelli D, McKinley MJ, Trevaks D, Anderson CR, McAllen RM. Neural regulation of inflammation: no neural connection from the vagus to splenic sympathetic neurons. Exp Physiol. 2012;97(11):1180–5. doi: 10.1113/expphysiol.2011.061531 [DOI] [PubMed] [Google Scholar]
53.Vida G, Peña G, Deitch EA, Ulloa L. α7-cholinergic receptor mediates vagal induction of splenic norepinephrine. J Immunol. 2011;186(7):4340–6. doi: 10.4049/jimmunol.1003722 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Martelli D, McKinley MJ, McAllen RM. The cholinergic anti-inflammatory pathway: a critical review. Auton Neurosci. 2014;182:65–9. doi: 10.1016/j.autneu.2013.12.007 [DOI] [PubMed] [Google Scholar]
55.Mashimo M, Takeshima S, Okuyama H, Matsurida A, Murase M, Ono S, et al. α7 nAChRs expressed on antigen presenting cells are insensitive to the conventional antagonists α-bungarotoxin and methyllycaconitine. Int Immunopharmacol. 2020;81:106276. doi: 10.1016/j.intimp.2020.106276 [DOI] [PubMed] [Google Scholar]
56.Gaidhani N, Kem WR, Uteshev VV. Spleen is not required for therapeutic effects of 4OH-GTS-21, a selective α7 nAChR agonist, in the sub-acute phase of ischemic stroke in rats. Brain Res. 2021;1751:147196. doi: 10.1016/j.brainres.2020.147196 [DOI] [PubMed] [Google Scholar]
57.Nullens S, Staessens M, Peleman C, Schrijvers DM, Malhotra-Kumar S, Francque S, et al. Effect of GTS-21, an Alpha7 nicotinic acetylcholine receptor agonist, on clp-induced inflammatory, gastrointestinal motility, and colonic permeability changes in mice. Shock. 2016;45(4):450–9. doi: 10.1097/SHK.0000000000000519 [DOI] [PubMed] [Google Scholar]
58.Khan MAS, Farkhondeh M, Crombie J, Jacobson L, Kaneki M, Martyn JAJ. Lipopolysaccharide upregulates α7 acetylcholine receptors: stimulation with GTS-21 mitigates growth arrest of macrophages and improves survival in burned mice. Shock. 2012;38(2):213–9. doi: 10.1097/SHK.0b013e31825d628c [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Su X, Matthay MA, Malik AB. Requisite role of the cholinergic alpha7 nicotinic acetylcholine receptor pathway in suppressing Gram-negative sepsis-induced acute lung inflammatory injury. J Immunol. 2010;184(1):401–10. doi: 10.4049/jimmunol.0901808 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Leite PEC, Lagrota-Candido J, Moraes L, D’Elia L, Pinheiro DF, da Silva RF, et al. Nicotinic acetylcholine receptor activation reduces skeletal muscle inflammation of mdx mice. J Neuroimmunol. 2010;227(1–2):44–51. doi: 10.1016/j.jneuroim.2010.06.005 [DOI] [PubMed] [Google Scholar]
61.Hu S, Wang Y, Li H. The Regulation Effect of α7nAChRs and M1AChRs on Inflammation and Immunity in Sepsis. Mediators Inflamm. 2021;2021:9059601. doi: 10.1155/2021/9059601 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Herber DL, Severance EG, Cuevas J, Morgan D, Gordon MN. Biochemical and histochemical evidence of nonspecific binding of alpha7nAChR antibodies to mouse brain tissue. J Histochem Cytochem. 2004;52(10):1367–76. doi: 10.1177/002215540405201013 [DOI] [PubMed] [Google Scholar]
63.Rommel FR, Raghavan B, Paddenberg R, Kummer W, Tumala S, Lochnit G, et al. Suitability of Nicotinic Acetylcholine Receptor α7 and Muscarinic Acetylcholine Receptor 3 Antibodies for Immune Detection: Evaluation in Murine Skin. J Histochem Cytochem. 2015;63(5):329–39. doi: 10.1369/0022155415575028 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Garg BK, Loring RH. Evaluating Commercially Available Antibodies for Rat α7 Nicotinic Acetylcholine Receptors. J Histochem Cytochem. 2017;65(9):499–512. doi: 10.1369/0022155417725304 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Johansson ME, Ulleryd MA, Bernardi A, Lundberg AM, Andersson A, Folkersen L, et al. α7 Nicotinic acetylcholine receptor is expressed in human atherosclerosis and inhibits disease in mice--brief report. Arterioscler Thromb Vasc Biol. 2014;34(12):2632–6. doi: 10.1161/ATVBAHA.114.303892 [DOI] [PubMed] [Google Scholar]
66.Shelukhina IV, Kryukova EV, Lips KS, Tsetlin VI, Kummer W. Presence of alpha7 nicotinic acetylcholine receptors on dorsal root ganglion neurons proved using knockout mice and selective alpha-neurotoxins in histochemistry. J Neurochem. 2009;109(4):1087–95. doi: 10.1111/j.1471-4159.2009.06033.x [DOI] [PubMed] [Google Scholar]
67.van der Zanden EP, Hilbers FW, Verseijden C, van den Wijngaard RM, Skynner M, Lee K, et al. Nicotinic acetylcholine receptor expression and susceptibility to cholinergic immunomodulation in human monocytes of smoking individuals. Neuroimmunomodulation. 2012;19(4):255–65. doi: 10.1159/000335185 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Maldifassi MC, Martín-Sánchez C, Atienza G, Cedillo JL, Arnalich F, Bordas A, et al. Interaction of the α7-nicotinic subunit with its human-specific duplicated dupα7 isoform in mammalian cells: Relevance in human inflammatory responses. J Biol Chem. 2018;293(36):13874–88. doi: 10.1074/jbc.RA118.003443 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Teratani T, Mikami Y, Nakamoto N, Suzuki T, Harada Y, Okabayashi K, et al. The liver-brain-gut neural arc maintains the Treg cell niche in the gut. Nature. 2020;585(7826):591–6. doi: 10.1038/s41586-020-2425-3 [DOI] [PubMed] [Google Scholar]
70.Broide RS, Winzer-Serhan UH, Chen Y, Leslie FM. Distribution of α7 Nicotinic Acetylcholine Receptor Subunit mRNA in the Developing Mouse. Front Neuroanat. 2019;13:76. doi: 10.3389/fnana.2019.00076 [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Occhinegro A, McAllen RM, McKinley MJ, Martelli D. Acute Inhibition of Inflammation Mediated by Sympathetic Nerves: The Inflammatory Reflex. Neuroimmunomodulation. 2023;30(1):135–42. doi: 10.1159/000531469 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Salgado HC, Brognara F, Ribeiro AB, Lataro RM, Castania JA, Ulloa L, et al. Autonomic Regulation of Inflammation in Conscious Animals. Neuroimmunomodulation. 2023;30(1):102–12. doi: 10.1159/000530908 [DOI] [PubMed] [Google Scholar]
73.Dantzer R. Neuroimmune Interactions: From the Brain to the Immune System and Vice Versa. Physiol Rev. 2018;98(1):477–504. doi: 10.1152/physrev.00039.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Straub RH, Herrmann M, Berkmiller G, Frauenholz T, Lang B, Schölmerich J, et al. Neuronal regulation of interleukin 6 secretion in murine spleen: adrenergic and opioidergic control. J Neurochem. 1997;68(4):1633–9. doi: 10.1046/j.1471-4159.1997.68041633.x [DOI] [PubMed] [Google Scholar]
75.Caravaca AS, Gallina AL, Tarnawski L, Tracey KJ, Pavlov VA, Levine YA, et al. An Effective Method for Acute Vagus Nerve Stimulation in Experimental Inflammation. Front Neurosci. 2019;13:877. doi: 10.3389/fnins.2019.00877 [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Bob-Manuel J, Gautron L. Detection of G Protein-coupled Receptor Expression in Mouse Vagal Afferent Neurons using Multiplex In Situ Hybridization. J Vis Exp. 2021;(175):10.3791/62945. doi: 10.3791/62945 [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Gautron L, Lee C, Funahashi H, Friedman J, Lee S, Elmquist J. Melanocortin-4 receptor expression in a vago-vagal circuitry involved in postprandial functions. J Comp Neurol. 2010;518(1):6–24. doi: 10.1002/cne.22221 [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Thomsen MS, Mikkelsen JD. The α7 nicotinic acetylcholine receptor ligands methyllycaconitine, NS6740 and GTS-21 reduce lipopolysaccharide-induced TNF-α release from microglia. J Neuroimmunol. 2012;251(1–2):65–72. doi: 10.1016/j.jneuroim.2012.07.006 [DOI] [PubMed] [Google Scholar]
79.Zhang X, Lei B, Yuan Y, Zhang L, Hu L, Jin S, et al. Brain control of humoral immune responses amenable to behavioural modulation. Nature. 2020;581(7807):204–8. doi: 10.1038/s41586-020-2235-7 [DOI] [PubMed] [Google Scholar]
80.Mao D, Yasuda RP, Fan H, Wolfe BB, Kellar KJ. Heterogeneity of nicotinic cholinergic receptors in rat superior cervical and nodose Ganglia. Mol Pharmacol. 2006;70(5):1693–9. doi: 10.1124/mol.106.027458 [DOI] [PubMed] [Google Scholar]
81.Genzen JR, Van Cleve W, McGehee DS. Dorsal root ganglion neurons express multiple nicotinic acetylcholine receptor subtypes. J Neurophysiol. 2001;86(4):1773–82. doi: 10.1152/jn.2001.86.4.1773 [DOI] [PubMed] [Google Scholar]
