Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Sep 5;123(5):e70458. doi: 10.1111/tpj.70458

Effects of light on chloroplast translation in Marchantia polymorpha are similar to those in angiosperms and are not influenced by light‐independent chlorophyll synthesis

Prakitchai Chotewutmontri 1,2, † , Rosalind Williams‐Carrier 1, † , Susan Belcher 1, Alice Barkan 1,✉
PMCID: PMC12413243  PMID: 40911876

SUMMARY

Translation of the chloroplast psbA mRNA in angiosperms is activated by photodamage of its gene product, the D1 subunit of photosystem II (PSII), providing nascent D1 for PSII repair. The involvement of chlorophyll in the regulatory mechanism has been suggested due to the regulatory roles of proteins proposed to mediate chlorophyll/D1 transactions and the fact that chlorophyll is synthesized only in the light in angiosperms. We used ribosome profiling and RNA‐seq to address whether the effects of light on chloroplast translation are conserved in the liverwort Marchantia (Marchantia polymorpha), which synthesizes chlorophyll in both the dark and the light. As in angiosperms, ribosome occupancy on psbA mRNA decreased rapidly upon shifting plants to the dark and was rapidly restored upon a transfer back to the light, whereas ribosome occupancy on other chloroplast mRNAs changed very little. The results were similar in a Marchantia mutant unable to synthesize chlorophyll in the dark. Those results, in conjunction with pulse‐labeling data, suggest that light elicits a plastome‐wide activation of translation elongation and a specific increase in psbA translation initiation in Marchantia, as in angiosperms. These findings show that light regulates chloroplast translation similarly in vascular and non‐vascular plants, and that constitutive chlorophyll synthesis does not affect light‐regulated psbA translation initiation. Additionally, the translational outputs of chloroplast genes are similar in Marchantia and angiosperms but result from differing contributions of mRNA abundance and translational efficiencies. This adds to the evidence that chloroplast mRNA abundance and translational efficiencies co‐evolve under selection to maintain protein outputs.

Keywords: chloroplast, translational control, psbA, PSII repair, Marchantia polymorpha, DPOR

Significance Statement

Ribosome profiling elucidated chloroplast translation, its control by light, and effects of light‐independent chlorophyll synthesis on these processes in the liverwort Marchantia polymorpha. The psbA mRNA is the only chloroplast mRNA in Marchantia to experience large changes in ribosome occupancy in response to light–dark shifts (as in angiosperms), and light‐independent chlorophyll synthesis does not influence this response.

INTRODUCTION

Oxygenic photosynthesis is catalyzed by a set of macromolecular complexes embedded in the thylakoid membranes of cyanobacteria and chloroplasts: photosystem II (PSII), photosystem I (PSI), cytochrome b 6 f, and ATP synthase. Although the structures of these complexes are highly conserved, their biogenesis mechanisms have diverged due to the partitioning of the structural genes between the nuclear and chloroplast genomes in photosynthetic eucaryotes, and to the divergence of gene expression mechanisms in cyanobacteria and chloroplasts. For example, post‐transcriptional control of gene expression is much more prevalent in chloroplasts than in cyanobacteria, and is mediated by hundreds of nucleus‐encoded RNA‐binding proteins that evolved in plants and algae after acquisition of the cyanobacterial endosymbiont (Barkan, 2011; Small et al., 2023).

A ubiquitous feature of oxygenic photosynthesis is the susceptibility of the D1 reaction center protein of PSII to photooxidative damage. Photodamaged D1 must be replaced with newly synthesized D1 to maintain photosynthesis (reviewed in Mulo et al., 2012). Accordingly, the rate of D1 synthesis is tuned to the degree of D1 photodamage (Adir et al., 1990; Tyystjarvi et al., 2002; Adir et al., 2003; Chotewutmontri and Barkan, 2020). However, distinct mechanisms underlie this regulation in chloroplasts and cyanobacteria. D1 is encoded by the psbA gene, which resides in the chloroplast genome of plants and algae. Whereas transcriptional control of psbA couples D1 synthesis with D1 photodamage in cyanobacteria (reviewed in Mulo et al., 2012; Muramatsu and Hihara, 2012), translational control serves this purpose in angiosperm and Chlamydomonas (Chlamydomonas reinhardtii) chloroplasts (Adir et al., 1990; Adir et al., 2003; Chotewutmontri and Barkan, 2020). This involves regulation at the step of translation initiation in angiosperms, as demonstrated by rapid changes in psbA ribosome occupancy when plants harboring mature chloroplasts are shifted among light conditions that provoke different degrees of D1 photodamage (Chotewutmontri and Barkan, 2018; Chotewutmontri and Barkan, 2020; Schuster et al., 2020). By contrast, current data suggest that this control is exerted at the level of translation elongation in Chlamydomonas chloroplasts (Minai et al., 2006). In angiosperms, the specific activation of psbA translation initiation in response to D1 photodamage is superimposed on a plastome‐wide activation of translation elongation in response to light (Chotewutmontri and Barkan, 2018). As a consequence, ribosomes are rapidly lost from psbA mRNA when plants are shifted to the dark and are rapidly restored when dark‐adapted plants are reilluminated, whereas ribosome occupancies on other chloroplast mRNAs change very little, despite profound changes in rates of synthesis of the proteins they encode. It is not known whether the psbA‐specific and plastome‐wide translational responses to light are conserved in land plants outside the angiosperms.