82.Sapio MR, Vazquez FA, Loydpierson AJ, Maric D, Kim JJ, LaPaglia DM, et al. Comparative Analysis of Dorsal Root, Nodose and Sympathetic Ganglia for the Development of New Analgesics. Front Neurosci. 2020;14:615362. doi: 10.3389/fnins.2020.615362 [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Tabula Muris Consortium, Overall coordination, Logistical coordination, Organ collection and processing, Library preparation and sequencing, Computational data analysis, et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 2018;562(7727):367–72. doi: 10.1038/s41586-018-0590-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
84.GTEx Consortium, Laboratory, Data Analysis &Coordinating Center (LDACC)—Analysis Working Group, Statistical Methods groups—Analysis Working Group, Enhancing GTEx (eGTEx) groups, NIH Common Fund, NIH/NCI, et al. Genetic effects on gene expression across human tissues. Nature. 2017;550(7675):204–13. doi: 10.1038/nature24277 [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Pipes L, Li S, Bozinoski M, Palermo R, Peng X, Blood P, et al. The non-human primate reference transcriptome resource (NHPRTR) for comparative functional genomics. Nucleic Acids Res. 2013;41(Database issue):D906–14. doi: 10.1093/nar/gks1268 [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Schmiedel BJ, Singh D, Madrigal A, Valdovino-Gonzalez AG, White BM, Zapardiel-Gonzalo J, et al. Impact of Genetic Polymorphisms on Human Immune Cell Gene Expression. Cell. 2018;175(6):1701–1715.e16. doi: 10.1016/j.cell.2018.10.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Gautron L. The parasympathetic innervation of the spleen: are we chasing a ghost?. J Anat. 2022;240(4):772–4. doi: 10.1111/joa.13586 [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Brown TC, Bond CE, Hoover DB. Variable expression of GFP in different populations of peripheral cholinergic neurons of ChATBAC-eGFP transgenic mice. Auton Neurosci. 2018;210:44–54. doi: 10.1016/j.autneu.2017.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Cleypool CGJ, Mackaaij C, Verlinde-Schellekens SAMW, Bleys RLAW. A comparative anatomical and histological study on the presence of an apical splenic nerve in mice and humans. J Anat. 2022;240(2):296–304. doi: 10.1111/joa.13541 [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Verlinden TJM, van Dijk P, Hikspoors J, Herrler A, Lamers WH, Köhler SE. Innervation of the human spleen: A complete hilum-embedding approach. Brain Behav Immun. 2019;77:92–100. doi: 10.1016/j.bbi.2018.12.009 [DOI] [PubMed] [Google Scholar]
91.Murray K, Godinez DR, Brust-Mascher I, Miller EN, Gareau MG, Reardon C. Neuroanatomy of the spleen: Mapping the relationship between sympathetic neurons and lymphocytes. PLoS One. 2017;12(7):e0182416. doi: 10.1371/journal.pone.0182416 [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Cox MA, Duncan GS, Lin GHY, Steinberg BE, Yu LX, Brenner D, et al. Choline acetyltransferase-expressing T cells are required to control chronic viral infection. Science. 2019;363(6427):639–44. doi: 10.1126/science.aau9072 [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Vasamsetti SB, Florentin J, Coppin E, Stiekema LCA, Zheng KH, Nisar MU, et al. Sympathetic Neuronal Activation Triggers Myeloid Progenitor Proliferation and Differentiation. Immunity. 2018;49(1):93–106.e7. doi: 10.1016/j.immuni.2018.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Ağaç D, Gill MA, Farrar JD. Adrenergic Signaling at the Interface of Allergic Asthma and Viral Infections. Front Immunol. 2018;9:736. doi: 10.3389/fimmu.2018.00736 [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Wieduwild E, Girard-Madoux MJ, Quatrini L, Laprie C, Chasson L, Rossignol R, et al. β2-adrenergic signals downregulate the innate immune response and reduce host resistance to viral infection. J Exp Med. 2020;217(4):e20190554. doi: 10.1084/jem.20190554 [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Hasegawa S, Inoue T, Nakamura Y, Fukaya D, Uni R, Wu C-H, et al. Activation of Sympathetic Signaling in Macrophages Blocks Systemic Inflammation and Protects against Renal Ischemia-Reperfusion Injury. J Am Soc Nephrol. 2021;32(7):1599–615. doi: 10.1681/ASN.2020121723 [DOI] [PMC free article] [PubMed] [Google Scholar]
97.McKinley MJ, Martelli D, Trevizan-Baú P, McAllen RM. Divergent splanchnic sympathetic efferent nerve pathways regulate interleukin-10 and tumour necrosis factor-α responses to endotoxaemia. J Physiol. 2022;600(20):4521–36. doi: 10.1113/JP283217 [DOI] [PubMed] [Google Scholar]
98.Kizaki T, Shirato K, Sakurai T, Ogasawara J, Oh-ishi S, Matsuoka T, et al. Beta2-adrenergic receptor regulate Toll-like receptor 4-induced late-phase NF-kappaB activation. Mol Immunol. 2009;46(6):1195–203. doi: 10.1016/j.molimm.2008.11.005 [DOI] [PubMed] [Google Scholar]
99.Smith NJ, Hone AJ, Memon T, Bossi S, Smith TE, McIntosh JM, et al. Comparative functional expression of nAChR subtypes in rodent DRG neurons. Front Cell Neurosci. 2013;7:225. doi: 10.3389/fncel.2013.00225 [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Higashi H, Ueda N, Nishi S, Gallagher JP, Shinnick-Gallagher P. Chemoreceptors for serotonin (5-HT), acetylcholine (ACh), bradykinin (BK), histamine (H) and gamma-aminobutyric acid (GABA) on rabbit visceral afferent neurons. Brain Res Bull. 1982;8(1):23–32. doi: 10.1016/0361-9230(82)90023-5 [DOI] [PubMed] [Google Scholar]
101.Nervo A, Calas A-G, Nachon F, Krejci E. Respiratory failure triggered by cholinesterase inhibitors may involve activation of a reflex sensory pathway by acetylcholine spillover. Toxicology. 2019;424:152232. doi: 10.1016/j.tox.2019.06.003 [DOI] [PubMed] [Google Scholar]
102.Paintal BA. Impulses in vagal afferent fibres from specific pulmonary deflation receptors: the response of these receptors to phenyl diguanide, potato starch, 5-hydroxytryptamine and nicotine, and their rôle in respiratory and cardiovascular reflexes. Q J Exp Physiol Cogn Med Sci. 1955;40(2):89–111. doi: 10.1113/expphysiol.1955.sp001116 [DOI] [PubMed] [Google Scholar]
103.Komegae EN, Farmer DGS, Brooks VL, McKinley MJ, McAllen RM, Martelli D. Vagal afferent activation suppresses systemic inflammation via the splanchnic anti-inflammatory pathway. Brain Behav Immun. 2018;73:441–9. doi: 10.1016/j.bbi.2018.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
104.McAllen RM, McKinley MJ, Martelli D. Reflex regulation of systemic inflammation by the autonomic nervous system. Auton Neurosci. 2022;237:102926. doi: 10.1016/j.autneu.2021.102926 [DOI] [PubMed] [Google Scholar]
105.Martelli D, Farmer DGS, McKinley MJ, Yao ST, McAllen RM. Anti-inflammatory reflex action of splanchnic sympathetic nerves is distributed across abdominal organs. Am J Physiol Regul Integr Comp Physiol. 2019;316(3):R235–42. doi: 10.1152/ajpregu.00298.2018 [DOI] [PubMed] [Google Scholar]
106.Martelli D, Yao ST, McKinley MJ, McAllen RM. Reflex control of inflammation by sympathetic nerves, not the vagus. J Physiol. 2014;592(7):1677–86. doi: 10.1113/jphysiol.2013.268573 [DOI] [PMC free article] [PubMed] [Google Scholar]
107.Martelli D, Farmer DGS, Yao ST. The splanchnic anti-inflammatory pathway: could it be the efferent arm of the inflammatory reflex?. Exp Physiol. 2016;101(10):1245–52. doi: 10.1113/EP085559 [DOI] [PubMed] [Google Scholar]
108.Martelli D, Yao ST, McKinley MJ, McAllen RM. Neural control of inflammation by the greater splanchnic nerves. Temperature (Austin). 2014;1(1):14–5. doi: 10.4161/temp.29135 [DOI] [PMC free article] [PubMed] [Google Scholar]
109.Nance DM, Sanders VM. Autonomic innervation and regulation of the immune system (1987-2007). Brain Behav Immun. 2007;21(6):736–45. doi: 10.1016/j.bbi.2007.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
110.Besedovsky HO, del Rey A, Sorkin E, Burri R, Honegger CG, Schlumpf M, et al. T lymphocytes affect the development of sympathetic innervation of mouse spleen. Brain Behav Immun. 1987;1(2):185–93. doi: 10.1016/0889-1591(87)90020-1 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0331707.r001

Decision Letter 0

Yoshihiko Kakinuma

6 May 2025

PONE-D-25-18446 The Molecular Components of The Anti-Inflammatory Cholinergic Pathway Are Extrasplenic PLOS ONE

Dear Dr. Gautron,

Please submit your revised manuscript by Jun 20 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yoshihiko Kakinuma, M.D., Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. Thank you for stating the following financial disclosure:

“LG: NIH P01DK119130 (CNS mechanisms linking exercise training with energy balance and metabolism, Core C). “

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“The NIH grant P01DK119130 (CNS mechanisms linking exercise training with energy balance and metabolism, Core C). The Zeiss LSM880 with Airyscan was purchased with a Shared Instrumentation grant from NIH award 1S10OD021684-01 to Katherine Luby Phelps (UTSW). We are grateful to Jenny Lee for her assistance with RNAscope studies in the early phase of this project. This basic research study was not pre-registered.”

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“LG: NIH P01DK119130 (CNS mechanisms linking exercise training with energy balance and metabolism, Core C). “

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Additional Editor Comments:

The manuscript has been reviewed by two referees, both of which request to revise it in terms of each comments and critisism. They specifically address the request to re-evaluate the accuracy regarding the conclusion. Since the spleen does neither express Chat mRNA nor alpha7 nAChR at all in residential immune cells, and therefore, it should be logical that ACh does not come from the spleen, rather from the vagus nerve. However, if so, vagus nerve stimulation may elevate local AChs in several tissues other than the spleen; moreover, even the splenectomized mice subjected to LPS load could be rescued by the stimulation as well as non-splenectomized mice. Based on referees' and editor's comments they need to conduct another experiment in order to consolidate their speculation and conclusion.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript is well written. Data are clear. This reviewer has a few comments on this manuscript.

The authors proposed the alternative model of the anti-inflammatory cholinergic pathway (shown in Figure 9) based on their mRNA expression data alone. Since no functional investigations were performed, the discussion section appears a bit speculative.

The conclusions are based solely on mRNA expression data. Since detectable mRNA levels do not always correlate with protein abundance, it would be interesting to assess protein expression to strengthen the authors’ proposal.

Reviewer #2: The author concerned anti-inflammatory cholinergic pathway interacted between cholinergic vagal nerves and splenic immune cells so they proposed a new model of the cholinergic anti-

inflammatory pathway that highlights the roles of extrasplenic cholinergic signaling. This is a very interesting paper but there are major issues as shown below.

Major points

The manuscript needs to be reorganized and rewritten to ensure logical and appropriate placement of all content. Some information is presented in inappropriate sections while missing from where it would be most relevant.

The descriptions of statistical analysis are very poor. The information of statistical analysis is need to provide evidence of statistical significance (determination of p-value, F-value, main effect, interaction, etc.) in the methods and the result sections not in the figure legend.

The manuscript lacks logical coherence in the conclusion and the experimental results are not discussed in sufficient depth to support the conclusions. For example, what mechanism about LPS-induced decreasing of the Adrb2 mRNA expression in the brainstem and spleen? The interpretation of the results is needed in the discussion section. There is insufficient interpretation or inference based on the presented data in the discussion section. It might be helpful to rewrite the section by linking each experimental result with previous reports to build a logical hypothesis, and then summarize the overall findings using Figures 8 and 9 in the discussion section.

Only findings from present study should be described in the conclusions and references may be avoided in the conclusion section.

The description in the figure 8 lacks of specific explanation each figure (A-E). Readers need more details of the figure not URL.

Some of the description in the figure 9 is not the explanation of the figure. The author should reorganize the figure legend.

LPS-induced decreasing gene expression of Adrb2 in the brainstem and spleen were well established by qPCR analysis in wild type mice. Several experiments are needed to explain that Chrna7 and Chat mRNA expression is not influenced by LPS injection (several dose of LPS and long-time course).

Fluorescent RNAScope assays revealed that the expression of Chrna7 using is restricted to neurons. The expression of Chrna7 in the afferent neurons is very interesting, so the description of Chrna7 mRNA expression in the vagal and spinal afferent neuron and the involvement of these neurons in the anti-inflammatory pathway is need in the discussion section.

In the result section about the figure 5, the description “the expression of Chrna7 mRNA in the spleen was not significantly different between genotypes, we concluded low levels of Chrna7 in the spleen are attribute to a slight sample contamination during dissection an/or tissue processing.” is inappropriate. What means sample contamination? The phrases impress reduced reliability of the experimental data. I recommend verifying reproducibility with large sample size of mice.

The expression of Chrna7 is not detected by using RNAScope assay, so the reason about this discrepancy is needed in the discussion.

Minor points

How about ChAT-positive cell body in the nodose ganglion?

In the figure 6, the authors did not mention the ChAT-positive neuronal cell body may be exist in the nodose ganglion. To ensure the validity of the study, it should be mentioned in the result section.

According to submission guideline, in the text, the reference number cite in square brackets (e.g., “We used the techniques developed by our colleagues [19] to analyze the data”). You must change the description of the reference number.

The words “vagal afferents” is not suitable, so change to “vagal afferent neurons” in the line 199.

In the legend of Figure 6, what is mean of the description “saline and LPS”?

Some description in the figure legend contains the appropriate content for the methods, so move and rewrite in the appropriate section.

The word “mRNA” is mentioned in the description about data from qPCR and RNA scope.

Change “Chrn7” to “Chrna7” in the page18, line379, 381, 383, 386, 387, 386.

Change “microscopy” to “microscopic analysis” in the page18 line392.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2025 Sep 5;20(9):e0331707. doi: 10.1371/journal.pone.0331707.r002

Author response to Decision Letter 1

10 Jul 2025

Reviewer #1: The manuscript is well written. Data are clear. This reviewer has a few comments on this manuscript.

Answer: Thank you for the helpful and constructive feedback. We agree that our discussion was too speculative and wordy. Therefore, we revised it to remove entirely the speculative parts not directly linked to our own data.

Answer: We appreciate the suggestion to assess the α7 nicotinic acetylcholine receptor (α7 nAChR) protein. While this would indeed be of interest, to our knowledge, there are currently no specific and well-characterized antibodies available for this receptor. Unfortunately, the reliability of most commercially available antibodies targeting G protein-coupled receptors (GPCRs), including α7, remains a significant concern. This issue has been extensively documented by us and others in the field (see PMID: 37264690; 31080409). ChAT protein has been examined in the past by many investigators in the past and we do not wish to repeat this information. While there are reliable antibodies against ChAT, immunodetection of ChAT remains challenging, which is also an issue we discussed in detail in the past (PMID: 23749724; 34729780). In other words, we feel strongly that examining proteins is simply not feasible now.

Reviewer #2: The author concerned anti-inflammatory cholinergic pathway interacted between cholinergic vagal nerves and splenic immune cells so they proposed a new model of the cholinergic anti-

inflammatory pathway that highlights the roles of extrasplenic cholinergic signaling. This is a very interesting paper but there are major issues as shown below.

Answer: Thank you for the helpful and constructive feedback. We addressed your concerns to the further extent possible as explained below. In particular, we extensively revised our discussion which both reviewers found too speculative.

Major points

Answer: We apologize for the lack of clarity. Please find a revised manuscript which hopefully addresses your concerns (see below for details).

Answer: We agree to reorganize our results according to reviewer #2’s comments. Results with statistics were moved from legends to the main manuscript. We are grateful to Reviewer #2 for pointing out the issues.

Answer: We agree and our revised manuscript discusses potential mechanisms through which LPS regulated Adrb2 based on the available literature (see PMID: 19167076; see also our revised discussion).

It might be helpful to rewrite the section by linking each experimental result with previous reports to build a logical hypothesis, and then summarize the overall findings using Figures 8 and 9 in the discussion section.

Answer: Our manuscript was revised to be clearer, less speculative, and more logical.

Only findings from present study should be described in the conclusions and references may be avoided in the conclusion section.

Answer: We extensively revised our discussion to focus on our own findings as suggested by Reviewer #2.

The description in the figure 8 lacks of specific explanation each figure (A-E). Readers need more details of the figure not URL.

Answer: We agree and we revised figure 8 accordingly.

Some of the description in the figure 9 is not the explanation of the figure. The author should reorganize the figure legend.