The regulation of psbA translation initiation by D1 photodamage in angiosperms is mediated by the translational regulator HCF173, which binds the psbA 5'UTR adjacent to the ribosome binding site (Schult et al., 2007; McDermott et al., 2019; Williams‐Carrier et al., 2025). HCF173 was originally reported as an activator of psbA translation based on the phenotype of a knockout mutant (Schult et al., 2007). However, recent data provided a more nuanced view, demonstrating that HCF173 also represses psbA translation in the dark and that the psbA ORF acts in cis to promote HCF173‐mediated repression in conditions of low D1 photodamage (Williams‐Carrier et al., 2025). Several proteins involved in early steps in the assembly of the PSII reaction center contribute to the regulatory circuit: the rubredoxin RBD1 (Calderon et al., 2013) and the HCF244/OHP1/OHP2 complex (Knoppova et al., 2014; Hey and Grimm, 2018; Myouga et al., 2018) stimulate the association of ribosomes with psbA mRNA (Link et al., 2012; Chotewutmontri et al., 2020; Che et al., 2022; Rojas et al., 2025), whereas the assembly factor HCF136 (Meurer et al., 1998) represses the association of ribosomes with psbA mRNA specifically in the dark (Chotewutmontri and Barkan, 2020). These observations led to a working model that invokes co‐translational interactions among nascent D1, RBD1, HCF136, and HCF173 to account for the tuning of psbA translation to the degree of D1 photodamage (Rojas et al., 2025; Williams‐Carrier et al., 2025). However, how these PSII assembly factors influence psbA translation remains speculative.

In angiosperms, chlorophyll is synthesized only in the light due to the light‐dependence of the enzyme protochlorophyllide oxidoreductase (POR) (Armstrong et al., 1995; Gabruk and Mysliwa‐Kurdziel, 2015). By contrast, photosynthetic eukaryotes outside of the angiosperms harbor two distinct POR enzymes, a light‐dependent POR (LPOR) and a “DPOR” enzyme that is light‐independent (Armstrong, 1998). Thus, organisms harboring DPOR have a “green in the dark” phenotype. It has been suggested that light‐induced chlorophyll synthesis might contribute to the activation of psbA translation when angiosperms are shifted from dark to light, and that organisms harboring DPOR might regulate psbA translation differently (Wang et al., 2023). In accord with this possibility, OHP2, which is required for psbA translation in Arabidopsis (Arabidopsis thaliana) (Chotewutmontri et al., 2020) but not in Chlamydomonas (Wang et al., 2023), binds chlorophyll and has been suggested to recycle chlorophyll released from damaged D1, deliver chlorophyll to nascent D1, and/or protect the assembling reaction center from photooxidative damage (Knoppova et al., 2014; Hey and Grimm, 2020; Knoppova et al., 2022).

In this study, we addressed whether the effects of light on chloroplast ribosome occupancies are conserved between angiosperms and non‐vascular land plants, and whether the capacity to synthesize chlorophyll in the dark influences the translational response to light. To that end, we used ribosome profiling to analyze the effects of light–dark shifts on chloroplast ribosome occupancies in the liverwort Marchantia (Marchantia polymorpha), a non‐vascular land plant whose chloroplast genome organization is similar to that in angiosperms but also encodes DPOR (Ohyama, 1996), and is therefore green‐in‐the‐dark. We also analyzed a Marchantia mutant that synthesizes chlorophyll only in the light due to a mutation in the chloroplast chlB gene encoding a DPOR subunit (Ueda et al., 2014). Our results show that the effects of light–dark shifts on chloroplast ribosome occupancies are similar in Marchantia and angiosperms, and that this response is not affected by the presence/absence of DPOR. The data also elucidate general features of chloroplast gene expression in Marchantia by providing plastome‐wide readouts of translational outputs and translational efficiencies. The results strongly suggest that plastid‐encoded proteins are synthesized in similar ratios in angiosperms and Marchantia. However, the conserved protein outputs of angiosperm and liverwort chloroplast genes are achieved through evolutionarily malleable adjustments in the relative contributions of mRNA abundance and translational efficiencies.

RESULTS AND DISCUSSION

Similar translational outputs of chloroplast genes in Marchantia and angiosperms result from differing contributions of mRNA abundance and translational efficiency

We began by using ribosome profiling (ribo‐seq) and RNA‐seq to provide an overview of chloroplast gene expression in Marchantia grown in continuous light. Ribo‐seq uses deep sequencing to map and quantify ribosome footprints– mRNA segments protected by ribosomes from nuclease attack. The normalized abundance of ribosome footprints mapping to open reading frames (ORFs) within a dataset is typically proportional to rates of protein synthesis from those ORFs under the particular condition being assayed. This metric, referred to below as translational output, reflects the combined contributions of mRNA abundance and translational efficiency. When paired with RNA‐seq to normalize for mRNA abundance, ribo‐seq data can be used to infer relative translational efficiencies, which are proportional to the average number of ribosomes bound to each ORF.

Ribo‐seq data collected from two biological replicates were normalized for sequencing depth and ORF length (TPM –psbA , see Methods). RNA‐seq data were collected from three biological replicates. We filtered out data for genes that met any of the following criteria: genes with fewer than an average of 50 reads among replicates in either the ribo‐seq or RNA‐seq; RNA‐seq data from intron‐containing genes due to uncertainty about the fraction of reads derived from spliced RNA; and RNA‐seq data from ORFs with fewer than 100 nt because short RNAs are not quantitatively captured during the library preparation.

The data for chloroplast genes that passed these filters are presented in Figure 1. Translational outputs (normalized ribo‐seq values) varied over an approximately 3000‐fold range, similar to analogous data from seedling leaf tissue in angiosperms [maize (Zea mays) (Chotewutmontri and Barkan, 2016), Arabidopsis (Chotewutmontri and Barkan, 2018), tobacco (Nicotiana tabacum) (Williams‐Carrier et al., 2025)], and in the green alga Chlamydomonas (Gotsmann et al., 2024). The most highly expressed genes were rbcL, encoding the large subunit of Rubisco, and psbA, encoding the D1 subunit of PSII, correlating with the high abundance of Rubisco and the expected high rate of D1 synthesis to replace photodamaged D1. mRNA abundance (RNA‐seq) varied over an approximately 300‐fold range (Figure 1, middle), and translational efficiencies over an approximately 30‐fold range (Figure 1, bottom). Translational efficiency in bacteria and chloroplasts is generally programmed by the mRNA's ribosome binding region flanking the start codon, whose structure, ribosome affinity, and association with ORF‐specific translational regulators determine the rate of translation initiation (reviewed in Zoschke and Bock, 2018; Willmund et al., 2023; Webster, 2025). Thus, the translational efficiencies reported here have potential application in the selection of cis‐elements to tune translational outputs among transgenes in synthetic chloroplast operons in Marchantia for biotechnology applications.

Figure 1.

Figure 1

Overview of chloroplast gene expression in illuminated Marchantia chloroplasts.

The graphs summarize data from ribo‐seq (translational output) and RNA‐seq (mRNA level) analyses of Marchantia grown in continuous light. Genes are arranged according to position in the chloroplast genome (a) or according to function (b). Read counts were normalized for sequencing depth and ORF length (cpTPM –psbA ). Values are the mean ± SEM of two ribo‐seq replicates and three RNA‐seq replicates. Translational efficiency was calculated as the ratio of the normalized ribo‐seq and RNA‐seq values. Genes with introns (#) were excluded from the mRNA level and translational efficiency plots due to uncertainty about the fraction of the RNA that was spliced. Genes that failed to meet read count cut‐offs (see Methods) in either the RNA‐seq or ribo‐seq data are not displayed.

(c) Ribo‐seq (translational output), RNA‐seq (mRNA level), and translational efficiency data for the plastid‐encoded subunits of the thylakoid ATP synthase to illustrate the tuning of translational outputs to protein stoichiometry.

Ribosome profiling data from angiosperm and Chlamydomonas chloroplasts provided evidence that proteins are typically synthesized at rates that are roughly proportional to their steady‐state levels (Chotewutmontri and Barkan, 2016; Trösch et al., 2018). Accordingly, Marchantia genes encoding subunits of PSI, PSII, and ATP synthase generally had much higher translational output than those encoding subunits of ribosomes, the NADH dehydrogenase‐like complex (ndh), or RNA polymerase (rpo) (Figure 1b), correlating with the abundance of those proteins in angiosperms (Zybailov et al., 2008; Ponnala et al., 2014; McKenzie et al., 2020; Ibrahim et al., 2022). For example, Mckenzie et al. (2020) reported a stoichiometry of 1 PSII: 0.58 PSI: 0.35 cyt b 6 f: 0.01 NDH, which corresponds well to the relative translational outputs of genes encoding subunits of these complexes in Marchantia chloroplasts (roughly 1 PSII: 0.6 PSI: 0.17 cyt b 6 f: 0.02 NDH; see Data S1). The plastid‐encoded subunits of the chloroplast ATP synthase, AtpA, AtpB, AtpH, AtpE, AtpF, and AtpI are particularly illustrative, as they are found in a ratio of 3:3:14:1:1:1 in the ATP synthase, and the translational outputs of these genes mirror this ratio in maize (Chotewutmontri and Barkan, 2016). The Marchantia data are similar in this regard and, as in maize, this tuning of protein production to stoichiometry results primarily from differing translational efficiencies of the corresponding mRNAs (Figure 1c). Interestingly, PetD, a single‐copy subunit of the cyt b 6 f complex, is over‐produced with respect to the other cyt b 6 f subunits in Marchantia (Figure 1b), as reported previously for maize (Chotewutmontri and Barkan, 2016). The synthesis of PetD in excess of its partner proteins likely compensates for the unusually short half‐life of the PetD protein (Li et al., 2017).

The translational outputs of chloroplast genes in Marchantia correlate well with those reported for maize and Arabidopsis (Chotewutmontri and Barkan, 2016; Chotewutmontri and Barkan, 2018) (Figure 2, top), and the atpH mRNA is among the most efficiently translated mRNAs in all three species (Figure 2, bottom). However, translational efficiencies are less conserved than are translational outputs (Figure 2, bottom). For example, the low translational output of rps15 results from highly efficient translation of a low‐abundance mRNA in Arabidopsis and from inefficient translation of an abundant mRNA in Marchantia (Figure 2, left). Similarly, the low translational output of ndhC results from the efficient translation of a low‐abundance mRNA in Marchantia, but from inefficient translation of a more abundant mRNA in Arabidopsis (Figure 2, left). These results add to the evidence that evolutionary selection acts at the level of translational output, and that chloroplast translational efficiencies and mRNA abundances co‐evolve within that evolutionary constraint (Chotewutmontri and Barkan, 2016). Although the translational efficiencies of psbA mRNA were particularly discordant in the comparison of Arabidopsis and Marchantia (Figure 2, left bottom), this may reflect the specific light conditions employed for plant growth, because psbA ribosome occupancy is strongly dependent on light conditions (Chotewutmontri and Barkan, 2018; Schuster et al., 2020 and see below).

Figure 2.

Figure 2

Comparison of chloroplast gene outputs and translational efficiencies in Marchantia and angiosperms.

Data from prior analyses of (a) Arabidopsis (Chotewutmontri and Barkan, 2018) and (b) maize seedlings (Chotewutmontri and Barkan, 2016) harvested at midday are plotted using the RPKM normalization method used in the original studies. The maize data come from leaf section 9, representing young autotrophic tissue. The Marchantia data are the same as shown in Figure 1. Genes discussed in the text are labeled.