Answer: We agree and we revised figure 9 accordingly.

Answer: Given that the anti-inflammatory effects of vagus nerve stimulation (VNS) manifest rapidly—typically within minutes to a few hours—we did not deem it necessary to assess the time course of Chrna7 expression over an extended period. The time point selected in our study (1.5 hours post-LPS) aligns with that used in the seminal work describing the cholinergic anti-inflammatory reflex (2 hours post-LPS; PMID: 12508119). Furthermore, it is important to note that multiple studies have demonstrated that VNS can suppress inflammation when applied prior to LPS administration (see discussion in PMID: 30396599). This strongly suggests that Chrna7 and Chat must already be expressed prior to immune challenge. Cells expressing α7 nicotinic receptors and capable of releasing acetylcholine are therefore expected to be present at baseline, before LPS administration.

Importantly, the anti-inflammatory cholinergic pathway was originally described using a much lower dose of LPS (0.1 mg/kg, i.p.) by Wang et al. (PMID: 12508119). Therefore, it is unlikely that the moderate LPS dose (1 mg/kg, i.p.) used in our experiments was insufficient to induce Chat expression in the spleen. However, we agree that it is scientifically relevant to explore whether a very high dose of LPS could influence Chat expression. To address this point, we conducted additional qPCR control experiments using a very high LPS dose (see new supplementary data). Notably, Chat remained undetectable regardless of the dosage.

Answer: We agree with the reviewer. We hope that our revised version discusses in enough detail the issue of neuronal Chrna7.

Answer: We apologize for our poor choice of words (e.g. contamination). We rewrote our text to avoid further confusion. We did not mean to say that our samples were technically “contaminated”, but that residual Chrna7 detection by qPCR may be due to a very small number of cells that are not undetectable by histology.

Minor points

How about ChAT-positive cell body in the nodose ganglion? In the figure 6, the authors did not mention the ChAT-positive neuronal cell body may be exist in the nodose ganglion. To ensure the validity of the study, it should be mentioned in the result section.

Answer: This is a good question. As noted in our Chat-GFP data, we did not see any Chat-positive cell bodies in the nodose ganglion, but only axons. This is now better explained in our revision.

We modified the formatting of our references.

The words “vagal afferents” is not suitable, so change to “vagal afferent neurons” in the line 199.

Answer: We agree and modified our text.

In the legend of Figure 6, what is mean of the description “saline and LPS”?

Answer: We apologize for the mistake and modified the manuscript.

Some description in the figure legend contains the appropriate content for the methods, so move and rewrite in the appropriate section.

Answer: We modified our text.

The word “mRNA” is mentioned in the description about data from qPCR and RNA scope.

Answer: We agree and modified our text.

Change “Chrn7” to “Chrna7” in the page18, line379, 381, 383, 386, 387, 386.

Answer: Thank you for catching these errors. We corrected our text.

Change “microscopy” to “microscopic analysis” in the page18 line392.

Answer: We agree and modified our text.

Attachment

Submitted filename: rebuttal.docx

pone.0331707.s003.docx^{(23.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0331707.r003

Decision Letter 1

Yoshihiko Kakinuma

29 Jul 2025

PONE-D-25-18446R1 The Molecular Components of The Anti-Inflammatory Cholinergic Pathway Are Extrasplenic PLOS ONE

Dear Dr. Gautron,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a minorly revised version of the manuscript that addresses the points raised during the review process. The authors have almost revised original version according to the referees suggestion. however, they have left several points unrevised despite the Referee 2 concerns., especially, 1) p values in figure legends depicted by asterisk not yet added, 2) references in the conclusion sentence, and 3) several typos in methods (Line 86, 131, and 246 in the revised version). Therefore, they need to revise them.

Please submit your revised manuscript by Sep 12 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Yoshihiko Kakinuma, M.D., Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The authors extensively revised the original manuscript based on the referees comments, and the speculative parts are fully revised. However, several parts which the referee pointed out are left not revised. Moreover, several typos have been still observed. For example, 1) Line 86, "since all our procedures were terminal. are listed". Does this mean that "since our procedures were terminal and are listed"?; 2) Line 131, "Prevalidated taqman assays were Mm01317884_ml (Chrna7)" Does this mean that "Prevalidated Taqman assays were performed using primers of Mm01317884_ml (Chrna7)"?; 3) Line 246, "(72)" should be altered to [72]. In addition, the authors need to re-revise the manuscript under the consideration of the referee 2 suggestions including statistical explanation in figure legends (p values) and deletion of references in a conclusion sentences.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Although this reviewer still has an interest in the protein expression, this reviewer understood the author's concerns regarding antibodies.

This reviewer considers the current version of the manuscript to be acceptable for publication.

Reviewer #2: Comments to the Author

The authors have addressed majority of the concerns and the manuscript is substantially improved. I especially appreciate the manuscript was revised according to our concerns.

There are several concerns remaining:

Major points

As I mentioned in my previous comment, it seems that it has not been fully understood. The following two points are presented below.

1. The author must read “PLOS ONE Statistical Reporting Guidelines“ carefully and revise the statistical analysis in the material and method, results and figure legend. Information about which statistical methods were used for which data, and which parameters were used to assess the effects with ANOVA, should be described in the methods section. Although statistical results are revised and presented in the results section, the definition of asterisks should be included in the figure legend.

2. Descriptions of inferences and interpretations are not appropriate for the results section. Please move these statements found in the results section to the discussion section. The results section should contain only the results and no other content.

Minor points

As I mentioned before, citations are not necessary in the Conclusion section.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

PLoS One. 2025 Sep 5;20(9):e0331707. doi: 10.1371/journal.pone.0331707.r004

Author response to Decision Letter 2

13 Aug 2025

Response letter

“The authors have almost revised original version according to the referees suggestion. however,

they have left several points unrevised despite the Referee 2 concerns., especially, 1) p values in figure legends depicted by asterisk not yet added, 2) references in the conclusion sentence, and 3) several typos in methods (Line 86, 131, and 246 in the revised version). Therefore, they need to revise them.”

“Additional Editor Comments:

Dear editors,

We addressed previously raised concerns as explained below. Changes are marked-up in our revised manuscript. All typos were corrected. In addition, P values corresponding to the asterisks in each graph were added to the legends.

“Review Comments to the Author

Reviewer #1: Although this reviewer still has an interest in the protein expression, this reviewer understood the author's concerns regarding antibodies.

This reviewer considers the current version of the manuscript to be acceptable for publication.

We thank Reviewer 1 for his/her helpful comments throughout the revision process.

Reviewer #2: Comments to the Author

The authors have addressed majority of the concerns and the manuscript is substantially improved. I especially appreciate the manuscript was revised according to our concerns.

We thank Reviewer 2 for his/her helpful comments throughout the revision process.

There are several concerns remaining:

Major points

As I mentioned in my previous comment, it seems that it has not been fully understood. The following two points are presented below.

As requested by reviewer 2, we added a section describing our statistical reporting.

We deleted interpretations and comments from the results sections whenever appropriate.

Minor points

As I mentioned before, citations are not necessary in the Conclusion section.”

We apologize for the misunderstanding. We have removed the citations included in the conclusion sentence.

Attachment

Submitted filename: Response to Reviewers.docx

pone.0331707.s004.docx^{(15.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0331707.r005

Decision Letter 2

Yoshihiko Kakinuma

20 Aug 2025

The Molecular Components of The Anti-Inflammatory Cholinergic Pathway Are Extrasplenic

PONE-D-25-18446R2

Dear Dr. Laurent Gautron,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yoshihiko Kakinuma, M.D., Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewer 1 has already recommended 'accept', after evaluating the 1st revised manuscript. On the other hand, the Reviewer 2 has recognized that the 2nd revised manuscript is suitable for 'accept'.

Based on the two reviewers' comments, the authors have addressed almost all comments and concerns from reviewers. Therefore, nothing has been left for further evaluation.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0331707.r006

Acceptance letter

Yoshihiko Kakinuma

PONE-D-25-18446R2

PLOS ONE

Dear Dr. Gautron,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Yoshihiko Kakinuma

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Table of qPCR data.

(DOCX)

pone.0331707.s001.docx^{(15.1KB, docx)}

Attachment

Submitted filename: rebuttal.docx

pone.0331707.s003.docx^{(23.3KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0331707.s004.docx^{(15.5KB, docx)}

Data Availability Statement

All relevant data are within the manuscript.