Effects of light–dark shifts on mRNA abundance and ribosome occupancies are similar in Marchantia and angiosperm chloroplasts and are not influenced by light‐independent chlorophyll synthesis

Ribosomes are rapidly gained and lost from psbA mRNA when angiosperms are shifted between light and dark, whereas ribosome occupancy on other chloroplast mRNAs is quite stable (Chotewutmontri and Barkan, 2018; Chotewutmontri and Barkan, 2020; Williams‐Carrier et al., 2025). To determine whether the same is true in Marchantia, we performed ribo‐seq and RNA‐seq on Marchantia tissue harvested at midday during growth in continuous light, after 1 h of dark adaptation, and following 15 min of reillumination. This was similar to the light shift regime we used previously in angiosperms except that the midday condition for angiosperms came from plants grown in diurnal cycles, Marchantia was grown under a lower light intensity (10 μmol photons m−2 s−1), and Marchantia was reilluminated with a light intensity that was considerably greater than that in which it had been grown (100 μmol photons m−2 s−1).

Figure 3 displays the results in two graphs with different Y‐axes: highly expressed genes encoding subunits of PSI, PSII, cyt b 6 f, and the ATP synthase are shown at the top and lowly expressed genes encoding proteins involved in gene expression, the NDH complex, and various other functions are shown below. As in angiosperms, chloroplast mRNA levels did not change during this light shift regime, and the psbA mRNA was the only mRNA to experience large changes in ribosome occupancy: ribosome occupancy on psbA dropped roughly fourfold after 1 h in the dark and increased roughly eightfold during 15 min of reillumination. The psbK mRNA showed a modest decrease in ribosome occupancy in the dark (less than 2‐fold), which has not been reported in angiosperms. These results suggest that light intensity affects chloroplast translation initiation similarly in Marchantia and angiosperm chloroplasts despite the presence of light‐independent chlorophyll synthesis in Marchantia.

Figure 3.

Figure 3

Effect of light–dark shifts on chloroplast ribosome occupancies in Marchantia.

Wild‐type Marchantia grown in continuous light, dark‐adapted for 1 h, or reilluminated for 15 min was analyzed by ribo‐seq and RNA‐seq. The continuous light data shown here are the same as those in Figures 1 and 2. Genes are grouped by function and are organized into two graphs with different Y‐axes based on expression level. Read counts were normalized for sequencing depth and ORF length (cpTPM –psbA ). Values are the mean ± SEM of two replicates for ribo‐seq and three replicates for RNA‐seq. Translational efficiency was calculated as the ratio of the normalized ribo‐seq and RNA‐seq values. Genes with introns (#) were excluded from the mRNA level and translational efficiency calculations due to uncertainty about the fraction of the RNA that was spliced. Genes that failed to meet read count cut‐offs in either the RNA‐seq or ribo‐seq data are not displayed.

To determine whether the synthesis of chlorophyll in the dark influences these responses, we used ribo‐seq to analyze a Marchantia mutant with an aadA insertion disrupting the chloroplast chlB gene, which encodes an essential DPOR subunit (Ueda et al., 2014). The absence of ribosome footprints mapping to chlB sequences downstream of the aadA insertion confirmed the genotype of the material analyzed (Figure 4a). RNA gel blot analysis showed that the abundance of psbA mRNA in the chlB::aadA mutant did not change during the light shift regime (Figure 4b).

Figure 4.

Figure 4

Effect of light–dark shifts on chloroplast ribosome occupancies in the chlB::aadA mutant.

(a) Ribosome footprints mapping to chlB. The image was taken from the Integrated Genome Viewer (IGV). The position of the aadA insertion is shown below. CL: continuous light. D: 1 h dark. R: 15 min reillumination.

(b) psbA expression in the chlB::aadA mutant. An RNA gel blot demonstrating psbA mRNA abundance during the light shift regime is shown to the left. The distribution of ribosome footprints along the psbA ORF is shown to the right. Plots were made with the IGV, with the Y axes adjusted so that the maximum peak height is the same in each case. CL: continuous light. D: 1 h dark. R: 15 min reillumination.

(c) Ribo‐seq analysis of the chlB::aadA mutant grown in continuous light, dark‐adapted for 1 h, or reilluminated for 15 min. Values are the mean ± SEM of three biological replicates. Genes are grouped by function and are organized into two graphs with different Y‐axes based on expression level. Read counts were normalized for sequencing depth and ORF length (cpTPM –psbA ).

(d) Scatter plots comparing ribo‐seq data in wild‐type and chlB::aadA Marchantia under each light condition. The data are the same as those presented in Figures 3 and 4c.

The ribo‐seq data for the chlB::aadA mutant (Figure 4c) were very similar to those for the wild‐type: ribosome occupancy on psbA mRNA dropped during 1 h of dark adaptation and increased beyond its original level during 15 min of reillumination, whereas ribosome occupancy on other chloroplast ORFs changed very little. Furthermore, the distribution of ribosomes along the psbA ORF was similar in the wild‐type and mutant, as well as in all three light conditions (Figure 4b). A direct comparison of data for the wild‐type and chlB::aadA mutant (Figure 4d) shows that the results for the two genotypes are similar under each light condition. Therefore, the presence of light‐independent chlorophyll synthesis in wild‐type Marchantia has no apparent influence on the regulation of psbA translation initiation in response to light.

Pulse‐labeling data suggest that light increases translation elongation rate in Marchantia chloroplasts, as in angiosperms

In maize and Arabidopsis, the specific light activation of psbA translation initiation is superimposed on a plastome‐wide increase in the rate of translation elongation. As such, rates of chloroplast protein synthesis increase globally when plants are shifted to the light without a corresponding increase in ribosome occupancy (with the exception of psbA) (Chotewutmontri and Barkan, 2018). To assess whether a similar phenomenon occurs in Marchantia, we used pulse labeling to examine rates of chloroplast protein synthesis in plants experiencing changes in light intensity. Wild‐type and chlB mutant plants were acclimated to low intensity light for 20 min, and then shifted to higher intensity light and incubated in radiolabeled amino acids in the presence of cycloheximide to inhibit cytosolic protein synthesis (Figure 5a). Only RbcL and D1 could be identified among the radiolabeled products, but the synthesis of both of them increased dramatically in response to the increased light intensity in both the wild‐type and chlB mutant. Similar results were obtained when the wild‐type was acclimated briefly to the dark and then shifted to its standard growth light intensity (Figure 5b). The fact that light activated RbcL synthesis but did not increase rbcL ribosome occupancy (Figure 3) implies that light activates rbcL translation via a concerted increase in the rate of translation elongation and initiation. Although other radiolabeled proteins were detected with very low signal, it is unclear whether those are products of nuclear or plastid genes due to the possibility of incomplete inhibition of cytosolic translation. Nonetheless, the rbcL data suggest that the plastome‐wide control of translation elongation by light that has been elucidated in angiosperms applies also to Marchantia. However, confirmation of this possibility will require additional experiments, such as the lincomycin ribosome run‐off assay used to demonstrate that light elicits a plastome‐wide regulation of translation elongation in maize (Chotewutmontri and Barkan, 2018).

Figure 5.

Figure 5

Pulse‐labeling analysis of chloroplast protein synthesis in response to increases in light intensity.

Thallus tissue from plants that had been grown in continuous light was subjected to the diagrammed light shift regimes and analyzed by pulse‐labeling with [35S]‐methionine/cysteine. Cycloheximide was included to inhibit cytosolic protein synthesis. An equal amount of protein was applied to each lane. Proteins were transferred to a nitrocellulose membrane prior to exposure to a phosphor screen. Proteins bound to each membrane were stained with Ponceau S (below), to illustrate equal protein loading. Each experiment was performed with two replicates (rep).

(a) Chloroplast protein synthesis in thallus tissue after a brief period of adaptation to low intensity light and after a shift to a higher light intensity. The plants were 54 days old.

(b) Chloroplast protein synthesis in thallus tissue after brief periods of dark adaptation and reillumination. The plants were 60 days old.

CONCLUSIONS

Results presented here show that the basic themes of chloroplast translation and its regulation by light are conserved between the liverwort Marchantia and angiosperms, and that the presence of the DPOR pathway for chlorophyll synthesis in the dark has no discernable effect on these behaviors. These findings argue against the hypothesis that different mechanisms underlie light‐regulated psbA translation in organisms harboring and lacking DPOR (Wang et al., 2023). Our results do not, however, eliminate the possibility that a light‐induced burst in chlorophyll synthesis catalyzed by LPOR contributes to the specific induction of D1 synthesis in response to light. This possibility could be addressed in the future by examining the effects of light on psbA translation in a Marchantia mutant disrupted in LPOR, within which DPOR would constitutively produce chlorophyll to bind to D1, OHP2, and other chlorophyll‐binding proteins.

Our data also extend the observation of proportional protein synthesis– the production of proteins in rough proportion to their stoichiometry at steady state—to Marchantia chloroplasts. The protein outputs of chloroplast genes are highly correlated in maize, Arabidopsis, and Marchantia, but the relative contributions of mRNA abundance and translational efficiency to achieving this end vary between genes and between species (Figure 2). This implies that mRNA abundance and translational efficiency co‐evolve such that both limit rates of gene expression to a similar extent, with the notable exception of psbA for which there is a pool of translationally silenced mRNA whose size changes in response to D1 photodamage (Williams‐Carrier et al., 2025). The quantitative descriptions of translational outputs and translational efficiencies reported here also support the development of synthetic biology tools for the Marchantia chloroplast (Sauret‐Gueto et al., 2020), as these data can guide the design of cis‐elements to achieve desired outputs of chloroplast transgenes.

MATERIALS AND METHODS

Plant growth

Marchantia polymorpha male accession Takaragaike‐1 and a chlB mutant caused by the insertion of the aadA gene (Ueda et al., 2014) were asexually maintained by thallus subculture on 1/2 Gamborg B5 medium (Sigma) containing 6 g/L Micro agar (Duchefa Biochemie, Netherlands). Both strains were generously provided by Yoshiki Nishimura (Kyoto University), Minoru Ueda (Riken), Yukiko Yasui (Kyoto University), and Takayuki Kohchi (Kyoto University). The plants were grown at room temperature (roughly 20°C) under continuous light from fluorescent lamps at ~10 μmol photons m−2 s−1.

In vivo pulse labeling

For each replicate, four pieces of tissue of ~0.5 cm2 were excised from the apical region of thallus (age as indicated in the figure) and placed in a clear 24‐well plastic plate containing 135 μL of labeling buffer (10 mM Na‐PO4 buffer pH 7.2, 0.1% Tween 20, 100 μg/mL cycloheximide). For the low‐to‐high light experiment, the plate was moved to low light (5 μmol photons m−2 s−1 fluorescent light) for 30 min for acclimation. At the end of 30 min, one set of plants remained in low light (5 μmol photons m−2 s−1) and the other plate was moved to 100 μmol photons m−2 s−1 fluorescent light (Vivosun T5 24W 6500K). After 15 min of acclimation to the new light condition, 3 μL of EasyTag Express 35S Protein Labeling Mix (Perkin Elmer) diluted into 12 μL of labeling buffer was added to each well. After 20 min, the tissues were quickly washed twice in labeling buffer lacking radiolabeled amino acids and frozen in liquid nitrogen. The dark‐to‐light experiment was performed similarly, except that plants were adapted to the dark for 30 min and then either maintained in the dark or transferred to standard growth light for pulse labeling. Tissue was ground in liquid nitrogen in a mortar and pestle and thawed in the presence of homogenization buffer (10 mM Tris‐Cl pH 7.5, 10% glycerol, 5 mM EDTA, 2 mM EGTA, 40 mM β‐mercaptoethanol, 2 μg/mL pepstatin, 2 μg/mL leupeptin, 2 mM phenylmethylsulfonyl fluoride) with continued grinding. An equal amount of protein from each lysate was resolved on a 4%–20% polyacrylamide SDS‐PAGE gel. Proteins were electrophoretically transferred to nitrocellulose prior to radiolabel detection with a STORM phosphorimager.