[pone.0331707.ref001] 1.Somann JP, Wasilczuk KM, Neihouser KV, Sturgis J, Albors GO, Robinson JP, et al. Characterization of plasma cytokine response to intraperitoneally administered LPS & subdiaphragmatic branch vagus nerve stimulation in rat model. PLoS One. 2019;14(3):e0214317. doi: 10.1371/journal.pone.0214317 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref002] 2.Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, et al. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 2000;405(6785):458–62. doi: 10.1038/35013070 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref003] 3.Huston JM, Ochani M, Rosas-Ballina M, Liao H, Ochani K, Pavlov VA, et al. Splenectomy inactivates the cholinergic antiinflammatory pathway during lethal endotoxemia and polymicrobial sepsis. J Exp Med. 2006;203(7):1623–8. doi: 10.1084/jem.20052362 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref004] 4.van Westerloo DJ, Giebelen IAJ, Meijers JCM, Daalhuisen J, de Vos AF, Levi M, et al. Vagus nerve stimulation inhibits activation of coagulation and fibrinolysis during endotoxemia in rats. J Thromb Haemost. 2006;4(9):1997–2002. doi: 10.1111/j.1538-7836.2006.02112.x [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref005] 5.Bosmans G, Appeltans I, Stakenborg N, Gomez-Pinilla PJ, Florens MV, Aguilera-Lizarraga J, et al. Vagus nerve stimulation dampens intestinal inflammation in a murine model of experimental food allergy. Allergy. 2019;74(9):1748–59. doi: 10.1111/all.13790 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref006] 6.Guyot M, Simon T, Panzolini C, Ceppo F, Daoudlarian D, Murris E, et al. Apical splenic nerve electrical stimulation discloses an anti-inflammatory pathway relying on adrenergic and nicotinic receptors in myeloid cells. Brain Behav Immun. 2019;80:238–46. doi: 10.1016/j.bbi.2019.03.015 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref007] 7.Stakenborg N, Gomez-Pinilla PJ, Verlinden TJM, Wolthuis AM, D’Hoore A, Farré R, et al. Comparison between the cervical and abdominal vagus nerves in mice, pigs, and humans. Neurogastroenterol Motil. 2020;32(9):e13889. doi: 10.1111/nmo.13889 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref008] 8.Vida G, Peña G, Kanashiro A, Thompson-Bonilla M del R, Palange D, Deitch EA, et al. β2-Adrenoreceptors of regulatory lymphocytes are essential for vagal neuromodulation of the innate immune system. FASEB J. 2011;25(12):4476–85. doi: 10.1096/fj.11-191007 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref009] 9.Cailotto C, Gomez-Pinilla PJ, Costes LM, van der Vliet J, Di Giovangiulio M, Némethova A, et al. Neuro-anatomical evidence indicating indirect modulation of macrophages by vagal efferents in the intestine but not in the spleen. PLoS One. 2014;9(1):e87785. doi: 10.1371/journal.pone.0087785 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref010] 10.Matteoli G, Gomez-Pinilla PJ, Nemethova A, Di Giovangiulio M, Cailotto C, van Bree SH, et al. A distinct vagal anti-inflammatory pathway modulates intestinal muscularis resident macrophages independent of the spleen. Gut. 2014;63(6):938–48. doi: 10.1136/gutjnl-2013-304676 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref011] 11.Bassi GS, Kanashiro A, Coimbra NC, Terrando N, Maixner W, Ulloa L. Anatomical and clinical implications of vagal modulation of the spleen. Neurosci Biobehav Rev. 2020;112:363–73. doi: 10.1016/j.neubiorev.2020.02.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref012] 12.Rana M, Fei-Bloom Y, Son M, La Bella A, Ochani M, Levine YA, et al. Constitutive Vagus Nerve Activation Modulates Immune Suppression in Sepsis Survivors. Front Immunol. 2018;9:2032. doi: 10.3389/fimmu.2018.02032 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref013] 13.Chavan SS, Pavlov VA, Tracey KJ. Mechanisms and Therapeutic Relevance of Neuro-immune Communication. Immunity. 2017;46(6):927–42. doi: 10.1016/j.immuni.2017.06.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref014] 14.Rosas-Ballina M, Olofsson PS, Ochani M, Valdés-Ferrer SI, Levine YA, Reardon C, et al. Acetylcholine-synthesizing T cells relay neural signals in a vagus nerve circuit. Science. 2011;334(6052):98–101. doi: 10.1126/science.1209985 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref015] 15.Murray K, Rude KM, Sladek J, Reardon C. Divergence of neuroimmune circuits activated by afferent and efferent vagal nerve stimulation in the regulation of inflammation. J Physiol. 2021;599(7):2075–84. doi: 10.1113/JP281189 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref016] 16.Gautron L, Rutkowski JM, Burton MD, Wei W, Wan Y, Elmquist JK. Neuronal and nonneuronal cholinergic structures in the mouse gastrointestinal tract and spleen. J Comp Neurol. 2013;521(16):3741–67. doi: 10.1002/cne.23376 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref017] 17.Pavlov VA, Parrish WR, Rosas-Ballina M, Ochani M, Puerta M, Ochani K, et al. Brain acetylcholinesterase activity controls systemic cytokine levels through the cholinergic anti-inflammatory pathway. Brain Behav Immun. 2009;23(1):41–5. doi: 10.1016/j.bbi.2008.06.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref018] 18.Qian J, Galitovskiy V, Chernyavsky AI, Marchenko S, Grando SA. Plasticity of the murine spleen T-cell cholinergic receptors and their role in in vitro differentiation of naïve CD4 T cells toward the Th1, Th2 and Th17 lineages. Genes Immun. 2011;12(3):222–30. doi: 10.1038/gene.2010.72 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref019] 19.Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, et al. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature. 2003;421(6921):384–8. doi: 10.1038/nature01339 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref020] 20.Downs AM, Bond CE, Hoover DB. Localization of α7 nicotinic acetylcholine receptor mRNA and protein within the cholinergic anti-inflammatory pathway. Neuroscience. 2014;266:178–85. doi: 10.1016/j.neuroscience.2014.02.011 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref021] 21.Villiger Y, Szanto I, Jaconi S, Blanchet C, Buisson B, Krause K-H, et al. Expression of an alpha7 duplicate nicotinic acetylcholine receptor-related protein in human leukocytes. J Neuroimmunol. 2002;126(1–2):86–98. doi: 10.1016/s0165-5728(02)00057-7 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref022] 22.Benfante R, Antonini RA, De Pizzol M, Gotti C, Clementi F, Locati M, et al. Expression of the α7 nAChR subunit duplicate form (CHRFAM7A) is down-regulated in the monocytic cell line THP-1 on treatment with LPS. J Neuroimmunol. 2011;230(1–2):74–84. doi: 10.1016/j.jneuroim.2010.09.008 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref023] 23.Hoover DB, Poston MD, Brown S, Lawson SE, Bond CE, Downs AM, et al. Cholinergic leukocytes in sepsis and at the neuroimmune junction in the spleen. Int Immunopharmacol. 2020;81:106359. doi: 10.1016/j.intimp.2020.106359 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref024] 24.Costantini TW, Chan TW, Cohen O, Langness S, Treadwell S, Williams E, et al. Uniquely human CHRFAM7A gene increases the hematopoietic stem cell reservoir in mice and amplifies their inflammatory response. Proc Natl Acad Sci U S A. 2019;116(16):7932–40. doi: 10.1073/pnas.1821853116 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref025] 25.Zanetti SR, Ziblat A, Torres NI, Zwirner NW, Bouzat C. Expression and Functional Role of α7 Nicotinic Receptor in Human Cytokine-stimulated Natural Killer (NK) Cells. J Biol Chem. 2016;291(32):16541–52. doi: 10.1074/jbc.M115.710574 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref026] 26.Garg BK, Loring RH. GTS-21 has cell-specific anti-inflammatory effects independent of α7 nicotinic acetylcholine receptors. PLoS One. 2019;14(4):e0214942. doi: 10.1371/journal.pone.0214942 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref027] 27.Cedillo JL, Arnalich F, Martín-Sánchez C, Quesada A, Rios JJ, Maldifassi MC, et al. Usefulness of α7 nicotinic receptor messenger RNA levels in peripheral blood mononuclear cells as a marker for cholinergic antiinflammatory pathway activity in septic patients: results of a pilot study. J Infect Dis. 2015;211(1):146–55. doi: 10.1093/infdis/jiu425 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref028] 28.Gahring LC, Myers EJ, Dunn DM, Weiss RB, Rogers SW. Nicotinic alpha 7 receptor expression and modulation of the lung epithelial response to lipopolysaccharide. PLoS One. 2017;12(4):e0175367. doi: 10.1371/journal.pone.0175367 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref029] 29.Qi Y, Si D, Zhu L, Qi Y, Wu Z, Chen D, et al. High-fat diet-induced obesity affects alpha 7 nicotine acetylcholine receptor expressions in mouse lung myeloid cells. Sci Rep. 2020;10(1):18368. doi: 10.1038/s41598-020-75414-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref030] 30.Olofsson PS, Katz DA, Rosas-Ballina M, Levine YA, Ochani M, Valdés-Ferrer SI, et al. α7 nicotinic acetylcholine receptor (α7nAChR) expression in bone marrow-derived non-T cells is required for the inflammatory reflex. Mol Med. 2012;18(1):539–43. doi: 10.2119/molmed.2011.00405 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref031] 31.Pavlov VA, Ochani M, Yang L-H, Gallowitsch-Puerta M, Ochani K, Lin X, et al. Selective alpha7-nicotinic acetylcholine receptor agonist GTS-21 improves survival in murine endotoxemia and severe sepsis. Crit Care Med. 2007;35(4):1139–44. doi: 10.1097/01.CCM.0000259381.56526.96 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref032] 32.Hamano R, Takahashi HK, Iwagaki H, Yoshino T, Nishibori M, Tanaka N. Stimulation of alpha7 nicotinic acetylcholine receptor inhibits CD14 and the toll-like receptor 4 expression in human monocytes. Shock. 2006;26(4):358–64. doi: 10.1097/01.shk.0000228168.86845.60 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref033] 33.Godin J-R, Roy P, Quadri M, Bagdas D, Toma W, Narendrula-Kotha R, et al. A silent agonist of α7 nicotinic acetylcholine receptors modulates inflammation ex vivo and attenuates EAE. Brain Behav Immun. 2020;87:286–300. doi: 10.1016/j.bbi.2019.12.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref034] 34.Bernik TR, Friedman SG, Ochani M, DiRaimo R, Susarla S, Czura CJ, et al. Cholinergic antiinflammatory pathway inhibition of tumor necrosis factor during ischemia reperfusion. J Vasc Surg. 2002;36(6):1231–6. doi: 10.1067/mva.2002.129643 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref035] 35.Mizrachi T, Marsha O, Brusin K, Ben-David Y, Thakur GA, Vaknin-Dembinsky A, et al. Suppression of neuroinflammation by an allosteric agonist and positive allosteric modulator of the α7 nicotinic acetylcholine receptor GAT107. J Neuroinflammation. 2021;18(1):99. doi: 10.1186/s12974-021-02149-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref036] 36.Ulleryd MA, Mjörnstedt F, Panagaki D, Yang LJ, Engevall K, Gutiérrez S, et al. Stimulation of alpha 7 nicotinic acetylcholine receptor (α7nAChR) inhibits atherosclerosis via immunomodulatory effects on myeloid cells. Atherosclerosis. 2019;287:122–33. doi: 10.1016/j.atherosclerosis.2019.06.903 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref037] 37.Lee RH, Vazquez G. Evidence for a prosurvival role of alpha-7 nicotinic acetylcholine receptor in alternatively (M2)-activated macrophages. Physiol Rep. 2013;1(7):e00189. doi: 10.1002/phy2.189 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref038] 38.Wu J, Jiao Z-Y, Li R-Z, Lu H-L, Zhang H-H, Cianflone K. Cholinergic activation suppresses palmitate-induced macrophage activation and improves acylation stimulating protein resistance in co-cultured adipocytes. Exp Biol Med (Maywood). 2017;242(9):961–73. doi: 10.1177/1535370217700522 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref039] 39.Rosas-Ballina M, Goldstein RS, Gallowitsch-Puerta M, Yang L, Valdés-Ferrer SI, Patel NB, et al. The selective alpha7 agonist GTS-21 attenuates cytokine production in human whole blood and human monocytes activated by ligands for TLR2, TLR3, TLR4, TLR9, and RAGE. Mol Med. 2009;15(7–8):195–202. doi: 10.2119/molmed.2009.00039 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref040] 40.Hodo TW, de Aquino MTP, Shimamoto A, Shanker A. Critical Neurotransmitters in the Neuroimmune Network. Front Immunol. 2020;11:1869. doi: 10.3389/fimmu.2020.01869 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref041] 41.Jarczyk J, Yard BA, Hoeger S. The Cholinergic Anti-Inflammatory Pathway as a Conceptual Framework to Treat Inflammation-Mediated Renal Injury. Kidney Blood Press Res. 2019;44(4):435–48. doi: 10.1159/000500920 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref042] 42.Wu Y-J, Wang L, Ji C-F, Gu S-F, Yin Q, Zuo J. The Role of α7nAChR-Mediated Cholinergic Anti-inflammatory Pathway in Immune Cells. Inflammation. 2021;44(3):821–34. doi: 10.1007/s10753-020-01396-6 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref043] 43.Bonaz B, Sinniger V, Pellissier S. Vagus Nerve Stimulation at the Interface of Brain-Gut Interactions. Cold Spring Harb Perspect Med. 2019;9(8):a034199. doi: 10.1101/cshperspect.a034199 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref044] 44.Fujii T, Mashimo M, Moriwaki Y, Misawa H, Ono S, Horiguchi K, et al. Expression and Function of the Cholinergic System in Immune Cells. Front Immunol. 2017;8:1085. doi: 10.3389/fimmu.2017.01085 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref045] 45.Cox MA, Bassi C, Saunders ME, Nechanitzky R, Morgado-Palacin I, Zheng C, et al. Beyond neurotransmission: acetylcholine in immunity and inflammation. J Intern Med. 2020;287(2):120–33. doi: 10.1111/joim.13006 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref046] 46.Gallowitsch-Puerta M, Tracey KJ. Immunologic role of the cholinergic anti-inflammatory pathway and the nicotinic acetylcholine alpha 7 receptor. Ann N Y Acad Sci. 2005;1062:209–19. doi: 10.1196/annals.1358.024 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref047] 47.Udit S, Blake K, Chiu IM. Somatosensory and autonomic neuronal regulation of the immune response. Nat Rev Neurosci. 2022;23(3):157–71. doi: 10.1038/s41583-021-00555-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref048] 48.McAllen RM, Cook AD, Khiew HW, Martelli D, Hamilton JA. The interface between cholinergic pathways and the immune system and its relevance to arthritis. Arthritis Res Ther. 2015;17(1):87. doi: 10.1186/s13075-015-0597-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref049] 49.Morales JY, Young-Stubbs CM, Shimoura CG, Kem WR, Uteshev VV, Mathis KW. Systemic Administration of α7-Nicotinic Acetylcholine Receptor Ligands Does Not Improve Renal Injury or Behavior in Mice With Advanced Systemic Lupus Erythematosus. Front Med (Lausanne). 2021;8:642960. doi: 10.3389/fmed.2021.642960 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref050] 50.Simon T, Kirk J, Dolezalova N, Guyot M, Panzolini C, Bondue A, et al. The cholinergic anti-inflammatory pathway inhibits inflammation without lymphocyte relay. Front Neurosci. 2023;17:1125492. doi: 10.3389/fnins.2023.1125492 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref051] 51.Kox M, Pompe JC, Gordinou de Gouberville MC, van der Hoeven JG, Hoedemaekers CW, Pickkers P. Effects of the α7 nicotinic acetylcholine receptor agonist GTS-21 on the innate immune response in humans. Shock. 2011;36(1):5–11. doi: 10.1097/SHK.0b013e3182168d56 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref052] 52.Bratton BO, Martelli D, McKinley MJ, Trevaks D, Anderson CR, McAllen RM. Neural regulation of inflammation: no neural connection from the vagus to splenic sympathetic neurons. Exp Physiol. 2012;97(11):1180–5. doi: 10.1113/expphysiol.2011.061531 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref053] 53.Vida G, Peña G, Deitch EA, Ulloa L. α7-cholinergic receptor mediates vagal induction of splenic norepinephrine. J Immunol. 2011;186(7):4340–6. doi: 10.4049/jimmunol.1003722 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref054] 54.Martelli D, McKinley MJ, McAllen RM. The cholinergic anti-inflammatory pathway: a critical review. Auton Neurosci. 2014;182:65–9. doi: 10.1016/j.autneu.2013.12.007 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref055] 55.Mashimo M, Takeshima S, Okuyama H, Matsurida A, Murase M, Ono S, et al. α7 nAChRs expressed on antigen presenting cells are insensitive to the conventional antagonists α-bungarotoxin and methyllycaconitine. Int Immunopharmacol. 2020;81:106276. doi: 10.1016/j.intimp.2020.106276 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref056] 56.Gaidhani N, Kem WR, Uteshev VV. Spleen is not required for therapeutic effects of 4OH-GTS-21, a selective α7 nAChR agonist, in the sub-acute phase of ischemic stroke in rats. Brain Res. 2021;1751:147196. doi: 10.1016/j.brainres.2020.147196 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref057] 57.Nullens S, Staessens M, Peleman C, Schrijvers DM, Malhotra-Kumar S, Francque S, et al. Effect of GTS-21, an Alpha7 nicotinic acetylcholine receptor agonist, on clp-induced inflammatory, gastrointestinal motility, and colonic permeability changes in mice. Shock. 2016;45(4):450–9. doi: 10.1097/SHK.0000000000000519 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref058] 58.Khan MAS, Farkhondeh M, Crombie J, Jacobson L, Kaneki M, Martyn JAJ. Lipopolysaccharide upregulates α7 acetylcholine receptors: stimulation with GTS-21 mitigates growth arrest of macrophages and improves survival in burned mice. Shock. 2012;38(2):213–9. doi: 10.1097/SHK.0b013e31825d628c [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref059] 59.Su X, Matthay MA, Malik AB. Requisite role of the cholinergic alpha7 nicotinic acetylcholine receptor pathway in suppressing Gram-negative sepsis-induced acute lung inflammatory injury. J Immunol. 2010;184(1):401–10. doi: 10.4049/jimmunol.0901808 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref060] 60.Leite PEC, Lagrota-Candido J, Moraes L, D’Elia L, Pinheiro DF, da Silva RF, et al. Nicotinic acetylcholine receptor activation reduces skeletal muscle inflammation of mdx mice. J Neuroimmunol. 2010;227(1–2):44–51. doi: 10.1016/j.jneuroim.2010.06.005 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref061] 61.Hu S, Wang Y, Li H. The Regulation Effect of α7nAChRs and M1AChRs on Inflammation and Immunity in Sepsis. Mediators Inflamm. 2021;2021:9059601. doi: 10.1155/2021/9059601 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref062] 62.Herber DL, Severance EG, Cuevas J, Morgan D, Gordon MN. Biochemical and histochemical evidence of nonspecific binding of alpha7nAChR antibodies to mouse brain tissue. J Histochem Cytochem. 2004;52(10):1367–76. doi: 10.1177/002215540405201013 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref063] 63.Rommel FR, Raghavan B, Paddenberg R, Kummer W, Tumala S, Lochnit G, et al. Suitability of Nicotinic Acetylcholine Receptor α7 and Muscarinic Acetylcholine Receptor 3 Antibodies for Immune Detection: Evaluation in Murine Skin. J Histochem Cytochem. 2015;63(5):329–39. doi: 10.1369/0022155415575028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref064] 64.Garg BK, Loring RH. Evaluating Commercially Available Antibodies for Rat α7 Nicotinic Acetylcholine Receptors. J Histochem Cytochem. 2017;65(9):499–512. doi: 10.1369/0022155417725304 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref065] 65.Johansson ME, Ulleryd MA, Bernardi A, Lundberg AM, Andersson A, Folkersen L, et al. α7 Nicotinic acetylcholine receptor is expressed in human atherosclerosis and inhibits disease in mice--brief report. Arterioscler Thromb Vasc Biol. 2014;34(12):2632–6. doi: 10.1161/ATVBAHA.114.303892 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref066] 66.Shelukhina IV, Kryukova EV, Lips KS, Tsetlin VI, Kummer W. Presence of alpha7 nicotinic acetylcholine receptors on dorsal root ganglion neurons proved using knockout mice and selective alpha-neurotoxins in histochemistry. J Neurochem. 2009;109(4):1087–95. doi: 10.1111/j.1471-4159.2009.06033.x [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref067] 67.van der Zanden EP, Hilbers FW, Verseijden C, van den Wijngaard RM, Skynner M, Lee K, et al. Nicotinic acetylcholine receptor expression and susceptibility to cholinergic immunomodulation in human monocytes of smoking individuals. Neuroimmunomodulation. 2012;19(4):255–65. doi: 10.1159/000335185 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref068] 68.Maldifassi MC, Martín-Sánchez C, Atienza G, Cedillo JL, Arnalich F, Bordas A, et al. Interaction of the α7-nicotinic subunit with its human-specific duplicated dupα7 isoform in mammalian cells: Relevance in human inflammatory responses. J Biol Chem. 2018;293(36):13874–88. doi: 10.1074/jbc.RA118.003443 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref069] 69.Teratani T, Mikami Y, Nakamoto N, Suzuki T, Harada Y, Okabayashi K, et al. The liver-brain-gut neural arc maintains the Treg cell niche in the gut. Nature. 2020;585(7826):591–6. doi: 10.1038/s41586-020-2425-3 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref070] 70.Broide RS, Winzer-Serhan UH, Chen Y, Leslie FM. Distribution of α7 Nicotinic Acetylcholine Receptor Subunit mRNA in the Developing Mouse. Front Neuroanat. 