Ribo‐seq, RNA‐seq, and RNA gel blot hybridization

Thallus tissue was harvested from plants under three light conditions: growth light (continuous 10 μmol photons m−2 s−1), 1 h of dark adaptation, and 15 min reillumination at 100 μmol photons m−2 s−1 fluorescent light. Ribo‐seq experiments were performed with two biological replicates. For each replicate, eight pieces of apical thallus tissues (2 cm) were collected from 1 month old plants and frozen in liquid nitrogen. Ribosome footprints and sequencing libraries were prepared as described previously for Arabidopsis and maize (Chotewutmontri and Barkan, 2018) except that we used the NEXTFLEX Small RNA‐Seq Kit v4 (Perkin Elmer). RNA‐seq was performed with three biological replicates: one replicate was from total RNA isolated from ribo‐seq samples and two were from total RNA isolated from apical thallus tissue (2 cm) collected from 6‐week old plants. Total RNA was isolated using TRI Reagent (Molecular Research Center, Inc.). RNA‐seq libraries were prepared using the Zymo‐Seq RiboFree Total RNA Library Kit (Zymo Research). The ribo‐seq and RNA‐seq libraries were sequenced by the Genomics and Cell Characterization Core Facility at University of Oregon using a NovaSeq 6000 (Illumina) in single‐read mode with read lengths of 118 nt. Read trimming, mapping, and counting were performed as described in (Chotewutmontri et al., 2020), except that the adapter trimmed reads were mapped sequentially to the Marchantia polymorpha chloroplast genome (GenBank accession NC_037507.1), mitochondrial genome (GenBank accession NC_037508.1), and nuclear genome (JGI assembly v3.0 and annotation v3.1). RNA‐seq data were normalized to ORF length and sequencing depth using the cpTPM method, for which sequencing depth was normalized based on total reads mapping to chloroplast ORFs. Ribo‐seq data were normalized for sequencing depth and ORF length using the cpTPM –psbA method (Williams‐Carrier et al., 2025), during which sequencing depth normalization was based on total reads mapping to chloroplast ORFs other than psbA. Reads mapping to psbA were excluded from the read depth metric due to the fact that psbA reads make up a large proportion of total reads and also exhibit large changes in response to light, such that their inclusion artifactually decreases apparent changes in psbA ribosome occupancy in response to light. Because translation can initiate on unspliced chloroplast mRNA (Zoschke et al., 2013), ribo‐seq calculations for intron‐containing genes were based on reads mapping to the last exon to ensure that the values reflect translation through to the end of the ORF. Raw and normalized read counts for chloroplast genes are reported in Data S1.

RNA extraction and RNA gel blot hybridization were performed as described previously for leaf tissue of vascular plants (Williams‐Carrier et al., 2025). The psbA mRNA was detected by hybridization to a synthetic oligonucleotide complementary to the first 50 nt of the maize psbA ORF (5′ AAGCGACCCCACAGGCTTGTACTTTCGCGTCTCTCTAAAATTGCAGTCAT 3′), which differs at eight positions from the Marchantia sequence.

Accession Numbers

Ribo‐seq and RNA‐seq data were deposited at the SRA database under BioProject PRJNA1233356.

Author Contributions

AB and PC designed the project, RWC, PC, and SB performed the experiments, all authors analyzed the data, and AB wrote the paper. All authors edited the paper and read and approved the final version of the manuscript.

Conflict of Interest

The authors declare no competing interests.

Supporting information

Data S1. Summary of ribo‐seq and RNA‐seq data for chloroplast genes.

TPJ-123-0-s001.xlsx (49KB, xlsx)

Acknowledgments

The authors are extremely grateful to Yoshiki Nishimura (Kyoto University), Minoru Ueda (Riken), Yukiko Yasui (Kyoto University), and Takayuki Kohchi (Kyoto University) for providing the Marchantia strains used in this work, and for their helpful guidance on Marchantia growth. This work benefited from access to the University of Oregon high‐performance computing cluster, Talapas. This work was funded by grants MCB‐2034758 and IOS‐2052555 to A.B. from the U.S. National Science Foundation.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are openly available in SRA Database at https://www.ncbi.nlm.nih.gov/sra/docs/, reference number BioProject PRJNA1233356.

References

  1. Adir, N. , Shochat, S. & Ohad, I. (1990) Light‐dependent D1 protein synthesis and translocation is regulated by reaction center II. Reaction center II serves as an acceptor for the D1 precursor. The Journal of Biological Chemistry, 265, 12563–12568. [PubMed] [Google Scholar]
  2. Adir, N. , Zer, H. , Shochat, S. & Ohad, I. (2003) Photoinhibition ‐ a historical perspective. Photosynthesis Research, 76, 343–370. [DOI] [PubMed] [Google Scholar]
  3. Armstrong, G.A. (1998) Greening in the dark: light‐independent chlorophyll biosynthesis from anoxygenic photosynthetic bacteria to gymnosperms. Journal of Photochemistry and Photobiology, 43, 87–100. [Google Scholar]
  4. Armstrong, G.A. , Runge, S. , Frick, G. , Sperling, U. & Apel, K. (1995) Identification of NADPH:protochlorophyllide oxidoreductases a and B: a branched pathway for light‐dependent chlorophyll biosynthesis in Arabidopsis thaliana. Plant Physiology, 108, 1505–1517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barkan, A. (2011) Expression of plastid genes: organelle‐specific elaborations on a prokaryotic scaffold. Plant Physiology, 155, 1520–1532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Calderon, R.H. , Garcia‐Cerdan, J.G. , Malnoe, A. , Cook, R. , Russell, J.J. , Gaw, C. et al. (2013) A conserved rubredoxin is necessary for photosystem II accumulation in diverse oxygenic photoautotrophs. The Journal of Biological Chemistry, 288, 26688–26696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Che, L. , Meng, H. , Ruan, J. , Peng, L. & Zhang, L. (2022) Rubredoxin 1 is required for formation of the functional photosystem II Core complex in Arabidopsis thaliana. Frontiers in Plant Science, 13, 824358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chotewutmontri, P. & Barkan, A. (2016) Dynamics of chloroplast translation during chloroplast differentiation in maize. PLoS Genetics, 12, e1006106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chotewutmontri, P. & Barkan, A. (2018) Multilevel effects of light on ribosome dynamics in chloroplasts program genome‐wide and psbA‐specific changes in translation. PLoS Genetics, 14, e1007555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chotewutmontri, P. & Barkan, A. (2020) Light‐induced psbA translation in plants is triggered by photosystem II damage via an assembly‐linked autoregulatory circuit. Proceedings of the National Academy of Sciences of the United States of America, 117, 21775–21784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chotewutmontri, P. , Williams‐Carrier, R. & Barkan, A. (2020) Exploring the link between photosystem II assembly and translation of the chloroplast psbA mRNA. Plants, 9, E152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gabruk, M. & Mysliwa‐Kurdziel, B. (2015) Light‐dependent Protochlorophyllide oxidoreductase: phylogeny, regulation, and catalytic properties. Biochemistry, 54, 5255–5262. [DOI] [PubMed] [Google Scholar]
  13. Gotsmann, V.L. , Ting, M.K.Y. , Haase, N. , Rudorf, S. , Zoschke, R. & Willmund, F. (2024) Utilizing high‐resolution ribosome profiling for the global investigation of gene expression in Chlamydomonas. The Plant Journal, 117, 1614–1634. [DOI] [PubMed] [Google Scholar]
  14. Hey, D. & Grimm, B. (2018) ONE‐HELIX PROTEIN2 (OHP2) is required for the stability of OHP1 and assembly factor HCF244 and is functionally linked to PSII biogenesis. Plant Physiology, 177, 1453–1472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hey, D. & Grimm, B. (2020) ONE‐HELIX PROTEIN1 and 2 forms heterodimers to bind chlorophyll in photosystem II biogenesis. Plant Physiology, 183, 179–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ibrahim, I.M. , McKenzie, S.D. , Chung, J. , Aryal, U.K. , Leon‐Salas, W.D. & Puthiyaveetil, S. (2022) Photosystem stoichiometry adjustment is a photoreceptor‐mediated process in Arabidopsis. Scientific Reports, 12, 10982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Knoppova, J. , Sobotka, R. , Tichy, M. , Yu, J. , Konik, P. , Halada, P. et al. (2014) Discovery of a chlorophyll binding protein complex involved in the early steps of photosystem II assembly in Synechocystis. Plant Cell, 26, 1200–1212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Knoppova, J. , Sobotka, R. , Yu, J. , Beckova, M. , Pilny, J. , Trinugroho, J.P. et al. (2022) Assembly of D1/D2 complexes of photosystem II: binding of pigments and a network of auxiliary proteins. Plant Physiology, 189, 790–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li, L. , Nelson, C.J. , Trosch, J. , Castleden, I. , Huang, S. & Millar, A.H. (2017) Protein degradation rate in Arabidopsis thaliana leaf growth and development. The Plant Cell, 29, 207–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Link, S. , Engelmann, K. , Meierhoff, K. & Westhoff, P. (2012) The atypical short‐chain dehydrogenases HCF173 and HCF244 are jointly involved in translational initiation of the psbA mRNA of Arabidopsis. Plant Physiology, 160, 2202–2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. McDermott, J.J. , Watkins, K.P. , Williams‐Carrier, R. & Barkan, A. (2019) Ribonucleoprotein capture by in vivo expression of a designer pentatricopeptide repeat protein in Arabidopsis. Plant Cell, 31, 1723–1733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. McKenzie, S.D. , Ibrahim, I.M. , Aryal, U.K. & Puthiyaveetil, S. (2020) Stoichiometry of protein complexes in plant photosynthetic membranes. Biochimica et Biophysica Acta ‐ Bioenergetics, 1861, 148141. [DOI] [PubMed] [Google Scholar]