2019;13:76. doi: 10.3389/fnana.2019.00076 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref071] 71.Occhinegro A, McAllen RM, McKinley MJ, Martelli D. Acute Inhibition of Inflammation Mediated by Sympathetic Nerves: The Inflammatory Reflex. Neuroimmunomodulation. 2023;30(1):135–42. doi: 10.1159/000531469 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref072] 72.Salgado HC, Brognara F, Ribeiro AB, Lataro RM, Castania JA, Ulloa L, et al. Autonomic Regulation of Inflammation in Conscious Animals. Neuroimmunomodulation. 2023;30(1):102–12. doi: 10.1159/000530908 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref073] 73.Dantzer R. Neuroimmune Interactions: From the Brain to the Immune System and Vice Versa. Physiol Rev. 2018;98(1):477–504. doi: 10.1152/physrev.00039.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref074] 74.Straub RH, Herrmann M, Berkmiller G, Frauenholz T, Lang B, Schölmerich J, et al. Neuronal regulation of interleukin 6 secretion in murine spleen: adrenergic and opioidergic control. J Neurochem. 1997;68(4):1633–9. doi: 10.1046/j.1471-4159.1997.68041633.x [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref075] 75.Caravaca AS, Gallina AL, Tarnawski L, Tracey KJ, Pavlov VA, Levine YA, et al. An Effective Method for Acute Vagus Nerve Stimulation in Experimental Inflammation. Front Neurosci. 2019;13:877. doi: 10.3389/fnins.2019.00877 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref076] 76.Bob-Manuel J, Gautron L. Detection of G Protein-coupled Receptor Expression in Mouse Vagal Afferent Neurons using Multiplex In Situ Hybridization. J Vis Exp. 2021;(175):10.3791/62945. doi: 10.3791/62945 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref077] 77.Gautron L, Lee C, Funahashi H, Friedman J, Lee S, Elmquist J. Melanocortin-4 receptor expression in a vago-vagal circuitry involved in postprandial functions. J Comp Neurol. 2010;518(1):6–24. doi: 10.1002/cne.22221 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref078] 78.Thomsen MS, Mikkelsen JD. The α7 nicotinic acetylcholine receptor ligands methyllycaconitine, NS6740 and GTS-21 reduce lipopolysaccharide-induced TNF-α release from microglia. J Neuroimmunol. 2012;251(1–2):65–72. doi: 10.1016/j.jneuroim.2012.07.006 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref079] 79.Zhang X, Lei B, Yuan Y, Zhang L, Hu L, Jin S, et al. Brain control of humoral immune responses amenable to behavioural modulation. Nature. 2020;581(7807):204–8. doi: 10.1038/s41586-020-2235-7 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref080] 80.Mao D, Yasuda RP, Fan H, Wolfe BB, Kellar KJ. Heterogeneity of nicotinic cholinergic receptors in rat superior cervical and nodose Ganglia. Mol Pharmacol. 2006;70(5):1693–9. doi: 10.1124/mol.106.027458 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref081] 81.Genzen JR, Van Cleve W, McGehee DS. Dorsal root ganglion neurons express multiple nicotinic acetylcholine receptor subtypes. J Neurophysiol. 2001;86(4):1773–82. doi: 10.1152/jn.2001.86.4.1773 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref082] 82.Sapio MR, Vazquez FA, Loydpierson AJ, Maric D, Kim JJ, LaPaglia DM, et al. Comparative Analysis of Dorsal Root, Nodose and Sympathetic Ganglia for the Development of New Analgesics. Front Neurosci. 2020;14:615362. doi: 10.3389/fnins.2020.615362 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref083] 83.Tabula Muris Consortium, Overall coordination, Logistical coordination, Organ collection and processing, Library preparation and sequencing, Computational data analysis, et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 2018;562(7727):367–72. doi: 10.1038/s41586-018-0590-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref084] 84.GTEx Consortium, Laboratory, Data Analysis &Coordinating Center (LDACC)—Analysis Working Group, Statistical Methods groups—Analysis Working Group, Enhancing GTEx (eGTEx) groups, NIH Common Fund, NIH/NCI, et al. Genetic effects on gene expression across human tissues. Nature. 2017;550(7675):204–13. doi: 10.1038/nature24277 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref085] 85.Pipes L, Li S, Bozinoski M, Palermo R, Peng X, Blood P, et al. The non-human primate reference transcriptome resource (NHPRTR) for comparative functional genomics. Nucleic Acids Res. 2013;41(Database issue):D906–14. doi: 10.1093/nar/gks1268 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref086] 86.Schmiedel BJ, Singh D, Madrigal A, Valdovino-Gonzalez AG, White BM, Zapardiel-Gonzalo J, et al. Impact of Genetic Polymorphisms on Human Immune Cell Gene Expression. Cell. 2018;175(6):1701–1715.e16. doi: 10.1016/j.cell.2018.10.022 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref087] 87.Gautron L. The parasympathetic innervation of the spleen: are we chasing a ghost?. J Anat. 2022;240(4):772–4. doi: 10.1111/joa.13586 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref088] 88.Brown TC, Bond CE, Hoover DB. Variable expression of GFP in different populations of peripheral cholinergic neurons of ChATBAC-eGFP transgenic mice. Auton Neurosci. 2018;210:44–54. doi: 10.1016/j.autneu.2017.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref089] 89.Cleypool CGJ, Mackaaij C, Verlinde-Schellekens SAMW, Bleys RLAW. A comparative anatomical and histological study on the presence of an apical splenic nerve in mice and humans. J Anat. 2022;240(2):296–304. doi: 10.1111/joa.13541 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref090] 90.Verlinden TJM, van Dijk P, Hikspoors J, Herrler A, Lamers WH, Köhler SE. Innervation of the human spleen: A complete hilum-embedding approach. Brain Behav Immun. 2019;77:92–100. doi: 10.1016/j.bbi.2018.12.009 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref091] 91.Murray K, Godinez DR, Brust-Mascher I, Miller EN, Gareau MG, Reardon C. Neuroanatomy of the spleen: Mapping the relationship between sympathetic neurons and lymphocytes. PLoS One. 2017;12(7):e0182416. doi: 10.1371/journal.pone.0182416 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref092] 92.Cox MA, Duncan GS, Lin GHY, Steinberg BE, Yu LX, Brenner D, et al. Choline acetyltransferase-expressing T cells are required to control chronic viral infection. Science. 2019;363(6427):639–44. doi: 10.1126/science.aau9072 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref093] 93.Vasamsetti SB, Florentin J, Coppin E, Stiekema LCA, Zheng KH, Nisar MU, et al. Sympathetic Neuronal Activation Triggers Myeloid Progenitor Proliferation and Differentiation. Immunity. 2018;49(1):93–106.e7. doi: 10.1016/j.immuni.2018.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref094] 94.Ağaç D, Gill MA, Farrar JD. Adrenergic Signaling at the Interface of Allergic Asthma and Viral Infections. Front Immunol. 2018;9:736. doi: 10.3389/fimmu.2018.00736 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref095] 95.Wieduwild E, Girard-Madoux MJ, Quatrini L, Laprie C, Chasson L, Rossignol R, et al. β2-adrenergic signals downregulate the innate immune response and reduce host resistance to viral infection. J Exp Med. 2020;217(4):e20190554. doi: 10.1084/jem.20190554 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref096] 96.Hasegawa S, Inoue T, Nakamura Y, Fukaya D, Uni R, Wu C-H, et al. Activation of Sympathetic Signaling in Macrophages Blocks Systemic Inflammation and Protects against Renal Ischemia-Reperfusion Injury. J Am Soc Nephrol. 2021;32(7):1599–615. doi: 10.1681/ASN.2020121723 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref097] 97.McKinley MJ, Martelli D, Trevizan-Baú P, McAllen RM. Divergent splanchnic sympathetic efferent nerve pathways regulate interleukin-10 and tumour necrosis factor-α responses to endotoxaemia. J Physiol. 2022;600(20):4521–36. doi: 10.1113/JP283217 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref098] 98.Kizaki T, Shirato K, Sakurai T, Ogasawara J, Oh-ishi S, Matsuoka T, et al. Beta2-adrenergic receptor regulate Toll-like receptor 4-induced late-phase NF-kappaB activation. Mol Immunol. 2009;46(6):1195–203. doi: 10.1016/j.molimm.2008.11.005 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref099] 99.Smith NJ, Hone AJ, Memon T, Bossi S, Smith TE, McIntosh JM, et al. Comparative functional expression of nAChR subtypes in rodent DRG neurons. Front Cell Neurosci. 2013;7:225. doi: 10.3389/fncel.2013.00225 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref100] 100.Higashi H, Ueda N, Nishi S, Gallagher JP, Shinnick-Gallagher P. Chemoreceptors for serotonin (5-HT), acetylcholine (ACh), bradykinin (BK), histamine (H) and gamma-aminobutyric acid (GABA) on rabbit visceral afferent neurons. Brain Res Bull. 1982;8(1):23–32. doi: 10.1016/0361-9230(82)90023-5 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref101] 101.Nervo A, Calas A-G, Nachon F, Krejci E. Respiratory failure triggered by cholinesterase inhibitors may involve activation of a reflex sensory pathway by acetylcholine spillover. Toxicology. 2019;424:152232. doi: 10.1016/j.tox.2019.06.003 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref102] 102.Paintal BA. Impulses in vagal afferent fibres from specific pulmonary deflation receptors: the response of these receptors to phenyl diguanide, potato starch, 5-hydroxytryptamine and nicotine, and their rôle in respiratory and cardiovascular reflexes. Q J Exp Physiol Cogn Med Sci. 1955;40(2):89–111. doi: 10.1113/expphysiol.1955.sp001116 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref103] 103.Komegae EN, Farmer DGS, Brooks VL, McKinley MJ, McAllen RM, Martelli D. Vagal afferent activation suppresses systemic inflammation via the splanchnic anti-inflammatory pathway. Brain Behav Immun. 2018;73:441–9. doi: 10.1016/j.bbi.2018.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref104] 104.McAllen RM, McKinley MJ, Martelli D. Reflex regulation of systemic inflammation by the autonomic nervous system. Auton Neurosci. 2022;237:102926. doi: 10.1016/j.autneu.2021.102926 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref105] 105.Martelli D, Farmer DGS, McKinley MJ, Yao ST, McAllen RM. Anti-inflammatory reflex action of splanchnic sympathetic nerves is distributed across abdominal organs. Am J Physiol Regul Integr Comp Physiol. 2019;316(3):R235–42. doi: 10.1152/ajpregu.00298.2018 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref106] 106.Martelli D, Yao ST, McKinley MJ, McAllen RM. Reflex control of inflammation by sympathetic nerves, not the vagus. J Physiol. 2014;592(7):1677–86. doi: 10.1113/jphysiol.2013.268573 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref107] 107.Martelli D, Farmer DGS, Yao ST. The splanchnic anti-inflammatory pathway: could it be the efferent arm of the inflammatory reflex?. Exp Physiol. 2016;101(10):1245–52. doi: 10.1113/EP085559 [DOI] [PubMed] [Google Scholar]