  23. Meurer, J. , Plücken, H. , Kowallik, K. & Westhoff, P. (1998) A nuclear‐encoded protein of prokaryotic origin is essential for the stability of photosystem II in Arabidopsis thaliana. The EMBO Journal, 17, 5286–5297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Minai, L. , Wostrikoff, K. , Wollman, F.A. & Choquet, Y. (2006) Chloroplast biogenesis of photosystem II cores involves a series of assembly‐controlled steps that regulate translation. Plant Cell, 18, 159–175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mulo, P. , Sakurai, I. & Aro, E.M. (2012) Strategies for psbA gene expression in cyanobacteria, green algae and higher plants: from transcription to PSII repair. Biochimica et Biophysica Acta, 1817, 247–257. [DOI] [PubMed] [Google Scholar]
  26. Muramatsu, M. & Hihara, Y. (2012) Acclimation to high‐light conditions in cyanobacteria: from gene expression to physiological responses. Journal of Plant Research, 125, 11–39. [DOI] [PubMed] [Google Scholar]
  27. Myouga, F. , Takahashi, K. , Tanaka, R. , Nagata, N. , Kiss, A.Z. , Funk, C. et al. (2018) Stable accumulation of photosystem II requires ONE‐HELIX PROTEIN1 (OHP1) of the light harvesting‐like family. Plant Physiology, 176, 2277–2291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ohyama, K. (1996) Chloroplast and mitochondrial genomes from a liverwort, Marchantia polymorpha‐‐gene organization and molecular evolution. Bioscience, Biotechnology, and Biochemistry, 60, 16–24. [DOI] [PubMed] [Google Scholar]
  29. Ponnala, L. , Wang, Y. , Sun, Q. & van Wijk, K.J. (2014) Correlation of mRNA and protein abundance in the developing maize leaf. The Plant Journal: For Cell and Molecular Biology, 78, 424–440. [DOI] [PubMed] [Google Scholar]
  30. Rojas, M. , Williams‐Carrier, R. , Chotewutmontri, P. , Belcher, S. , Boyce, E. & Barkan, A. (2025) Opposing action of photosystem II assembly factors RBD1 and HCF136 underlies light‐regulated psbA translation in plant chloroplasts. Proceedings of the National Academy of Sciences of the United States of America, 122, e2423694122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sauret‐Gueto, S. , Frangedakis, E. , Silvestri, L. , Rebmann, M. , Tomaselli, M. , Markel, K. et al. (2020) Systematic tools for reprogramming plant gene expression in a simple model, Marchantia polymorpha. ACS Synthetic Biology, 9, 864–882. [DOI] [PubMed] [Google Scholar]
  32. Schult, K. , Meierhoff, K. , Paradies, S. , Toller, T. , Wolff, P. & Westhoff, P. (2007) The nuclear‐encoded factor HCF173 is involved in the initiation of translation of the psbA mRNA in Arabidopsis thaliana. Plant Cell, 19, 1329–1346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Schuster, M. , Gao, Y. , Schottler, M.A. , Bock, R. & Zoschke, R. (2020) Limited responsiveness of chloroplast gene expression during acclimation to high light in tobacco. Plant Physiology, 182, 424–435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Small, I. , Melonek, J. , Bohne, A.V. , Nickelsen, J. & Schmitz‐Linneweber, C. (2023) Plant organellar RNA maturation. Plant Cell, 35, 1727–1751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Trösch, R. , Barahimipour, R. , Gao, Y. , Badillo‐Corona, J.A. , Gotsmann, V.L. , Zimmer, D. et al. (2018) Commonalities and differences of chloroplast translation in a green alga and land plants. Nature Plants, 4, 564–575. [DOI] [PubMed] [Google Scholar]
  36. Tyystjarvi, T. , Tuominen, I. , Herranen, M. , Aro, E.M. & Tyystjarvi, E. (2002) Action spectrum of psbA gene transcription is similar to that of photoinhibition in Synechocystis sp. PCC 6803. FEBS Letters, 516, 167–171. [DOI] [PubMed] [Google Scholar]
  37. Ueda, M. , Tanaka, A. , Sugimoto, K. , Shikanai, T. & Nishimura, Y. (2014) chlB requirement for chlorophyll biosynthesis under short photoperiod in Marchantia polymorpha L. Genome Biology and Evolution, 6, 620–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang, F. , Dischinger, K. , Westrich, L.D. , Meindl, I. , Egidi, F. , Trosch, R. et al. (2023) One‐helix protein 2 is not required for the synthesis of photosystem II subunit D1 in Chlamydomonas. Plant Physiology, 191, 1612–1633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Webster, M.W. (2025) Initiation of translation in bacteria and chloroplasts. Journal of Molecular Biology, 169137, 169137. [DOI] [PubMed] [Google Scholar]
  40. Williams‐Carrier, R. , Chotewutmontri, P. , Perkel, S. , Rojas, M. , Belcher, S. & Barkan, A. (2025) The psbA ORF acts in cis to toggle HCF173 from an activator to a repressor for light‐regulated psbA translation in plants. Plant Cell, 37, koaf047. Available from: 10.1093/plcell/koaf047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Willmund, F. , Hauser, C. & Zerges, W. (2023) Translation and protein synthesis in the chloroplast. In: Grossman, A.R. & Wollman, F.A. (Eds.) The Chlamydomonas Sourcebook. 3rd edition of The Chlamydomonas Sourcebook. Amsterdam: Elsevier, pp. 467–508. [Google Scholar]
  42. Zoschke, R. & Bock, R. (2018) Chloroplast translation: structural and functional organization, operational control and regulation. Plant Cell, 30, 745–770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zoschke, R. , Watkins, K. & Barkan, A. (2013) A rapid microarray‐based ribosome profiling method elucidates chloroplast ribosome behavior in vivo. Plant Cell, 25, 2265–2275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zybailov, B. , Rutschow, H. , Friso, G. , Rudella, A. , Emanuelsson, O. , Sun, Q. et al. (2008) Sorting signals, N‐terminal modifications and abundance of the chloroplast proteome. PLoS One, 3, e1994. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1. Summary of ribo‐seq and RNA‐seq data for chloroplast genes.

TPJ-123-0-s001.xlsx (49KB, xlsx)

Data Availability Statement

The data that support the findings of this study are openly available in SRA Database at https://www.ncbi.nlm.nih.gov/sra/docs/, reference number BioProject PRJNA1233356.


Articles from The Plant Journal are provided here courtesy of Wiley

RESOURCES