[pone.0331707.ref108] 108.Martelli D, Yao ST, McKinley MJ, McAllen RM. Neural control of inflammation by the greater splanchnic nerves. Temperature (Austin). 2014;1(1):14–5. doi: 10.4161/temp.29135 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref109] 109.Nance DM, Sanders VM. Autonomic innervation and regulation of the immune system (1987-2007). Brain Behav Immun. 2007;21(6):736–45. doi: 10.1016/j.bbi.2007.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0331707.ref110] 110.Besedovsky HO, del Rey A, Sorkin E, Burri R, Honegger CG, Schlumpf M, et al. T lymphocytes affect the development of sympathetic innervation of mouse spleen. Brain Behav Immun. 1987;1(2):185–93. doi: 10.1016/0889-1591(87)90020-1 [DOI] [PubMed] [Google Scholar]

PERMALINK

The molecular components of the anti-inflammatory cholinergic pathway are extrasplenic

Warda Merchant

Steven Wyler

Bandy Chen

Laurent Gautron

Roles

Abstract

Introduction

Methods

Commercial mice

Generation of Chrna7 knockout mice

LPS treatment

QPCR

RNAscope studies

GFP immunostaining

Microscopic and data analysis

Statistical reporting

Fig 1. QPCR analysis of Adrb2, Chrna7, and Chat expression in wild-type mice.

Fig 5. Validation of a new Chrna7 knockout mouse.

Results

QPCR analysis of the main molecular components of the anti-inflammatory pathway in wild-type mice

Expression of Chrna7 is restricted to neurons

Fig 2. Anatomical distribution of Chrna7 in wild-type mice.

Fig 3. Chrna7 expression is unchanged in the nodose ganglion of LPS-treated mice.

Fig 4. Chromogenic RNAScope assay for Adrb2, Chat and Chrna7 in the mouse spleen.

Transcriptional adaptations in the spleen of α7nAChR knockout mice

The spleen is not a site of cholinergic signaling

Fig 6. Distribution of YFP in the Chat-Cre-ChR2-YFP mouse.

Fig 7. Cholinergic signaling in the gut and spleen of ChAT-Cre-ChR2-YFP mice.

Discussion

Fig 8. Heat maps compiling publicly available transcriptomics data from various databases.

Fig 9. Proposed alternative model of the anti-inflammatory cholinergic pathway.

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Yoshihiko Kakinuma

Roles

Author response to Decision Letter 1

Decision Letter 1

Yoshihiko Kakinuma

Roles

Author response to Decision Letter 2

Decision Letter 2

Yoshihiko Kakinuma

Roles

Acceptance letter

Yoshihiko Kakinuma

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases